Polyene macrolactam antibiotic Weidelmycin as well as production method and production strain thereof

Abstract

The invention discloses a polyene macrolactam antibiotic Weidel, a production method thereof and a production strain. According to the invention, a bacterial artificial chromosome library of streptomyces DSS69 genome DNA is constructed, bacterial artificial chromosomes containing polyene macrolactam compound biosynthetic gene clusters are selected from the bacterial artificial chromosome library, and are cloned and subjected to heterologous expression, antibacterial activity screening and compound separation and identification, so that the novel polyene macrolactam antibiotics are found; the compound is named as Weddelamycin, and the compound is named as Weddelamycin. An antibacterial experiment is further carried out on the Weddellamycin, the Weddellamycin has very good antibacterial activity on all tested gram-positive strains, and the MIC (minimal inhibitory concentration) value of the Weddellamycin is between 0.14 mu g / mL and 1.07 mu g / mL. Especially, the MIC values to MRSA, MRSE and enterococcus faecalis are 0.14 [mu] g / mL, 0.27 [mu] g / mL and 1.07 [mu] g / mL respectively.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and relates to a polyene macrolactam antibiotic, weddellamycin, its production method, and production strain; specifically, it relates to the discovery of a novel polyene macrolactam antibiotic, especially the discovery of a novel polyene macrolactam antibiotic, weddellamycin, its production strain, and its fermentation method. Background Art

[0002] Polyene macrolactam compounds (PMLs) are mainly produced by Streptomyces and Micromonospora. Their structural characteristics are the presence of a 16-34 membered lactam ring, and the amide functional group is connected to two unsaturated fragments. In addition, various unique structural modifications on the PMLs molecule ring further diversify its structure: including rings with hydroxyl and methyl groups, hydrophobic structures with hydrocarbon chains, long chains linked with glycosides, intramolecular epoxidation, and intramolecular polycyclic structures. The unique biosynthetic pathway of polyene macrolactams, including β-amino acids as the starting unit, cyclization reactions, and necessary post-modifications, endows these compounds with structural diversity and broad biological activities, such as antibacterial (bombyxamycin A-C [1] and BE-14106 [2]), antifungal (streptolactams A [3]), antitumor (vicenistatin [4]), antiparasitic (lobosamides [5]), and anti-inflammatory (cyclamenol A [6]).

[0003] Some typical PMLs have good antifungal activity, such as sceliphrolactam [7], cremimycin [8], and macrotermycins [3, 9]. Amphotericin B is generally considered the last line of defense against life-threatening fungal infections, but its application is limited due to its high cytotoxicity

[10] . Different from the mechanism of action of most clinically used antifungal antibiotics targeting the ergosterol biosynthesis pathway

[11] , some antifungal PMLs have unique antifungal mechanisms. For example, the action of auroramycin on yeast cells is to disrupt the structural organization and membrane integrity of vacuoles

[12] ; heronamide C has potential antifungal activity due to its saturated hydrocarbon chain that can insert into the phospholipid bilayer

[13] . Such broad-spectrum antibacterial activity and special antifungal mechanisms make polyene macrolactam antibiotics very promising in drug research and development.

[0004] Bioinformatics analysis reveals that there are a large number of biosynthetic gene clusters for polyene macrolactam antibiotics in the Streptomyces genome. Mining the Streptomyces genome and heterologous expression of gene clusters contribute to the isolation and identification of PMLs molecules corresponding to these gene clusters, and it is possible to discover new antibacterial substances from them, providing more valuable new compounds for drug development.

[0005] 1. Shin, Y.; Beom, J.Y.; Chung, B.; Shin, Y.; Byun, W.S.; Moon, K.; Bae, M.; Lee, S.K.; Oh, K.; Shin, J.; Yoon, Y..J.; Oh, D. Bombyxamycins A and B, cytotoxic macrocyclic lactams from an intestinal bacterium of the silkworm Bombyx mori. Org. Lett. 2019, 21, 1804 - 1808.

[0006] 2. Katsuhisa Kojiri; Shigeru Nakajima; Suzuki., H.; Hisao Kondo; Suda, H. A new marocyclic lactam antibiotic, BE - 14106 I. Taxonomy, isolation, biological activity and structural elucidation. The Journal of Antibiotics 1992, 45, 868 - 874.

[0007] 3. Wang, P.; Wang, D.; Zhang, R.; Wang, Y.; Kong, F.; Fu, P.; Zhu, W. Novel macrolactams from a deep - sea - derived Streptomyces species. Mar. Drugs 2021, 19, 13.

[0008] 4. Shindo, K.; Kamishohara, M.; Odagawa, A.; Matsuoka, M.; Kawai, H. Vicenistatin, a novel 20 - membered macrocyclic lactam antitumor antibiotic. 1993, 46, 1076 - 1081.

[0009] 5. Schulze, C.J.; Donia, M.S.; Siqueira-Neto, J.L.; Ray, D.; Raskatov, J.A.; Grean, R.E.; Mckerrow, J.H.; Fischbach, M.A.; Linington, R.G. Genome-directed lead discovery: biosynthesis, structure elucidation, and biological evaluation of two families of polyene macrolactams against Trypanosoma brucei. ACS Chem. Biol. 2015, 10, 2373 - 2381.

[0010] 6. Shen, J.; Fan, Y.; Zhu, G.; Chen, H.; Zhu, W.; Fu, P. Polycyclic macrolactams generated via intramolecular Diels-Alder reactions from an Antarctic Streptomyces species. Org. Lett. 2019, 21, 4816 - 4820.

[0011] 7. Low, Z.J.; Pang, L.M.; Ding, Y.; Cheang, Q.W.; Le Mai Hoang, K.; Thi Tran, H.; Li, J.; Liu, X.; Kanagasundaram, Y.; Yang, L.; Liang, Z. Identification of a biosynthetic gene cluster for the polyene macrolactam sceliphrolactam in a Streptomyces strain isolated from mangrove sediment. Sci. Rep. 2018, 8.

[0012] 8. Luo, H.; Liu, H.; Cao, Y.; Xu, D.; Mao, Z.; Mou, Y.; Meng, J.; Lai, D.; Liu, Y.; Zhou, L. Enhanced production of botrallin and TMC-264 with in situ macroporous resin adsorption in mycelial liquid culture of the endophytic fungus Hyalodendriella sp. Ponipodef12. Molecules 2014, 19, 14221 - 14234.

[0013] 9. Udwary, D.W.; Zeigler, L.; Asolkar, R.N.; Singan, V.; Lapidus, A.; Fenical, W.; Jensen, P.R.; Moore, B.S. Genome sequencing reveals complex secondary metabolome in the marine actinomycete Salinispora tropica. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 10376 - 10381.

[0014] 10. Kaur, L.; Abhijeet; Jain, S.K. Safe and effective delivery of amphotericin b: a survey of patents. Recent Pat. Nanotechnology 2017, 11, 214.

[0015] 11. Ottilie, S.; Goldgof, G.M.; Cheung, A.L.; Walker, J.L.; Vigil, E.; Allen, K.E.; Antonova-Koch, Y.; Slayman, C.W.; Suzuki, Y.; Durrant, J.D. Two inhibitors of yeast plasma membrane ATPase 1 (ScPmalp): toward the development of novel antifungal therapies. J. Cheminformatics 2018, 10.

[0016] 12. Wong, J.H.; Alfatah, M.; Kong, K.W.; Hoon, S.; Yeo, W.L.; Ching, K.C.; Jie Hui Goh, C.; Zhang, M.M.; Lim, Y.H.; Wong, F.T.; Arumugam, P. Chemogenomic profiling in yeast reveals antifungal mode-of-action of polyene macrolactam auroramycin. PLoS One 2019, 14, e218189.

[0017] 13. Fujita, K.; Sugiyama, R.; Nishimura, S.; Ishikawa, N.; Arai, M.A.; Ishibashi, M.; Kakeya, H. Stereochemical assignment and biological evaluation of BE-14106 unveils the importance of one acetate unit for the antifungal activity of polyene macrolactams. J. Nat. Prod. 2016, 79, 1877 - 1880. Summary of the Invention

[0018] The object of the present invention is to solve the problem that most of the current research on polyene macrolactam compounds is in the early stage, the number of discovered compounds is small, and there is a need to explore new structural molecules with antibacterial activity to provide more candidate molecules for drug development. The present invention provides a polyene macrolactam antibiotic, widelmycin, and its production method and production strain. The present invention discovers polyene macrolactam compounds with high antibacterial activity in Streptomyces, providing precursors for drug research and development.

[0019] The present invention constructs a bacterial artificial chromosome library of Streptomyces DSS69 genomic DNA, selects bacterial artificial chromosome clones containing the polyene macrolactam biosynthetic gene cluster from it, conducts heterologous expression, antibacterial activity screening, and compound isolation and identification, and discovers a new polyene macrolactam antibiotic named Weddellamycin. Further antibacterial experiments were carried out on Weddellamycin. Its antibacterial experiments were carried out on Gram-positive strains Staphylococcus aureus ATCC25923, methicillin-resistant Staphylococcus aureus (MRSA), methicillin-resistant Staphylococcus epidermidis (MRSE), Enterococcus faecalis ATCC29212, Micrococcus luteus ATCC4698, Bacillus alpinus 41KF2b, and Listeria monocytogenes ATCC BAA-679, the fungus Candida albicans, and the Gram-negative strain Escherichia coli DH10B, with the antibacterial effect of ampicillin as a comparison. Weddellamycin has good antibacterial activity against all tested Gram-positive strains, and its MIC values are between 0.14 - 1.07 μg / mL. In particular, the MIC values for MRSA, MRSE, and Enterococcus faecalis are 0.14, 0.27, and 1.07 μg / mL respectively, while the MIC values of ampicillin are all ≥ 50 μg / mL. The MIC value for Candida albicans is 2.15 μg / mL, while the MIC value of ampicillin is > 100 μg / mL. In particular, the activity of Enterococcus faecalis is superior to that of the similar compound piceamycin (32 ± 0 μg / mL), and the similar compounds bombyxamycins do not inhibit the activity of Enterococcus faecalis. It is worth noting that: weddellamycin has the activity against the fungus Candida albicans, which has not been reported for the similar compounds piceamycin and bombyxamycins in the existing literature.

[0020] Specifically, to achieve the above object, the present invention provides the following technical solutions:

[0021] In the first aspect, the present invention provides a polyene macrolactam compound (Weddellamycin), and its planar structural formula is as follows:

[0022]

[0023] In the second aspect, the present invention provides the production strain of the aforementioned Weddellamycin, which is constructed by a method including the following steps: heterologously expressing the bacterial artificial chromosome clone containing the polyene macrolactam biosynthetic gene cluster, and obtaining the production strain through antibacterial activity screening and PCR verification.

[0024] As an embodiment of the present invention, genomic DNA of Streptomyces sp. DSS69 was extracted to construct a bacterial artificial chromosome library; a bacterial artificial chromosome clone containing the gene cluster was selected from the bacterial artificial chromosome library by PCR.

[0025] As an embodiment of the present invention, the primers used in PCR are as follows:

[0026] 15-1-F: CACACAGCGCCGCTCCAGCT,

[0027] 15-1-R: ATGTCCACGCCCGTCAACGT;

[0028] 15-2-F: CGTTCGCTGCGGGAGGTCATC,

[0029] 15-2-R: GCTTCCAGGGTGAGTTCCTC;

[0030] 15-3-F: GTGCAGATGACTGAGTCGGG,

[0031] 15-3-R: GCCGCTCCAGGACGAAGACG;

[0032] 15-4-F: TCAGGTGCACTTCTTGTCGT,

[0033] 15-4-R: GCTATCTCCAGGGGTACGCG.

[0034] As an embodiment of the present invention, the host bacteria for heterologous expression include Streptomyces lividans and Streptomyces albus.

[0035] As an embodiment of the present invention, the host bacteria for heterologous expression is Streptomyces lividans GX28.

[0036] As an embodiment of the present invention, the sequence of the polyene macrolactam compound biosynthetic gene cluster is as shown in SEQ ID NO.1.

[0037] In a third aspect, the present invention also provides an engineered strain capable of producing the compound Weddellamycin - Streptomyces lividans SLG106 (also denoted as: Streptomyces lividans GX28 / pBAC11H09), and its preservation number is CGMCC No. 28826.

[0038] The specific construction method is as follows:

[0039] (1) Genomic sequencing was performed on Streptomyces sp. DSS69 isolated from the Weddell Sea floor in Antarctica. Bioinformatics analysis confirmed that the genome of DSS69 contains a biosynthetic gene cluster for PML - like compounds, named the Weddellamycin gene cluster. The DNA sequence is shown in SEQ ID NO.1.

[0040] (2) The genomic DNA of Streptomyces sp. DSS69 was extracted to construct a bacterial artificial chromosome library. Bacterial artificial chromosome clones containing the Weddellamycin gene cluster were selected from this library by PCR and denoted as pBAC11H09.

[0041] (3) The bacterial artificial chromosome clone pBAC11H09 was integrated into the genome of Streptomyces lividans GX28 by conjugation transfer.

[0042] (4) Through antibacterial activity screening and PCR verification, the genetically engineered recombinant strain Streptomyces lividans GX28 / pBAC11H09 capable of producing the compound Weddellamycin was obtained.

[0043] In a fourth aspect, the present invention also provides a production method of Weddellamycin. The aforementioned Weddellamycin - producing strain is fermented, separated and purified to obtain the polyene macrolactam compound Weddellamycin.

[0044] As an embodiment of the present invention, the fermentation is carried out using fermentation medium R5a for fermentation culture, and the solid fermentation product is collected; after extraction and concentration, it is adsorbed by macroporous resin and eluted with water, 50% methanol - water, and 100% methanol; the 100% methanol elution fraction is recovered and vacuum - concentrated, and then separated by liquid chromatography to obtain pure Weddellamycin.

[0045] In some specific embodiments, the present invention also establishes a method for the fermentation, separation, and purification of a new polyene macrolactam compound, Weddellamycin, as follows:

[0046] (1) Ferment the recombinant strain Streptomyces lividans GX28 / pBAC11H09 on the fermentation medium R5a for 6 - 7 days, and collect the solid fermentation product;

[0047] (3) Extract the solid fermentation product three times with an equal volume of acetonitrile, and concentrate it in vacuo until only water remains;

[0048] (4) Adsorb the concentrated extract on macroporous resin HP20, and elute it with water, 50% methanol - water, and 100% methanol;

[0049] (5) Recover and concentrate the 100% methanol elution fraction in vacuo, and perform liquid - phase separation twice to obtain pure Weddellamycin, with the molecular formula C 27 H 29 NO4, and the relative molecular mass is determined to be m / z 432.2166 [M + H] + . Through nuclear magnetic data analysis, its planar structure was obtained, and through electronic circular dichroism spectroscopy testing and theoretical calculations, its absolute configuration was deduced.

[0050] The high - performance liquid chromatography (HPLC) preparation conditions for Weddellamycin are as follows:

[0051] The HPLC column model is Agilent Zorbax SB - C18 (5μm, 9.4×250mm).

[0052] The mobile phase is:

[0053] The first preparation (coarse fractionation): Phase A is water, and phase B is methanol; the elution conditions are: isocratic elution with 68% B for 20 min, flow rate is 2 mL / min, and Weddellamycin elutes at 16.9 min; concentrate in vacuo for the second preparation and purification;

[0054] The second preparation (refinement): Phase A is water, and phase B is acetonitrile; the elution conditions are: isocratic elution with 47% B for 16 min, flow rate is 3.24 mL / min, and Weddellamycin elutes at 14.8 min.

[0055] The detection wavelength is 300 nm for both.

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] 1) The present invention provides a new polyene macrolactam compound, enriching the variety of polyene macrolactam compounds;

[0058] 2) The compounds obtained in this invention have broad-spectrum antibacterial activities, and have good antibacterial activities against drug-resistant strains MRSE, MRSA and the fungus Candida albicans, providing precursor substances for the research and development of drugs, especially antibiotics.

[0059] Streptomyces lividans SLG106 of this invention has been deposited with the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on October 31, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No. 28826.

[0060] Streptomyces sp. DSS69 of this invention has been deposited with the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 6, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No. 29252. Description of the Drawings

[0061] By reading the detailed description of the non-limiting embodiments with reference to the following drawings, other features, purposes and advantages of this invention will become more obvious:

[0062] Figure 1 It is the liquid-phase detection chart for the expression of Weddellamycin; among them, S.lividans GX28 / vector is the empty plasmid vector integrated for constructing the bacterial artificial chromosome, as a control;

[0063] Figure 2 It is the mass spectrum of Weddellamycin;

[0064] Figure 3 It is the planar structure and the speculated absolute configuration of Weddellamycin; among them, (a) is the planar structure of Weddellamycin, and (b) is the speculated absolute configuration;

[0065] Figure 4 It is for Weddellamycin 1 1H spectrum (DMSO-d6);

[0066] Figure 5 It is for Weddellamycin 13 13C spectrum and HSQC spectrum (DMSO-d6), among which, (a) is 13 13C spectrum, and (b) is HSQC spectrum;

[0067] Figure 6HMBC spectrum of Weddellamycin and 1 H- 1 H COSY spectrum (DMSO-d6), where (a) is HMBC and (b) is 1 H- 1 H COSY spectrum. Detailed implementation manners

[0068] The present invention will be described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several adjustments and improvements can still be made. These all fall within the protection scope of the present invention.

[0069] The experimental techniques and methods used in this embodiment are all conventional technical methods unless otherwise specified. The materials, reagents, etc. used in this example can be obtained through regular commercial channels unless otherwise specified.

[0070] Culture media and uses:

[0071] 1. LB medium: for culturing Escherichia coli;

[0072] Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, made up to 1,000 mL with deionized water, pH 7.0.

[0073] 2. 2×YT medium: for indirect conjugation transfer between Escherichia coli and Streptomyces;

[0074] Tryptone 16 g, yeast extract 10 g, sodium chloride 5 g, made up to 1,000 mL with deionized water, pH 7.0.

[0075] 3. TSBY medium: for liquid culture of strains;

[0076] Sucrose 103 g, yeast extract 5 g, TSB 30 g, made up to 1,000 mL with deionized water, pH 7.2 - 7.4, sterilized at 115 °C for 30 min.

[0077] 4. Freezing Medium: for culturing and preserving bacterial artificial chromosomes;

[0078] Tryptone 10 g, sodium chloride 10 g, yeast extract 5 g, dipotassium hydrogen phosphate 6.27 g, potassium dihydrogen phosphate 1.8 g, ammonium sulfate 0.9 g, sodium citrate 0.5 g, glycerol 44 mL, made up to 1,000 mL with deionized water, pH 7.0.

[0079] Add magnesium sulfate to a final concentration of 0.4 mM before use.

[0080] 5. Mueller Hinton medium: used for culturing indicator bacteria such as Staphylococcus aureus during MIC determination, purchased from oxiod.

[0081] 6. MS medium: for spore production and related conjugation transfer of Streptomyces;

[0082] 20 g of soybean cake powder, 20 g of mannitol, made up to 1,000 mL with tap water, pH 7.2 - 7.4, add 20 g of agar per liter to prepare solid medium.

[0083] Soak 20 g of soybean cake powder in 1,000 mL of tap water, sterilize at 121 °C for 30 min, then filter to collect the soybean cake powder extract to prepare the medium.

[0084] 7. R5a medium: for Streptomyces fermentation to isolate and purify compounds;

[0085] 100 g of sucrose, 0.25 g of potassium sulfate, 10.12 g of magnesium chloride hexahydrate, 5 g of yeast extract, 0.1 g of tyrosine amino acid, 10 g of glucose, 21 g of MOPS, made up to 1,000 mL with deionized water, pH 6.85, add 20 g of agar per liter to prepare solid medium, sterilize at 116 °C for 30 min.

[0086] Before use, add 2 mL of trace element solution (40 μg of sodium hydroxide, 20 μg of zinc chloride, 20 μg of ferric chloride hexahydrate, 10 μg of manganese chloride and 10 μg of (NH4)6Mo7O 24 ·4H2O, made up to 1,000 mL with deionized water) to each liter of medium.

[0087] The heterologous expression host Streptomyces lividans GX28 is described in the literature "Engineered Streptomyces lividans Strains for Optimal Identification and Expression of Cryptic Biosynthetic Gene Clusters".

[0088] The strains Staphylococcus aureus ATCC25923, Micrococcus luteus ATCC4698, Enterococcus faecalis ATCC29212, and Listeria monocytogenes ATCC BAA-679 involved in the bioactivity assay of the present invention are all preserved in the laboratory, and the public can obtain them from the American Type Culture Collection (ATCC). Methicillin-resistant Staphylococcus aureus [MRSA] and methicillin-resistant Staphylococcus epidermidis [MRSE] are both preserved in the laboratory and were gifted by Teacher Ju Jianhua from the South China Sea Institute of Oceanology, Chinese Academy of Sciences. The public can purchase them from Shanghai Xinyu Biotechnology Co., Ltd. Bacillus alpinus 41KF2b and Candida albicans are preserved in the laboratory and were gifted by Teacher Mo Tianlu from the University of Shanghai for Science and Technology. The public can purchase them from Beijing BioWin Biotechnology Co., Ltd. Escherichia coli DH10B is preserved in the laboratory, and the public can purchase it from Invitrogen.

[0089] Example 1: Construction of an expression strain of a bacterial artificial chromosome containing Weddellamycin

[0090] The construction of the bacterial artificial chromosome library of Streptomyces sp. DSS69 was completed by Wuhan Bakingstar Biotechnology Co., Ltd. with reference to "Construction and Application of a Bacterial Artificial Chromosome (BAC) Vector Suitable for Cloning and Heterologous Expression of Large-Fragment Genomic DNA of Streptomyces" in Acta Microbiologica Sinica (2012) 52(1).

[0091] 1. Take out the bacterial artificial chromosome library of Streptomyces sp. DSS69 (24 96-well plates) from the -80°C refrigerator and place it in a 37°C incubator for 2 h until completely melted;

[0092] 2. Add 150 μL of fresh Freezing Medium to a new sterile 96-well plate, and use a 48-well replicator to inoculate the bacterial artificial chromosome library of DSS69 into the 96-well plate. Incubate at 37°C and 220 rpm for 4 - 6 h, and usually store it at -80°C;

[0093] 3. Add 20 mL of fresh LB medium to a new sterile petri dish, use a 48-well replicator to mix each plate of the bacterial artificial chromosome library of DSS69 into the petri dish, and pour the mixed solution in the petri dish into a 50 mL centrifuge tube. Incubate at 37°C and 220 rpm overnight to obtain the mixed plate bacterial solution for each 96-well plate;

[0094] 4. Extract the mixed plasmid, prepare the reaction system shown in Table 2 using the primers in Table 1, and perform PCR according to the procedure shown in Table 3. Using the fact that amplification bands can be obtained with all four pairs of primers as an indication, localize the bacterial artificial chromosome containing Weddellamycin to the specific plate of the library;

[0095] 5. Add 20 mL of fresh LB medium to a new sterile petri dish. Use a multichannel pipette to aspirate the bacterial suspension in each column of the plate determined in step 4, mix it into the petri dish, and pour the mixed solution in the petri dish into a 50 mL centrifuge tube. Incubate overnight at 37 °C and 220 rpm to obtain the mixed-column bacterial suspension of each well plate;

[0096] 6. Extract the mixed plasmid, perform PCR using the primers in Table 1, with the method the same as in step 4. Using the fact that amplification bands can be obtained with all four pairs of primers as an indication, localize the bacterial artificial chromosome containing Weddellamycin to the specific column of the library;

[0097] 7. Take a 50 mL centrifuge tube and add 20 mL of fresh LB medium. Aspirate the content of each well in the determined column into the centrifuge tube and incubate overnight at 37 °C and 220 rpm;

[0098] 8. Extract the mixed plasmid, perform PCR using the primers in Table 1. Using the fact that amplification bands can be obtained with all four pairs of primers as an indication, obtain the bacterial artificial chromosome-containing bacterium DH10B / pBAC11H09 with Weddellamycin;

[0099] 9. Extract the plasmid pBAC11H09 and electrotransform it into Escherichia coli ET12567 to obtain the strain ET12567 / pBAC11H09;

[0100] 10. Inoculate this Escherichia coli into 5 mL of fresh LB medium (containing 50 μg / ml apramycin). At the same time, inoculate the strain ET12567 / pUB307 into 5 mL of fresh LB medium (containing 50 μg / ml kanamycin) and incubate at 37 °C and 220 rpm for 4 - 6 h;

[0101] 11. Take 1 mL of the bacterial suspension from each, centrifuge at 4,000 rpm for 10 min to collect the two types of bacteria, wash them 3 times with fresh LB medium, and then resuspend them in 200 μL of LB;

[0102] 12. Obtain spores from the S. lividans GX28 culture plate and add them to 50 mL of fresh TSBY medium. Incubate at 30 °C and 220 rpm for two days;

[0103] 13. Take 3 mL of the bacterial solution, centrifuge at 4,000 rpm for 10 min to collect the mycelium, wash it 3 times with fresh 2×YT medium, and then resuspend it with 1 mL of 2×YT;

[0104] 14. Mix the two types of Escherichia coli and the mycelium, spread them on an MS plate (containing magnesium chloride or magnesium sulfate at a final concentration of 20 mM), dry them in a biosafety cabinet, and culture at 30 °C for 12 - 16 h;

[0105] 15. Cover the MS plate with trimethoprim and apramycin to a final concentration of 50 μg / ml, dry it in a biosafety cabinet, and culture at 30 °C for 4 - 6 d until the conjugants grow out;

[0106] 16. Use a toothpick to pick a single conjugant onto an MS plate containing nalidixic acid (25 μg / ml) and apramycin (50 μg / ml) to remove the residual Escherichia coli and the recipient Streptomyces lividans GX28, and culture at 30 °C for 4 - 6 days until sporulation is complete;

[0107] 17. Extract the total DNA of the strain and perform PCR confirmation using the primers in Table 1 to obtain the expression strain Streptomyces lividans GX28 / 11H09 containing the bacterial artificial chromosome of weddellamycin.

[0108] Table 1 Primers used in the examples

[0109] Primer Sequence 15-1-F CACACAGCGCCGCTCCAGCT, SEQ ID NO.2 15-1-R ATGTCCACGCCCGTCAACGT, SEQ ID NO.3 15-2-F CGTTCGCTGCGGGAGGTCATC, SEQ ID NO.4 15-2-R GCTTCCAGGGTGAGTTCCTC, SEQ ID NO.5 15-3-F GTGCAGATGACTGAGTCGGG, SEQ ID NO.6 15-3-R GCCGCTCCAGGACGAAGACG, SEQ ID NO.7 15-4-F TCAGGTGCACTTCTTGTCGT, SEQ ID NO.8 15-4-R GCTATCTCCAGGGGTACGCG, SEQ ID NO.9

[0110] Table 2 20 μL PCR reaction system

[0111]

[0112] Table 3 PCR program

[0113]

[0114] Example 2: Detection of weddellamycin

[0115] 1. Pick the verified conjugants onto an MS plate for sporulation and culture at 30 °C for 4 - 6 days;

[0116] 2. Spread the spores evenly on an R5a fermentation medium plate and ferment at 30 °C for 6 - 7 days until the production of the antibiotic is complete;

[0117] 3. After the fermentation is completed, collect the solid fermentation product, extract it 3 times with an equal volume of acetonitrile, and vacuum concentrate and spin dry to obtain the acetonitrile crude extract;

[0118] 4. Dissolve the crude acetonitrile extract in methanol, centrifuge at 13,500 rpm for 15 min, remove the supernatant for high-performance liquid chromatography analysis, and the injection volume is 10 μL. The liquid chromatography column model is: Agilent Zorbax 300SB-C18 (5 μm, 4.6×250 mm).

[0119] The mobile phase is: Phase A is water, and Phase B is methanol. The analysis conditions are: from 0 to 40 min, the concentration of Phase B rises from 5% to 100%; from 40 to 50 min, the concentration of Phase B remains unchanged at 100%; from 50.1 to 50 min, the concentration of Phase B remains unchanged at 5%. The flow rate is 0.5 mL / min, at room temperature. Weddellamycin elutes at 38.2 min.

[0120] Figure 1 It is the liquid-phase detection chart for the expression of Weddellamycin. As can be seen from the figure, after fermentation, the expression strain containing the bacterial artificial chromosome of widdelmycin was treated and detected, and a differential peak of widdelmycin was produced compared with the control.

[0121] Example 3: Purification and Identification of Weddellamycin

[0122] 1. Uniformly coat the spores of Streptomyces lividans GX28 / 11H09 on a 10 L R5a fermentation medium plate and ferment at 30 °C for 6 - 7 days;

[0123] 2. Collect the solid fermentation product of the strain, extract it 3 times with an equal volume of acetonitrile, and vacuum concentrate and rotary evaporate until only water remains;

[0124] 3. Adsorb the concentrated extract with macroporous resin HP20 and elute it with water, 50% methanol-water, and 100% methanol, 5 L each;

[0125] 4. Recover and vacuum concentrate the 100% methanol elution fraction, and perform liquid-phase separation twice to obtain pure Weddellamycin.

[0126] The preparation conditions for high-performance liquid chromatography are:

[0127] The high-performance liquid chromatography column model is Agilent Zorbax SB-C18 (5 μm, 9.4×250 mm).

[0128] The mobile phase is:

[0129] For the first time: Phase A is water, and Phase B is methanol; the elution conditions are: isocratic elution with 68% Phase B for 20 min, the flow rate is 2 mL / min, and Weddellamycin elutes at 16.9 min; vacuum concentrate for the second purification;

[0130] Second time: Phase A is water and Phase B is acetonitrile; the elution conditions are as follows: isocratic elution with 47% of Phase B for 16 min at a flow rate of 3.24 mL / min, and Weddellamycin elutes at 14.8 min.

[0131] The detection wavelength is 300 nm for all.

[0132] 5. Perform mass spectrometry analysis on the purified Weddellamycin to determine its molecular weight. The molecular weight of Weddellamycin is measured to be m / z 432.2166 [M+H] using Acquity UPLC I-class / VION IMS QTOF. + ( Figure 2 ) The molecular weight determination of Weddellamycin is as Figure 2 shown;

[0133] 6. Obtain the relevant NMR spectra of Weddellamycin using a Bruker Avance III 600 MHz nuclear magnetic resonance spectrometer ( Figure 4 , 5 6), and therefrom deduce the planar structure of the compound, as Figure 3 shown;

[0134] 7. On the basis of obtaining the planar structure, perform ECD calculation, and measure the electronic circular dichroism spectrum data of Weddellamycin using JASCO J-1500. By comparing with the calculation results, the absolute configuration of Weddellamycin is deduced, as Figure 3 shown.

[0135] Example 4: Biological activity assay of Weddellamycin

[0136] The minimum inhibitory concentration (MIC) value of Weddellamycin is determined according to the microplate method. The strains to be tested are Staphylococcus aureus ATCC25923, methicillin-resistant Staphylococcus aureus [MRSA], methicillin-resistant Staphylococcus epidermidis [MRSE], Enterococcus faecalis ATCC29212, Micrococcus luteus ATCC4698, Bacillus alpinus 41KF2b, Listeria monocytogenes ATCC BAA-679, Candida albicans, and Escherichia coli DH10B. The MIC value is defined as the lowest antibiotic concentration that inhibits the growth of more than 90% of the concentration of the strain. Using ampicillin as a control, there are 3 parallels for each sample.

[0137] 1. Select Mueller-Hinton (MH) broth medium to culture the experimental bacteria, and culture them overnight at 37 °C for 12 - 16 h. Prepare the sample solution before the experimental bacteria grow well;

[0138] 2. Prepare the sample solutions. Dissolve the samples Weddellamycin and ampicillin in DMSO to prepare stock solutions with concentrations of 1.72 mg / mL and 10 mg / mL, respectively.

[0139] 3. Use a pipette to add 196 μL of MH medium to the first column of a 96-well plate, and add 100 μL of MHB medium to the second to twelfth columns. In addition, add 100 μL of the mixed bacterial solution (the bacterial solution obtained by diluting the indicator bacterial seed solution at a ratio of 1:1000) to the eleventh column as a positive control, and add 100 μL of MHB medium to the twelfth column as a negative control.

[0140] 4. Pipette 4 μL of the prepared antibiotic stock solution into the wells of the first column, and pipette up and down to mix the solution.

[0141] 5. Use a multichannel pipette to aspirate 100 μL of the mixed liquid from the first column to the second column, pipette up and down to mix, and then transfer 100 μL to the third column. Repeat this process until the tenth column. When diluting to the tenth column, discard the 100 μL of the aspirated culture medium and do not transfer it to the eleventh column.

[0142] 6. Add 100 μL of the diluted and mixed indicator bacterial solution to the first to tenth columns. In this way, the drug concentration gradients of Weddellamycin are: 17.20, 8.60, 4.30, 2.15, 1.07, 0.54, 0.27, 0.14, 0.07, and 0.034 μg / mL; the drug concentration gradients of ampicillin are: 100, 50, 25, 12.5, 6.25, 3.12, 1.56, 0.78, 0.39, and 0.20 μg / mL.

[0143] 7. Cover the 96-well plate with a lid, make marks, and incubate it in an incubator at 37°C for 18 - 24 h.

[0144] 8. Using the eleventh column as the positive control and the twelfth column as the blank control, use a microplate reader to read the OD 600 value. After subtracting the background OD600 value of the MHB medium, the antibiotic concentration corresponding to the ratio less than 10% compared to the positive control is the minimum inhibitory concentration (MIC, μg / mL) of the antibiotic against the indicator bacterium, as shown in Table 4 below:

[0145] Table 4

[0146]

[0147]

[0148] The results show that weddellamycin has good antibacterial activity against all the tested Gram-positive strains, and its MIC values are between 0.14 - 1.07 μg / mL. In particular, the MIC values of weddellamycin against MRSA, MRSE and Enterococcus faecalis are 0.14, 0.27 and 1.07 μg / mL respectively, while the MIC values of ampicillin are all ≥ 50 μg / mL. The MIC value of weddellamycin against Candida albicans is 2.15 μg / mL, while the MIC value of ampicillin is > 100 μg / mL. In particular, the activity of Enterococcus faecalis is better than that of the similar compound piceamycin (32 ± 0 μg / mL), and the similar compounds bombyxamycins do not inhibit the activity of Enterococcus faecalis. It should be noted that weddellamycin has antifungal activity against Candida albicans, which has not been reported for the similar compounds piceamycin and bombyxamycins in the existing literature.

[0149] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A polyene macrolactam compound, the planar structural formula of which is as follows:

2. A production strain of a polyene macrolactam compound as described in claim 1, characterized in that, The strain is constructed by a method comprising the following steps: heterologously expressing a bacterial artificial chromosome clone containing a polyene macrolactam compound biosynthetic gene cluster, and obtaining the production strain through antibacterial activity screening and PCR verification.

3. The production strain of the polyene macrolactam compound according to claim 2, characterized in that, The sequence of the polyene macrolactam compound biosynthetic gene cluster is as shown in SEQ ID NO.

1.

4. The production strain of the polyene macrolactam compound according to claim 2, characterized in that, By extracting the genomic DNA of Streptomyces sp. DSS69, a bacterial artificial chromosome library is constructed; and a bacterial artificial chromosome clone containing the gene cluster is selected from the bacterial artificial chromosome library by PCR.

5. The production strain of the polyene macrolactam compound according to claim 4, characterized in that, The primers used in PCR are as follows: 15-1-F: CACACAGCGCCGCTCCAGCT, 15-1-R: ATGTCCACGCCCGTCAACGT; 15-2-F: CGTTCGCTGCGGGAGGTCATC, 15-2-R: GCTTCCAGGGTGAGTTCCTC; 15-3-F: GTGCAGATGACTGAGTCGGG, 15-3-R: GCCGCTCCAGGACGAAGACG; 15-4-F: TCAGGTGCACTTCTTGTCGT, 15-4-R: GCTATCTCCAGGGGTACGCG.

6. The production strain of the polyene macrolactam compound according to claim 2, characterized in that, The host bacteria for heterologous expression include Streptomyces lividans and Streptomyces albus.

7. The production strain of the polyene macrolactam compound according to claim 6, characterized in that, The host bacteria for heterologous expression is Streptomyces lividans GX28.

8. A production strain of the polyene macrolactam compound as described in claim 1, characterized in that, The strain is Streptomyces lividans SLG106, and its preservation number is CGMCC No.28826.

9. A method for producing a polyene macrolactam compound as described in claim 1, characterized in that, The polyene macrolactam compound is obtained by fermenting, separating and purifying the production strain according to any one of claims 2-7 or claim 8.

10. The production method according to claim 9, characterized in that, The fermentation is carried out by fermenting and culturing with fermentation medium R5a, and collecting the solid fermentation product; after extraction and concentration, it is adsorbed by macroporous resin and eluted with water, 50% methanol-water and 100% methanol; the 100% methanol elution fraction is recovered and vacuum concentrated, and the pure product of the polyene macrolactam compound is obtained by liquid phase separation.

Images