Extract for treating pulmonary nodule and application thereof

Abstract

The invention relates to the technical field of traditional Chinese medicines and foods, in particular to an extract for treating pulmonary nodules and application thereof, and the extract is a sonchus oleraceus water extract. According to the invention, it is found and proposed for the first time that the sonchus oleraceus extract can be applied to prevention and treatment of pulmonary nodules, compared with traditional glucocorticoids and other drugs, toxic and side effects or adverse reactions are small, and it is found that compatibility of sonchus oleraceus, platycodon grandiflorum and pulvis glycyrrhizae praeparata has a synergistic interaction effect.

Description

Technical Field

[0001] The present invention relates to the technical field of traditional Chinese medicine or food, and particularly relates to an extract for treating pulmonary nodules and its application. Background Art

[0002] Sarcoidosis is a granulomatous disease with unknown etiology. 90% of sarcoidosis cases involve the lungs. Pulmonary sarcoidosis not only mainly causes respiratory diseases, but also affects the quality of life of patients and increases psychological distress. Sarcoidosis is a disease with non-caseating epithelioid granulomas as pathological manifestations (a disease involving multiple systems of the whole body), and the lungs and thoracic lymph nodes are most commonly involved. At present, there is no radical treatment method, and glucocorticoids are still the first choice drugs, but long-term use of glucocorticoids can cause serious adverse reactions. Therefore, there is a need to develop new safe and effective drugs for treating sarcoidosis. Summary of the Invention

[0003] In view of the above problems, the present invention selects natural raw materials of medicine and food homology, and researches and develops a combined extract for treating pulmonary nodules without adverse reactions, providing new methods, new drugs, and new products for the treatment of pulmonary nodules.

[0004] To achieve the above object, the present invention adopts the following technical scheme:

[0005] An extract for treating pulmonary nodules, wherein the extract is a water extract of Sonchus oleraceus L.

[0006] Preferably, the extraction method of the water extract of Sonchus oleraceus L. comprises the following steps:

[0007] (1) Take the above-ground part of Sonchus oleraceus L., dry it in the shade, pulverize and sieve it to obtain Sonchus oleraceus L. powder for later use;

[0008] (2) Add the Sonchus oleraceus L. powder to water, carry out decoction extraction, and filter to obtain the Sonchus oleraceus L. filtrate;

[0009] (3) Carry out vacuum concentration on the filtrate obtained in step (2) to obtain a concentrated solution;

[0010] (4) Spray-dry the concentrated solution obtained in step (3) to obtain the water extract of Sonchus oleraceus L.

[0011] Preferably, in step (1), the temperature for drying in the shade is 20 - 30°C, the humidity is 10 - 20%, and after pulverization, it is sieved through a 60 - 100 mesh sieve;

[0012] In step (2), the material-liquid ratio of the Sonchus oleraceus L. powder to water is 1 g : 1 - 20 mL, the pH value is 5 - 7; the decoction temperature is 90 - 110°C, and the decoction time is 2 - 4 h;

[0013] In step (3), the vacuum degree for decompression concentration is -0.1 mpa to -0.08 mpa, and the concentration density is 1.05 - 1.14;

[0014] In step (4), the spray drying temperature is an inlet temperature of 120 - 125 °C and an outlet temperature of 60 - 70 °C.

[0015] Preferably, the extract further includes platycodon water extract and / or oldenlandia water extract;

[0016] The preparation method of the platycodon water extract or oldenlandia water extract is as follows: using platycodon root or oldenlandia as raw materials, water as a solvent for decoction extraction and decompression extraction, and then drying to obtain platycodon water extract / oldenlandia water extract.

[0017] Preferably, in the preparation method of the platycodon water extract or oldenlandia water extract, the material-liquid ratio is 1 g: 1 - 20 mL, the pH value is 5 - 7; the decoction time is 2 - 4 h, and the decoction temperature is 90 - 110 °C; the vacuum degree for decompression concentration is -0.1 mpa to -0.08 mpa, and the concentration density is 1.05 - 1.14; the spray drying temperature is an inlet temperature of 120 - 125 °C and an outlet temperature of 60 - 70 °C.

[0018] Preferably, the platycodon water extract and the sowthistle water extract are compounded in a mass ratio of (1 - 5):(5 - 9).

[0019] Preferably, the platycodon water extract and the sowthistle water extract are compounded in a mass ratio of (1 - 3):(7 - 9).

[0020] Preferably, the oldenlandia water extract, the platycodon water extract and the sowthistle water extract are compounded in a mass ratio of 3:4:1.

[0021] On the other hand, the present invention also provides an application of the above extract in the preparation of a drug for treating lung nodules.

[0022] Furthermore, the drug uses the extract as an active ingredient, alone or in combination with other drugs, and is prepared into a pharmaceutically acceptable dosage form by adding pharmaceutically acceptable excipients, auxiliary components or carriers.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] Sonchus oleraceus is an annual or biennial herb of the genus Sonchus in the Compositae family. It is often used as a wild vegetable in folk. According to "Flora Reipublicae Popularis Sinicae" and "Compendium of Chinese Herbal Medicine", the whole herb of Sonchus oleraceus is used as medicine, with the effects of clearing heat and detoxifying, cooling blood and stopping bleeding. It is used for enteritis, dysentery, acute icteric infectious hepatitis, appendicitis, mastitis, stomatitis, pharyngitis, tonsillitis, hematemesis, epistaxis, hemoptysis, hematochezia, metrorrhagia and metrostaxis; externally, it is used for treating carbuncles and sores, otitis media. However, there is no report on the study of Sonchus oleraceus in improving pulmonary nodules.

[0025] Platycodon grandiflorum has a bitter, pungent and neutral property and belongs to the lung meridian. Modern research has found that Platycodon grandiflorum mainly contains triterpenoid saponins, platycodin polysaccharide and other components, and has the effects of dispersing the lung qi, relieving sore throat, resolving phlegm and discharging pus. It is used for cough with profuse phlegm, chest distress, sore throat with hoarse voice, and lung abscess with expectoration.

[0026] Pulvis Glycyrrhizae Praeparatus has a sweet, salty and cold property. It belongs to the heart and stomach meridians. It has the effects of clearing heat and cooling blood, purging fire and detoxifying. It is commonly used for epidemic febrile diseases, maculae due to warm diseases, high fever with restlessness and thirst, blood heat in pox, erysipelas, sores and ulcers.

[0027] The present invention discovers and proposes for the first time that the extract of Sonchus oleraceus can be applied to the prevention and treatment of pulmonary nodules. Compared with traditional drugs such as glucocorticoids, it has less toxic and side effects or adverse reactions, and it is found that the compatibility of Sonchus oleraceus with Platycodon grandiflorum and Pulvis Glycyrrhizae Praeparatus has a synergistic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Appendix Figure 1 It is a comparison chart of the body weight changes of mice in each group in Example 1;

[0029] Appendix Figure 2 It is a sectional view of the pulmonary nodule size of mice in each group in Example 1;

[0030] Appendix Figure 3 It is a comparison chart of the serum SAA levels of mice in each group in Example 1;

[0031] Appendix Figure 4 It is a comparison chart of the anti-inflammatory factor IL-10 levels of mice in each group in Example 1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0033] Example 1

[0034] 1.1 Preparation of the extract

[0035] Extract of Sonchus oleraceus:

[0036] (1) Take the above-ground part of Sonchus oleraceus, dry it in the shade (the drying temperature is 25°C and the humidity is 10%), crush it and sieve it (60-mesh sieve) to obtain Sonchus oleraceus powder for standby;

[0037] (2) Add the Sonchus oleraceus powder to water, where the material-liquid ratio is 1:10 (g·mL -1 ), the pH value is 6, carry out decoction extraction, the decoction time is 2 h, the decoction temperature is 100°C, and obtain the Sonchus oleraceus extract by centrifugation;

[0038] (3) Carry out vacuum concentration on the filtrate obtained in step (2) to obtain a concentrated solution, the vacuum degree of vacuum concentration is -0.08 mpa, and the concentration density is 1.10;

[0039] (4) Spray-dry the concentrated solution obtained in step (3), the spray-drying temperature is 120°C at the inlet and 70°C at the outlet to obtain the Sonchus oleraceus extract.

[0040] Platycodon grandiflorum extract:

[0041] (1) Add the root of Platycodon grandiflorum to water, where the material-liquid ratio is 1:10 (g·mL -1 ), carry out decoction extraction, the decoction time is 2 h, the decoction temperature is 90°C, and obtain the Platycodon grandiflorum extract by centrifugation;

[0042] (2) Carry out vacuum concentration on the filtrate obtained in step (1) to obtain a concentrated solution, the vacuum degree of vacuum concentration is 0.08 mpa, and the concentration density is 1.08;

[0043] (3) Spray-dry the concentrated solution obtained in step (2), the spray-drying temperature is 120°C at the inlet and 60°C at the outlet to obtain the Platycodon grandiflorum extract.

[0044] Human feces fermentation product extract:

[0045] (1) Add human feces fermentation product to water, where the material-liquid ratio is 1:10 (g·mL -1 ), carry out decoction extraction, the decoction time is 2 h, the decoction temperature is 100°C, and obtain the human feces fermentation product extract by centrifugation;

[0046] (2) Carry out vacuum concentration on the filtrate obtained in step (1) to obtain a concentrated solution, the vacuum degree of vacuum concentration is -0.08 mpa, and the concentration density is 1.06;

[0047] (3) Spray-dry the concentrated solution obtained in step (1), the spray-drying temperature is 120°C at the inlet and 65°C at the outlet to obtain the human feces fermentation product extract.

[0048] 1.2 Experimental animal grouping

[0049] 110 female C57BL / 6 mice, 6 - 8 weeks old, weighing 20 g. After acclimating to the environment, they were randomly divided into 11 groups of 10 mice each, namely the control group (Con group), the model group (Mod group), and the experimental groups (extract of Renzhonghuang 200 mg / kg, extract of Platycodon grandiflorum 200 mg / kg, extract of Sonchus oleraceus 200 mg / kg, extract of Renzhonghuang:extract of Platycodon grandiflorum:extract of Sonchus oleraceus 3:4:1200 mg / kg, extract of Renzhonghuang:extract of Platycodon grandiflorum 3:4 200 mg / kg, extract of Sonchus oleraceus:extract of Platycodon grandiflorum 3:7 200 mg / kg, extract of Sonchus oleraceus:extract of Platycodon grandiflorum 5:5 200 mg / kg, extract of Sonchus oleraceus:extract of Platycodon grandiflorum 1:9 200 mg / kg). Hereinafter, for the sake of simplicity, the water extracts in each group are omitted and only the raw material names are retained.

[0050] 1.3 Establishment of a mouse model of pulmonary nodules.

[0051] 110 female C57 BL / 6 mice, 6 - 8 weeks old, weighing 20 g. After being raised for one week, the formal experiment began. Except for the control group, mice in other groups were instilled with 10^9 CFU of Cutibacterium acnes (ATCC 6919 = NCTC737) through the trachea to construct a mouse model of pulmonary nodules. After modeling, mice in the control group and the model group were gavaged with PBS (100 μL / d) as a placebo. Mice in the experimental groups were gavaged with 200 mg / kg of traditional Chinese medicine. On the 9th day, the mice were sacrificed by cervical dislocation.

[0052] 1.4 Monitoring of mouse body weight

[0053] Day 0 was before modeling, and days 1, 3, 5, 7, and 9 were the 1st, 3rd, 5th, 7th, and 9th days after modeling respectively.

[0054] 1.5 Preparation of mouse serum

[0055] After collecting blood from the mouse orbital cavity, the EP tubes were centrifuged at 5000 r / min for 10 min, and the serum was transferred to a new EP tube and stored in a -80 °C refrigerator for later use.

[0056] 1.6 Detection of serum amyloid A (SAA) level by ELISA

[0057] Take out the ELISA kit (SAA) from the 4 °C refrigerator and equilibrate it at room temperature for 30 min to restore it to room temperature. Dilute the standard product according to the kit instructions and make a standard curve according to the instructions. Detect the OD value of the sample according to the instructions and calculate the SAA level by substituting it into the standard curve.

[0058] 1.7 Histomorphological observation

[0059] Paraffin embed and section the lung tissue. Take 1 cm of lung tissue and place it in a fixative (10% formalin) for fixation. Then gradually dehydrate the tissue block with 85%, 95%, and 100% ethanol. After dehydration, place the tissue block in xylene, a clearing agent. After the xylene replaces the alcohol, place the tissue block in molten paraffin at 65 °C for 2 h. After impregnation, place it in an embedding mold for wax filling. After the wax block cools and solidifies, fix the wax block on the specimen holder of the microtome and cut continuous sections with a thickness of 4 μm. Dry (60 °C, 2 h) for later use. HE staining. (1) Deparaffinize the sections with xylene for 15 min / 2 times, and then sequentially place them in ethanol with gradient concentrations for 8 min each. (2) Stain with hematoxylin staining solution for 5 min. After terminating the staining, wash thoroughly with water and air dry. (3) Perform differentiation treatment three times with 1% hydrochloric acid ethanol solution, wash thoroughly with water and air dry. (4) Blue with saturated lithium carbonate aqueous solution, wash thoroughly with water and air dry. (5) Stain with 1% alcohol-soluble eosin solution for 6 min. After terminating the staining, wash thoroughly with water and air dry. (6) Dehydrate in ethanol with a concentration gradient for 5 min each, air dry, and mount the slides for later use. (7) Observe and take pictures with an upright fluorescence microscope.

[0060] 1.8 qPCR detection of the level of anti-inflammatory factor IL-10 in lung tissue

[0061] After grinding 0.05 g of lung tissue with liquid nitrogen, add RNAlyzol to extract total RNA. After reverse transcribing the extracted RNA into cDNA, perform fluorescence quantitative PCR detection. Use the 2 -△△Ct method to calculate the relative expression level of the target gene.

[0062] The primer sequences of β-actin and IL-10 in Table 1 were synthesized by Genewiz Biotechnology Co., Ltd. The primer sequences are shown in Table 1:

[0063] Table 1 Primer sequences of β-actin and IL-10

[0064] Primer Sequence (5’→3’) IL-10-F GGTTGCCAAGCCTTATCGGAA IL-10-R TGGCTGGGGAAGCAGCTTGATG β-actin-F AGAGGGAAATCGTGCGTGAC β-actin-R CAATAGTGATGACCTGGCCGT

[0065] 1.9 Synergistic effect

[0066] The synergistic effect is evaluated by calculating the interaction index γ through experiments to evaluate the compounding ability

[0067] The formula for calculating the theoretical IC50add value of the compound is IC50add = IC50A / (K1 + Q × K2);

[0068] In the formula: Q is the potency ratio when extracts A and B act alone, i.e., Q = IC50A / IC50B; K1 and K2 are the proportions of Sonchus oleraceus extract (Renshonghuang extract) and Platycodon grandiflorum extract in the compounding system, respectively, and K2 = 1 - K1;

[0069] Through the above experiments, the actual IC50mix value of the complex can be calculated, and the theoretically required concentration IC50add value after the compounding of the extract of Sonchus oleraceus (extract of Renzhonghuang) and the extract of Platycodon grandiflorum can be obtained. By comparing the two, if IC50mix < IC50add, it can prove that the compounding of the two samples has a synergistic effect on improving pulmonary nodules. The strength of the synergistic effect between the compounds is represented by the γ value, and the calculation formula is γ

[0070] = IC50Amix / IC50A + IC50Bmix / IC50B;

[0071] In the formula: IC50Amix and IC50Bmix are the respective IC50 values of the extract of Sonchus oleraceus (extract of Renzhonghuang) and the extract of Platycodon grandiflorum in the compounding system; IC50A and IC50B are the IC50 values of the extract of Sonchus oleraceus (extract of Renzhonghuang) and the extract of Platycodon grandiflorum when acting alone; if γ = 1, it indicates that the interaction is additive; if γ < 1, it indicates that there is synergy between the two, and the lower the γ value, the stronger the synergistic effect; if γ > 1, it indicates that the interaction is an antagonistic effect.

[0072] SPSS 19.0 software was used for statistical analysis. The results of measurement data were expressed as (x±s). One-way ANOVA was used for comparison among multiple groups, and t-test was used for comparison between two groups; count data were tested by x2 test (exact probability method), and p < 0.05 was considered statistically significant.

[0073] 2 Experimental results

[0074] 2.1 Effects on body weight

[0075] From Figure 1 the results, it can be seen that compared with the Con group, the body weights of the mice decreased after modeling. Compared with the model group, the body weights increased after intragastric administration of the extract.

[0076] 2.2 Effects on lung tissue morphology

[0077] From Figure 2 and Table 2 results, it can be seen that compared with the Con group, the model group had nodules, larger alveoli, and more obvious inflammatory cell infiltration. Compared with the model group, the inflammation was reduced and the nodules were smaller in the groups treated with intragastric administration of the extract, especially in the Sonchus oleraceus group, the Sonchus oleraceus:Platycodon grandiflorum = 1:9 group, the Renzhonghuang:Platycodon grandiflorum = 3:4 group, and the Renzhonghuang:Platycodon grandiflorum:Sonchus oleraceus = 3:4:1 group, and the nodule size was less than 50 μm.

[0078] Table 2 Effects on the size of pulmonary nodules

[0079] Group Nodule size (μm) con 0 mod 112 cyc 45 Platycodon grandiflorum 54 Decoction of fermented human feces 50 Sonchus oleraceus 40 Decoction of fermented human feces:Platycodon grandiflorum = 3:4 46 Sonchus oleraceus:Platycodon grandiflorum = 3:7 50 Sonchus oleraceus:Platycodon grandiflorum = 5:5 80 Sonchus oleraceus:Platycodon grandiflorum = 1:9 38 Decoction of fermented human feces:Platycodon grandiflorum:Sonchus oleraceus = 3:4:1 46

[0080] 2.3 Effects on serum SAA level

[0081] It can be seen from Figure 3 the results that, compared with the Con group, the level of SAA in the serum of the model group was significantly increased; compared with the model group, the levels of SAA in the serum of each experimental group decreased, and the effects of each experimental group were not very different, but the levels of SAA in the Platycodon grandiflorum group, the Sonchus oleraceus group, the Human Yellow: Platycodon grandiflorum: Sonchus oleraceus = 3:4:1 group, and the Sonchus oleraceus: Platycodon grandiflorum = 3:7 group were significantly down-regulated.

[0082] 2.4 Effect on anti-inflammatory factor IL-10

[0083] It can be seen from Figure 4 the results that, compared with the Con group, the level of IL-10 in the model group decreased, and after intragastric administration of the extract, the levels of IL-10 all increased. Among them, the levels of IL-10 in the Platycodon grandiflorum group, the Sonchus oleraceus group, the Sonchus oleraceus: Platycodon grandiflorum = 1:9 group, and the Sonchus oleraceus: Platycodon grandiflorum = 3:7 group increased significantly.

[0084] 2.5 Synergistic effect

[0085] It can be seen from Table 4 that the theoretical IC50mix values are all smaller than the experimental IC50add values, and the γ values of each group are also less than 1. That is to prove that the effect of improving the size of pulmonary nodules after the re-combination of Sonchus oleraceus extract and Platycodon grandiflorum extract in different proportions is stronger than that of the single action, and has a synergistic effect.

[0086] Table 3 Synergistic effect of different compound formulas on the size of pulmonary nodules

[0087] Ratio <![CDATA[IC50 add / mg·kg -1 > <![CDATA[IC50mix / mg·kg -1 > Synergy index Sonchus oleraceus:Platycodon grandiflorum = 3:7 107.41 106.19 0.96 Sonchus oleraceus:Platycodon grandiflorum = 5:5 121.64 120.57 1.16 Sonchus oleraceus:Platycodon grandiflorum = 1:9 78.23 77.49 0.48 Decoction of fermented human feces:Platycodon grandiflorum = 3:4 97.11 96.89 0.92

[0088] To sum up, the Sonchus oleraceus, the Sonchus oleraceus: Platycodon grandiflorum = 1:9, the Sonchus oleraceus: Platycodon grandiflorum = 3:7, and the Human Yellow: Platycodon grandiflorum = 3:4 groups can all be used to treat pulmonary nodules, especially the ratio of Sonchus oleraceus: Platycodon grandiflorum = 1:9 has a better effect.

[0089] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An extract for treating pulmonary nodules, characterized in that, The extract is the aqueous extract of Sonchus oleraceus L..

2. The extract for treating pulmonary nodules according to claim 1, wherein, The extraction method of the aqueous extract of Sonchus oleraceus L. comprises the following steps: (1) Take the aerial part of Sonchus oleraceus L., dry it in the shade, crush and sieve it to obtain Sonchus oleraceus L. powder for standby; (2) Add the Sonchus oleraceus L. powder into water, carry out decoction extraction, and filter to obtain the Sonchus oleraceus L. filtrate; (3) Carry out vacuum concentration on the filtrate obtained in step (2) to obtain a concentrated solution; (4) Spray-dry the concentrated solution obtained in step (3) to obtain the aqueous extract of Sonchus oleraceus L..

3. An extract for treating pulmonary nodules according to claim 2, characterized in that, In step (1), the temperature for drying in the shade is 20 - 30 °C, the humidity is 10 - 20%, and after crushing, it is sieved through a 60 - 100 mesh sieve; In step (2), the material-liquid ratio of the Sonchus oleraceus L. powder to water is 1 g : 1 - 20 mL, and the pH value is 5 - 7; the decoction temperature is 90 - 110 °C, and the decoction time is 2 - 4 h; In step (3), the vacuum degree for vacuum concentration is -0.1 mpa to -0.08 mpa, and the concentration density is 1.05 - 1.14; In step (4), the spray-drying temperature is 120 - 125 °C for the inlet temperature and 60 - 70 °C for the outlet temperature.

4. An extract for treating pulmonary nodules as described in claim 1, characterized in that, The extract further comprises the aqueous extract of Platycodon grandiflorum and / or the aqueous extract of human urine sediment; The preparation method of the aqueous extract of Platycodon grandiflorum or the aqueous extract of human urine sediment is: using the root of Platycodon grandiflorum or human urine sediment as the raw material, water as the solvent, carrying out decoction extraction and vacuum extraction, and then drying to obtain the aqueous extract of Platycodon grandiflorum / or the aqueous extract of human urine sediment.

5. An extract for treating lung nodules according to claim 4, characterized in that, In the preparation method of the aqueous extract of Platycodon grandiflorum or the aqueous extract of human urine sediment, the material-liquid ratio is 1 g : 1 - 20 mL, and the pH value is 5 - 7; the decoction time is 2 - 4 h, and the decoction temperature is 90 - 110 °C; the vacuum degree for vacuum concentration is -0.1 mpa to -0.08 mpa, and the concentration density is 1.05 - 1.14; the spray-drying temperature is 120 - 125 °C for the inlet temperature and 60 - 70 °C for the outlet temperature.

6. An extract for treating pulmonary nodules according to claim 4, wherein, The aqueous extract of Platycodon grandiflorum and the aqueous extract of Sonchus oleraceus L. are compounded according to the mass ratio of (1 - 5) : (5 - 9).

7. An extract for treating lung nodules according to claim 4, characterized in that, The aqueous extract of Platycodon grandiflorum and the aqueous extract of Sonchus oleraceus L. are compounded according to the mass ratio of (1 - 3) : (7 - 9).

8. An extract for treating pulmonary nodules according to claim 4, characterized in that, The aqueous extract of human urine sediment, the aqueous extract of Platycodon grandiflorum and the aqueous extract of Sonchus oleraceus L. are compounded according to the mass ratio of 3 : 4 :

1.

9. The application of the extract according to any one of claims 1 - 8 in the preparation of a drug for treating lung nodules.

10. The application according to claim 9, characterized in that, The drug uses the extract as the active ingredient, alone or in combination with other drugs, and is prepared into a pharmaceutically acceptable dosage form by adding pharmaceutically acceptable excipients, auxiliary components or carriers.

Images