Application of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy

Abstract

The present invention is applicable to the field of biomedicine and provides the use of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy. The present invention reveals the mechanism of action of the long noncoding RNA (lncRNA) MCM3AP-AS1 in diabetic cardiomyopathy (DCM). Bioinformatics screening revealed that MCM3AP-AS1 is significantly downregulated in DCM. It can act as a competitive endogenous RNA (ceRNA) to competitively bind to miR-155-5p, targeting the miR-155-5p / DHCR24 axis and promoting the expression of DHCR24 (24-dehydrocholesterol reductase), thereby enzymatically hydrolyzing H₂O₂ and alleviating oxidative stress and apoptosis in cardiomyocytes. This mechanism makes MCM3AP-AS1 a biomarker with diagnostic and therapeutic potential, providing a new target and theoretical basis for the clinical diagnosis and treatment of DCM.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy. Background Art

[0002] Diabetes mellitus (DM) is a complex metabolic disease characterized by chronic hyperglycemia. Its pathological nature lies in defective insulin secretion or dysfunction, which in turn leads to disturbances in sugar, lipid, and protein metabolism. Long-term uncontrolled blood sugar levels can trigger extensive microvascular and macrovascular lesions, affecting the kidneys, retina, nervous system, and cardiovascular system. Among these, diabetic cardiomyopathy (DCM) is the leading cause of death in diabetic patients. DCM refers to elevated left ventricular end-diastolic pressure, decreased ventricular compliance, and eventual progression to heart failure with reduced ventricular ejection fraction in DM patients, even in the absence of other causes of heart failure, such as coronary atherosclerosis, valvular disease, and hypertension.

[0003] Currently, the early diagnosis and targeted treatment of DCM face significant challenges. On the one hand, DCM has an insidious onset and lacks specific symptoms in the early stages of the disease (such as during the preserved left ventricular ejection fraction stage). Clinical diagnosis relies heavily on imaging techniques such as echocardiography and cardiac magnetic resonance imaging. However, these methods struggle to capture early signs of myocardial damage at the molecular level, making early diagnosis difficult. On the other hand, existing treatment strategies are limited to symptomatic treatments such as controlling blood sugar and delaying the progression of heart failure (such as ACE inhibitors), and lack specific therapeutic agents. Therefore, uncovering the molecular pathogenesis of DCM and screening for biomarkers with both diagnostic and therapeutic value are key to overcoming clinical bottlenecks.

[0004] Long noncoding RNAs (lncRNAs), a class of noncoding RNA molecules exceeding 200 nucleotides in length, have garnered widespread attention due to their complex and diverse mechanisms for regulating gene expression, particularly their competitive endogenous RNA (ceRNA) mechanism. The ceRNA mechanism involves lncRNAs competitively binding to microRNAs (miRNAs), inhibiting their complementary binding to the 3' untranslated region of their target RNAs, thereby hindering miRNA-induced degradation of their target mRNAs. Through this mechanism, lncRNAs can influence the expression of numerous pathogenic genes, becoming key regulators of disease. Notably, lncRNAs exhibit tissue specificity and high stability (they can be found stably in bodily fluids such as blood and saliva), making them promising noninvasive diagnostic biomarkers. Although lncRNAs are considered key molecules for addressing the challenges of diagnosis and treatment of diabetic comorbidity (DCM), their underlying mechanisms of action in DCM remain largely unknown. Furthermore, MCM3AP-AS1 has been found to be overregulated in various cancers, including colorectal cancer, prostate cancer, and liver cancer. MCM3AP-AS1 promotes tumorigenesis by participating in tumor cell proliferation, invasion, and migration, and is associated with poor patient prognosis, making it a promising biomarker and therapeutic target for various tumor types. Recent studies have also found that MCM3AP-AS1 can bind to miR-501-3p, upregulate the expression of cell adhesion molecule 3 (CADM1), enhance cell viability, and thereby mitigate lipopolysaccharide-mediated myocardial apoptosis. However, no studies have yet reported its role in diabetic cardiomyopathy (DCM). Therefore, this paper proposes the use of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy. Summary of the Invention

[0005] The purpose of the present invention is to provide the use of lncRNA MCM3AP-AS1 as a biomarker and therapeutic target for diabetic cardiomyopathy, aiming to solve the problems raised in the above background technology.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A composition for regulating oxidative stress and apoptosis of cardiomyocytes, wherein the composition uses lncRNA MCM3AP-AS1 as an active ingredient and inhibits oxidative stress and apoptosis of cardiomyocytes in a high-glucose and high-fat environment by upregulating the expression of lncRNA MCM3AP-AS1.

[0008] Furthermore, the high-sugar and high-fat environment is 33.3 mM glucose and 100 μM palmitic acid.

[0009] Furthermore, the lncRNA MCM3AP-AS1 promotes the expression of the DHCR24 gene by inhibiting the activity of miR-155-5p, thereby inhibiting oxidative stress and apoptosis of cardiomyocytes.

[0010] Furthermore, the method of inhibiting the activity of miR-155-5p includes lncRNA MCM3AP-AS1 acting as a competitive endogenous RNA to bind to miR-155-5p.

[0011] Furthermore, the expression of the lncRNA MCM3AP-AS1 is promoted by using a lentiviral vector to infect cells to overexpress lncRNA MCM3AP-AS1.

[0012] A method for regulating oxidative stress and apoptosis of cardiomyocytes in vitro, comprising applying the above-mentioned composition to cardiomyocytes cultured in a high-glucose and high-fat environment.

[0013] Application of lncRNA MCM3AP-AS1 as a biomarker for the preparation and detection of diabetic cardiomyopathy.

[0014] A kit for detecting diabetic cardiomyopathy, comprising a reagent for detecting the expression level of lncRNA MCM3AP-AS1.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This study reveals the mechanism of action of the lncRNA MCM3AP-AS1 in diabetic cardiomyopathy (DCM), providing a breakthrough in the diagnosis and treatment of DCM. Using bioinformatics tools, researchers identified MCM3AP-AS1 as a potential lncRNA involved in the development of DCM and found that it is significantly downregulated in DCM. Further studies revealed that MCM3AP-AS1 acts as a competitive endogenous RNA (ceRNA), competing with miR-155-5p to regulate the expression of DHCR24 (24-dehydrocholesterol reductase). Specifically, MCM3AP-AS1 targets the miR-155-5p / DHCR24 axis, promoting DHCR24 expression and subsequently enzymatically degrading H₂O₂, alleviating oxidative stress and apoptosis in cardiomyocytes. This molecular mechanism establishes MCM3AP-AS1 as a biomarker with both diagnostic and therapeutic potential, providing a novel target and theoretical basis for overcoming the bottlenecks in the clinical diagnosis and treatment of DCM. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1It is a volcano plot of differentially expressed lncRNAs; among them, A is the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE95894 dataset; B is the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE130279 dataset; C is the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE133225 dataset; D is the differential expression of lncRNAs between the diabetic patient group and the control group in the GSE163980 dataset; E is the differential expression of lncRNAs between the heart failure patient group and the control group in the GSE21610 dataset; F is the differential expression of lncRNAs between the heart failure patient group and the control group in the GSE46224 dataset.

[0018] Figure 2 are lncRNAs from the intersection of diabetic patients and heart failure patients; among them, A is the lncRNA that is upregulated in both diabetic patients and heart failure patients; B is the lncRNA that is downregulated in both diabetic patients and heart failure patients.

[0019] Figure 3 These are the volcano plots and heat maps for differential expression analysis of miRNA and mRNA; A is the volcano plot for miRNA; B is the heat map for miRNA; C is the volcano plot for mRNA; and D is the heat map for mRNA.

[0020] Figure 4 This is a schematic diagram of the lncRNA-miRNA-mRNA ceRNA network construction; A shows the interaction relationship between some differential lncRNAs (such as FAM225B, LOC101926887, etc.), miRNAs and mRNAs based on the ceRNA mechanism; B shows the interaction relationship between another part of differential lncRNAs (such as LINC00471, MCM3AP-AS1), miRNAs and mRNAs.

[0021] Figure 5Figure 3 is the expression difference of heart-related indexes (NPPA, NPPB, EDN1, ADM) in heart failure patients with high and low expression of MCM3AP-AS1; A is the NPPA, NPPB, EDN1, and ADM contents in the LINC00663 low expression group (LINC00663_low) and high expression group (LINC00663_high); B is the NPPA, NPPB, EDN1, and ADM contents in the LOC100286925 low expression group (LOC100286925_low) and high expression group (LOC100286925_high); C is the NPPA, NPPB, EDN1, and ADM contents in the FAM225B low expression group (FAM225B_low) and high expression group (FAM225B_high); D is the LINC00663 low expression group (LINC00663_low) and high expression group (LINC00663_high) Figure 3. NPPA, NPPB, EDN1, and ADM contents in the C00471 low expression group (LINC00471_low) and high expression group (LINC00471_high). E is the NPPA, NPPB, EDN1, and ADM contents in the FAM225A low expression group (FAM225A_low) and high expression group (FAM225A_high). F is the NPPA, NPPB, EDN1, and ADM contents in the LOC101926887 low expression group (LOC101926887_low) and high expression group (LOC101926887_high). G is the NPPA, NPPB, EDN1, and ADM contents in the MCM3AP-AS1 low expression group (MCM3AP-AS1_low) and high expression group (MCM3AP-AS1_high).

[0022] Figure 6 Schematic diagram of high-glucose and high-fat-induced oxidative stress and apoptosis in AC16 cardiomyocytes; A is the expression of 4HNE detected by Western blot and its relative expression statistics; B is the expression of cleaved caspase-3 detected by Western blot and its relative expression statistics; C is the H2O2 content statistics of the control group and the HG+HF group; D is the Hoechst 33342 staining image and apoptosis rate statistics of the control group and the HG+HF group; E is the relative expression statistics of MCM3AP-AS1 in the control group and the HG+HF group.

[0023] Figure 7Schematic diagram of overexpression of MCM3AP-AS1 inhibiting high-glucose and high-fat-induced oxidative stress and apoptosis in AC16 cardiomyocytes; A shows the cell morphology and green fluorescence of the two groups; B shows the relative expression of MCM3AP-AS1 detected by RT-qPCR; C shows the protein expression of 4HNE and Cleaved caspase-3 detected by Western blot; D shows the relative expression of 4HNE; E shows the relative expression of Cleaved caspase-3; F shows the H2O2 content; and G shows the cell apoptosis stained with Hoechst33342.

[0024] Figure 8 Figure 3 is a schematic diagram of the reduced expression of DHCR24 in AC16 cardiomyocytes treated with high glucose and high fat; A is the average values ​​of heart failure indicators NPPA and MCAM in the DHCR24 low expression group (DHCR24_low) and high expression group (DHCR24_high); B is the average values ​​of apoptosis indicators CASP10, CASP12, CASP2, BCL211, and APAF1 in the DHCR24 low expression group and high expression group; C is the relative expression level of DHCR24 mRNA in AC16 cardiomyocytes detected by RT-qPCR; D is the expression of DHCR24 protein by Western blot and the statistics of its relative expression level.

[0025] Figure 9 Figure 3 is a schematic diagram of how overexpression of MCM3AP-AS1 promotes DHCR24 expression; A is the relative mRNA expression level of DHCR24 in AC16 cardiomyocytes of each group; B is the expression of DHCR24 protein in each group detected by Western blot; C is the relative expression statistics of Figure B.

[0026] Figure 10 Schematic diagram of AC16 cardiomyocytes with DHCR24 expression inhibition; A shows the relative expression levels of DHCR24 mRNA in each group detected by RT-qPCR when AC16 cardiomyocytes were transfected with three DHCR24-siRNAs; B shows the expression of DHCR24 protein in each group detected by Western blot and the statistics of relative expression levels when AC16 cardiomyocytes were transfected with three DHCR24-siRNAs; C shows the relative expression levels of DHCR24 mRNA in each group detected by RT-qPCR when MCM3AP-AS1 was overexpressed; D shows the expression of DHCR24 protein in each group detected by Western blot and the statistics of relative expression levels when MCM3AP-AS1 was overexpressed.

[0027] Figure 11Figure 1 is a schematic diagram showing that inhibiting DHCR24 can reverse the protective effect of MCM3AP-AS1 against high-glucose and high-fat-induced cardiomyocyte injury; Figure A is a Western blot analysis of the protein expression of 4HNE, an oxidative stress indicator, and Cleaved caspase-3, an apoptosis indicator, in different treatment groups; Figure B is a bar graph quantifying the expression level of 4HNE protein in Figure A; Figure C is a bar graph quantifying the expression level of Cleaved caspase-3 protein in Figure A; Figure D is the H2O2 content in different treatment groups; Figure E is a Hoechst33342 staining image (bright blue nuclei represent apoptotic cells) and a bar graph of the apoptotic cells in different treatment groups.

[0028] Figure 12 Schematic diagram of MCM3AP-AS1 targeting miR-155-5p to promote DHCR24 expression; A is the relative expression of miR-155-5p mRNA in each group, reflecting the effects of high sugar and high fat and overexpression of MCM3AP-AS1; B is the relative expression of miR-155-5p mRNA in each group, showing the effect of transfection with mimic-miR-155-5p; C is the relative expression of DHCR24 mRNA in each group; D is the effect of overexpression of miR-155-5p on the luciferase activity of MCM3AP-AS1-WT and MCM3AP-AS1-MT (the left figure in D is the website predicted miR-155-5p and MCM3AP-AS1 binding sites. The right figure is a dual-luciferase reporter gene experiment verifying the binding of MCM3AP-AS1 to miR-155-5p); E is the effect of overexpression of miR-155-5p on the luciferase activity of DHCR24-WT and DHCR24-MT (the left figure in E is the website prediction of miR-155-5p binding to DHCR24, and the right figure is a dual-luciferase reporter gene experiment verifying the binding of miR-155-5p to DHCR24).

[0029] Figure 13 Schematic diagram of overexpression of miR-155-5p reversing the promoting effect of MCM3AP-AS1 on DHCR24 expression; wherein: A is the relative mRNA expression level of DHCR24 in each group; B is the protein expression of DHCR24 in each group detected by Western blot; C is the relative expression level of DHCR24 in each group.

[0030] Figure 14Overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on AC16 cell damage induced by high glucose and high fat; A is the protein expression of 4HNE and Cleaved caspase-3 in each group detected by Western blot; B is the relative expression level of 4HNE in each group; C is the relative expression level of Cleaved caspase-3 in each group; D is the H2O2 content in each group; E is the Hoechst33342 staining image and the cell apoptosis rate in each group.

[0031] Figure 15 It is a diagram of the molecular mechanism of the present invention. DETAILED DESCRIPTION

[0032] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of implementation of the present invention.

[0033] The present invention proposes a molecular mechanism diagram as shown below Figure 15 MCM3AP-AS1 targets the miR-155-5p / DHCR24 axis and inhibits the occurrence of oxidative stress and apoptosis in diabetic cardiomyopathy.

[0034] The nucleotide sequence of MCM3AP-AS1 is shown in SEQ ID NO.1:

[0035]

[0036] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0037] Example 1: Database screening of differentially expressed lncRNAs, miRNAs, and mRNAs in patients with diabetic cardiomyopathy;

[0038] 1.1 Database screening of differentially expressed lncRNAs in patients with diabetic cardiomyopathy;

[0039] The GEO2R bioinformatics tool was used to perform differential analysis on multiple datasets, screen for differentially expressed lncRNAs between the disease group and the control group, and calculate log2 (FC) and p-values. There were 66 differentially expressed lncRNAs in GSE95894, of which 46 were upregulated and 20 were downregulated in diabetic patients ( Figure 1 Middle A). There are 388 differentially expressed lncRNAs in GSE130279, of which 283 are upregulated and 105 are downregulated in diabetic patients ( Figure 1 Middle B). There are 422 differentially expressed lncRNAs in GSE133225, 197 of which are upregulated and 225 are downregulated in diabetic patients ( Figure 1 Middle C). There are 223 differentially expressed lncRNAs in GSE163980, of which 117 are upregulated and 106 are downregulated in diabetic patients ( Figure 1 There are 247 differentially expressed lncRNAs in GSE21610, of which 63 are upregulated and 184 are downregulated in heart failure patients ( Figure 1 Middle E). There are 110 differentially expressed lncRNAs in GSE46224, of which 66 are upregulated and 44 are downregulated in heart failure patients ( Figure 1 Middle F).

[0040] A Venn diagram was used to obtain lncRNAs with consistent expression in the diabetic patient dataset and the heart failure patient dataset. The lncRNAs upregulated in both diabetic patients and heart failure patients included LINC00663, LOC101926887, FAM225B, FAM225A, and LOC100286925 ( Figure 2 Middle A), lncRNAs downregulated in both diabetic patients and heart failure patients include MCM3AP-AS1, LINC00471 ( Figure 2 Middle B).

[0041] 1.2 Identification of differentially expressed miRNAs and mRNAs;

[0042] Differential analysis was performed on miRNA and mRNA datasets. There were 70 differentially expressed miRNAs in GSE185845, of which 56 were upregulated and 14 were downregulated in patients with diabetic ischemic cardiomyopathy. There were 233 differentially expressed mRNAs in GSE26887, of which 131 were upregulated and 102 were downregulated in patients with diabetic heart failure. Finally, a volcano plot was performed on the differentially expressed miRNA genes and mRNA genes ( Figure 3 A and C) and heat map plots ( Figure 3 B and D).

[0043] 1.3 Construction of lncRNA-miRNA-mRNA network;

[0044] The ceRNA network was constructed by Cytoscape for the screened differential lncRNAs, miRNAs, and mRNAs. Based on the ceRNA theory, we used shared miRNAs as the connection points and constructed the ceRNA network using 7 differential lncRNAs (LINC00663, LOC101926887, FAM225B, FAM225A, LOC100286925, MCM3AP-AS1, LINC00471), 70 differential miRNAs, and 233 differential mRNAs ( Figure 4 A and B).

[0045] 1.4 lncRNA MCM3AP-AS1 is negatively correlated with heart failure markers;

[0046] LINC00663, LOC100286925, LINC00471 and MCM3AP-AS1 are differentially expressed lncRNAs in the heart failure dataset GSE21610, and FAM225B, FAM225A and LOC101926887 are lncRNAs in the heart failure dataset GSE46224. The seven differentially expressed lncRNAs that may be associated with DCM were divided into lncRNA high expression group and low expression group according to the median dichotomy in their corresponding datasets, and the heart failure indicators NPPA (natriuretic peptide pro-A), NPPB (brain natriuretic peptide pro-B), EDN1 (endothelin 1) and ADM (adrenomedullin) were compared to see whether there were differences in the two groups with high and low expression of lncRNAs. The results are as follows Figure 5 As shown in Figure AG, compared with the LINC0063 low expression group, the levels of NPPA, NPPB, and EDN1 in the LINC0063 high expression group were higher and statistically significant ( p <0.05), there was no statistically significant difference in ADM; the levels of NPPA and END1 in the LOC100286925 high expression group were higher than those in the LOC100286925 low expression group and were statistically significant ( p<0.05), NPPB and ADM were not statistically significant; there were no statistically significant differences in the levels of NPPA, NPPB, EDN1 and ADM between the FAM225B high expression group and the LINC00471 high expression group and the low expression group; the levels of NPPA, NPPB and ADM in the FAM225A high expression group were higher than those in the FAM225A low expression group and were statistically significant ( p <0.05); EDN1 had no statistical significance; the NPPA and NPPB contents in the LOC101926887 high expression group were high and statistically significant (p<0.05); EDN1 and ADM had no statistical difference; compared with the MCM3AP-AS1 low expression group, the NPPA, NPPB, EDN1 and ADM contents in the MCM3AP-AS1 high expression group were low and statistically significant ( p <0.05). Of the seven differentially expressed lncRNAs identified as potentially associated with DCM, only MCM3AP-AS1 affected all heart failure markers. Furthermore, these predictive heart failure markers decreased in the MCM3AP-AS1 high-expression group, suggesting that MCM3AP-AS1 may play a protective role in cardiac function. Therefore, MCM3AP-AS1 was selected for subsequent research. Based on the ceRNA network diagram established in Result 1.3, it was found that MCM3AP-AS1 may target the miR-155-5p / DHCR24 pathway.

[0047] Example 2: lncRNA MCM3AP-AS1 inhibits the occurrence of cardiomyocyte oxidative stress and apoptosis induced by high glucose and high fat;

[0048] 2.1 High glucose and high fat induce oxidative stress and apoptosis in AC16 cardiomyocytes and reduce the expression of MCM3AP-AS1;

[0049] AC16 cardiomyocytes were divided into a control group (control) and a high-glucose, high-fat group (HG+HF group). The control group received 27.8 mmol mannitol as a control. The HG+HF group received a high-glucose, high-fat treatment with 33.3 mmol glucose and 100 μM palmitic acid to establish a high-glucose, high-fat-induced AC16 cardiomyocyte injury model. Both groups were cultured in DMEM / F12 medium containing 5.5 mmol glucose for 48 hours. Western blot analysis was performed to measure oxidative stress markers (4HNE) and apoptosis markers (cleaved caspase-3). A hydrogen peroxide kit was used to detect hydrogen peroxide (H2O2) levels. Hoechst 33342 staining was used to observe cardiomyocyte apoptosis.

[0050] Western blot results showed that the expression of oxidative stress indicator 4HNE and apoptosis indicator Cleavedcaspase-3 increased in the HG+HF group ( Figure 6 A and B, p <0.05). H2O2 content test showed that the H2O2 content in the HG+HF group was significantly higher than that in the control group ( Figure 6 Middle C, p <0.01). Hoechst 33342 staining showed that the number of apoptotic cells with bright blue nuclei increased in the HG+HF group, and the apoptosis rate was statistically significantly higher than that in the control group ( Figure 6 Middle D, p <0.0001), indicating that high sugar and high fat induce AC16 cardiomyocyte damage, manifested as oxidative stress and cell apoptosis. RT-qPCR detection found that in AC16 cardiomyocytes treated with high sugar and high fat, the expression of MCM3AP-AS1 was reduced ( Figure 6 Middle E, p <0.05).

[0051] 2.2 Overexpression of MCM3AP-AS1 inhibits high glucose and high fat-induced oxidative stress and apoptosis in AC16 cardiomyocytes;

[0052] AC16 cardiomyocytes were divided into two groups: the empty transfection group (LV-Vector) and the LV-MCM3AP-AS1 group. The empty transfection group was a cell group transfected with an empty lentiviral vector and served as a control; the LV-MCM3AP-AS1 group was a cell group overexpressing MCM3AP-AS1 using lentivirus. After grouping and treatment, the cells were tested. Figure 7 As shown in A and B, cells in both the empty vector group (LV-Vector) and the LV-MCM3AP-AS1 group expressed GFP green fluorescent protein, and RT-qPCR detected that the mRNA level of MCM3AP-AS1 group was significantly increased, indicating that AC16 cardiomyocytes overexpressing MCM3AP-AS1 were obtained ( p <0.0001). To further verify whether overexpression of MCM3AP-AS1 can inhibit oxidative stress and apoptosis, the study set up the following group experiments: NC group: When the growth density of AC16 cardiomyocytes reached 60%-70%, the vector virus solution was added to establish a stable cell line; LV-MCM3AP-AS1 group: When the cell growth density reached 60%-70%, the vector virus solution overexpressing MCM3AP-AS1 was added to establish a cell line stably overexpressing MCM3AP-AS1; HG+HF / LV-MCM3AP-AS1: AC16 cells that have stably overexpressed MCM3AP-AS1 were treated with high glucose and high fat for 48 hours. The results are shown in the figure below. Figure 7As shown in Figure CG, compared with the NC group, the expressions of 4HNE and Cleaved caspase-3 in the HG+HF group were significantly increased, the H2O2 content was increased, and more bright blue cells were observed in Hoechst33342 staining; while the above indicators were significantly decreased in the LV-MCM3AP-AS1 group and the HG+HF / LV-MCM3AP-AS1 group compared with the HG+HF group ( p <0.05). This indicates that overexpression of MCM3AP-AS1 can effectively inhibit the occurrence of oxidative stress and apoptosis in AC16 cardiomyocytes induced by high glucose and high fat, indicating that MCM3AP-AS1 plays an important protective role in regulating the response of cardiomyocytes to high glucose and high fat injury.

[0053] Example 3: MCM3AP-AS1 inhibits oxidative stress and apoptosis in AC16 cardiomyocytes by promoting DHCR24 expression;

[0054] 3.1 DHCR24 expression is reduced in AC16 cardiomyocytes treated with high glucose and high fat;

[0055] First, we used the diabetic heart failure dataset GSE26887 to analyze the relationship between DHCR24 and heart failure and myocardial apoptosis. The data were divided into DHCR24 high expression group and DHCR24 low expression group based on the median value of DHCR24 expression in the dataset. Figure 8 As shown in A and B, compared with the DHCR24 low expression group, the heart failure indicators NPPA and MCAM (melanoma cell adhesion molecule) and apoptosis indicators CASP10 (caspase 10), CASP12, CASP2, BCL211 (apoptosis promoting factor), and APAF (apoptosis enzyme activating factor) in the DHCR24 high expression group were significantly reduced ( p <0.05), suggesting that DHCR24 may inhibit the occurrence of apoptosis and the progression of heart failure in patients with diabetic heart failure. In AC16 cardiomyocytes, the expression of DHCR24 was detected by RT-qPCR and Western blot. Compared with the control group, the mRNA and protein expression of DHCR24 in the HG+HF group was significantly decreased ( Figure 8 Middle C and D, p <0.05).

[0056] 3.2 Overexpression of MCM3AP-AS1 promotes DHCR24 expression;

[0057] The expression changes of DHCR24 in AC16 cardiomyocytes were detected by RT-qPCR and Western blot. Figure 9As shown in Figures AC. It can be seen that compared with the Control group, the mRNA and protein expression levels of DHCR24 in the HG+HF group were significantly decreased, indicating that high sugar and high fat can induce the downregulation of DHCR24 expression; compared with the HG+HF group, the mRNA and protein expression levels of DHCR24 in the HG+HF / LV-MCM3AP-AS1 group were significantly increased ( p <0.05), indicating that overexpression of MCM3AP-AS1 can restore the mRNA and protein levels of DHCR24. These results suggest that MCM3AP-AS1 may target DHCR24 to exert its effects.

[0058] 3.3 Obtaining AC16 cardiomyocytes with suppressed DHCR24 expression;

[0059] The present invention designed three siRNAs targeting DHCR24 (si-DHCR24-01, si-DHCR24-02, si-DHCR24-03) and a negative control siRNA (si-NC):

[0060] si-DHCR24-01 sequence: 5′–UUUCUUGGUGUCCACUUCCAG–3′ (as shown in SEQ ID NO. 2);

[0061] si-DHCR24-02 sequence: 5′–AUUGCCAAUGCUAUUCAGCUU–3′ (as shown in SEQ ID NO. 3);

[0062] si-DHCR24-03 sequence: 5′–UUGUCUUCAGAUAGUUCUCCA–3′ (as shown in SEQ ID NO. 4);

[0063] si-NC sequence: 5'–ACGUGACACGUUCGGAGAATT–3' (as shown in SEQ ID NO. 5).

[0064] Each siRNA at a concentration of 50 nM was transfected into AC16 cardiomyocytes. Figure 10 As shown in A and B, si-DHCR24-01, si-DHCR24-02, and si-DHCR24-03 can all reduce the expression of DHCR24 mRNA and protein in AC16 cardiomyocytes ( p <0.001). Subsequently, three DHCR24 siRNAs were transfected into cardiomyocytes overexpressing MCM3AP-AS1. The results were as follows Figure 10As shown in C and D, compared with HG+HF / LV-MCM3AP-AS1+si-NC, the expression of DHCR24 mRNA and protein were significantly decreased after transfection with si-DHCR24-01, si-DHCR24-02, and si-DHCR24-03 ( p <0.01), indicating that under high-glucose and high-fat conditions and under conditions of overexpression of MCM3AP-AS1, the three DHCR24-siRNAs could effectively inhibit DHCR24. Therefore, si-DHCR24-02 and si-DHCR24-03 were randomly selected for subsequent experiments.

[0065] 3.4 Inhibition of DHCR24 can reverse the protective effect of MCM3AP-AS1 against high glucose and high fat-induced cardiomyocyte injury;

[0066] To investigate whether MCM3AP-AS1 inhibits oxidative stress by promoting DHCR24 expression, we observed the changes in cell damage after knocking down DHCR24 in AC16 cardiomyocytes overexpressing MCM3AP-AS1. Figure 11 As shown in Figures AE, compared with the control group (Control group), the expressions of 4HNE and Cleaved caspase-3 in the HG+HF group were increased, the H2O2 content was increased, and Hoechst33342 staining showed an increase in apoptotic cells. Compared with the HG+HF group, the above-mentioned injury indicators were significantly decreased in the MCM3AP-AS1 overexpression and high-glucose and high-fat stimulation group (HG+HF / LV-MCM3AP-AS1 group). However, compared with the HG+HF / LV-MCM3AP-AS1 group, the above-mentioned injury indicators were significantly increased after transfection of si-DHCR24-02 (HG+HF / LV-MCM3AP-AS1+si-DHCR24-02 group) and si-DHCR24-03 (HG+HF / LV-MCM3AP-AS1+si-DHCR24-03 group) in the MCM3AP-AS1 overexpression group ( p <0.05). This indicates that knockdown of DHCR24 can reverse the protective effect of MCM3AP-AS1 on cardiomyocytes, that is, MCM3AP-AS1 inhibits high-glucose and high-fat-induced cardiomyocyte injury by promoting the expression of DHCR24.

[0067] Example 4: MCM3AP-AS1 protects cardiomyocytes by targeting miR-155-5p and promoting the expression of DHCR24;

[0068] 4.1 MCM3AP-AS1 targets miR-155-5p to promote DHCR24 expression;

[0069] The present invention designed a mimic-miR-155-5p that overexpresses miR-155-5p and a negative control mimic-NC:

[0070] mimic-miR-155-5p sequence: 5'-CCCCUAUCACGAUUAGCAUUAAUU-3' (as shown in SEQ ID NO. 6);

[0071] Mimic-NC sequence: 5'-UACUCUUUCUAGGAGGUUGUGAUU-3' (as shown in SEQ ID NO. 7).

[0072] Using lncBase and Starbase, we found that miR-155-5p has binding sites with MCM3AP-AS1 and DHCR24, respectively. First, we verified that MCM3AP-AS1 regulates miR-155-5p expression. Figure 12 As shown in middle A, compared with the control group (Control group), the HG+HF group induced upregulation of miR-155-5p expression, while the overexpression of MCM3AP-AS1 (LV-MCM3AP-AS1 group and HG+HF / LV-MCM3AP-AS1 group) significantly inhibited the expression of miR-155-5p ( p <0.01). 50 nM mimic-miR-155-5p was transfected into AC16 cardiomyocytes. Figure 12 As shown in Figure B, the relative expression level of miR-155-5p mRNA in the mimic-miR-155-5p group was significantly increased compared with the mimic-NC group and the Control group (p < 0.0001). Figure 12 As shown in center C, the relative mRNA expression level of DHCR24 in the mimic-miR-155-5p group was significantly lower than that in the mimic-NC group and the Control group (p < 0.0001). This suggests that MCM3AP-AS1 may regulate the expression of DHCR24 by targeting miR-155-5p.

[0073] To further verify the targeting relationship among the three, a dual luciferase reporter gene experiment was used. Figure 12 As shown in Figure D, compared with the NC group, overexpression of miR-155-5p (hsa-miR-155-5p group) significantly decreased the luciferase activity of MCM3AP-AS1 wild type (MCM3AP-AS1-WT) (p < 0.001), but had no significant effect on the luciferase activity of MCM3AP-AS1 mutant (MCM3AP-AS1-MT). Figure 12As shown in Figure E, overexpression of miR-155-5p (hsa-miR-155-5p group) downregulated luciferase activity in wild-type DHCR24 (DHCR24-WT) cells (p < 0.001), whereas no significant change was observed in the mutant DHCR24 (DHCR24-MT) group. These results suggest that miR-155-5p can directly bind to MCM3AP-AS1 and DHCR24, respectively.

[0074] 4.2 Overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on AC16 cardiomyocyte injury induced by high glucose and high fat;

[0075] AC16 cardiomyocytes overexpressing MCM3AP-AS1 were transfected with 50 nM miR-155-5p and stimulated with high glucose and high fat to detect the expression of DHCR24. Figure 13 As shown in Figures AC, DHCR24 mRNA and protein expression levels were significantly decreased in the HG+HF group compared with the control group. In the HG+HF / LV-MCM3AP-AS1 group, overexpression of MCM3AP-AS1 restored DHCR24 expression. However, DHCR24 mRNA and protein expression were further decreased in the HG+HF / LV-MCM3AP-AS1+mimic-miR-155-5p group compared with the HG+HF / LV-MCM3AP-AS1+mimic-NC group (p < 0.05). This suggests that miR-155-5p inhibits DHCR24 expression and reverses the promoting effect of MCM3AP-AS1 on DHCR24 expression.

[0076] To further verify the effect of interfering with miR-155-5p on the cardioprotective effect of MCM3AP-AS1, the changes in cell damage after overexpressing miR-155-5p in AC16 cardiomyocytes overexpressing MCM3AP-AS1 were observed. Figure 14As shown in Figures AE, compared with the control group, the expressions of 4HNE, an indicator of oxidative stress, and Cleaved caspase-3, an indicator of apoptosis, were increased in the HG+HF group, as was the H2O2 content. Hoechst33342 staining showed an increase in apoptotic cells. Compared with the HG+HF group, overexpression of MCM3AP-AS1 in the HG+HF / LV-MCM3AP-AS1 group inhibited the increase in the above-mentioned myocardial cell oxidative stress and apoptosis indicators. However, in the MCM3AP-AS1 overexpression group, transfection of mimic-miR-155-5p (HG+HF / LV-MCM3AP-AS1+mimic-miR-155-5p group) significantly increased the expressions of 4HNE and Cleaved caspase-3 proteins, the H2O2 content, and the number of apoptotic cells, which were higher than those in the HG+HF / LV-MCM3AP-AS1 group. These results suggest that overexpression of miR-155-5p reverses the protective effect of MCM3AP-AS1 on cardiomyocytes, indicating that MCM3AP-AS1 inhibits high-glucose and high-fat-induced cardiomyocyte injury by targeting miR-155-5p and promoting the expression of DHCR24.

[0077] The above are only preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, several variations and improvements can be made without departing from the concept of the present invention. These should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. Use of a composition in the preparation of a drug for inhibiting oxidative stress and apoptosis in diabetic cardiomyopathy, characterized in that: The composition uses lncRNA MCM3AP-AS1 as an active ingredient, and the nucleotide sequence of the lncRNA MCM3AP-AS1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The lncRNA MCM3AP-AS1 promotes the expression of the DHCR24 gene by inhibiting the activity of miR-155-5p, thereby achieving the effect of inhibiting myocardial cell oxidative stress and apoptosis.

3. The use according to claim 2, characterized in that The method for inhibiting the activity of miR-155-5p includes lncRNA MCM3AP-AS1 acting as a competing endogenous RNA to bind to miR-155-5p.

4. The use according to claim 2, characterized in that The method for promoting the expression of the lncRNA MCM3AP-AS1 is to use a lentiviral vector to infect cells to overexpress lncRNA MCM3AP-AS1.

5. Use of a reagent for detecting the expression level of lncRNA MCM3AP-AS1 in preparing a kit for detecting diabetic cardiomyopathy, characterized in that: The nucleotide sequence of the lncRNA MCM3AP-AS1 is shown in SEQ ID NO.1.

Images