Epigenetic modification editor for targeted addition of DNA methylation and application of epigenetic modification editor

By developing an epigenetic modification editor targeting the addition of DNA methylation, using the CRISPR/dCas9 system and tobacco DNA methyltransferase DRM2, site-directed addition of rice DNA methylation was achieved, solving the problem of lack of targeted addition of DNA methylation in the prior art, and achieving fine regulation of gene expression and crop trait improvement.

CN120289650APending Publication Date: 2025-07-11INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510450870.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

There is a lack of research on targeted addition of DNA methylation in the prior art, especially in monocot plants such as rice, which cannot regulate gene expression by site-directed changes in DNA methylation status to improve crop traits.

Method used

An epigenetic modification editor targeting the addition of DNA methylation was developed, including the fusion protein (dCas9-nGCN4) of the CRISPR/dCas9-related protein and n copies of the yeast transcription activator GCN4 peptide, and the fusion protein (scFv-DRM2) of the single-chain antibody scFv and the tobacco DNA methyltransferase catalytic domain DRM2. The maize Ubiquintin promoter was used to drive expression to achieve site-directed addition of rice DNA methylation.

Benefits of technology

It has achieved efficient and precise addition of DNA methylation in rice, regulated the expression level of downstream genes, and produced specific phenotypic changes, such as the sensitive traits of low temperature stress during the ear pregnancy, which has expanded the application scope of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120289650A_ABST
    Figure CN120289650A_ABST
Patent Text Reader

Abstract

The invention discloses an epigenetic modification editor for targeted addition of DNA methylation and application of the epigenetic modification editor, and belongs to the technical field of biology. The epigenetic modification editor for targeted addition of DNA methylation, provided by the invention, comprises a fusion protein of CRISPR / dCas9 related protein and n copies of yeast transcription activator GCN4 peptide fragments and a fusion protein of a single-chain antibody scFv and a tobacco DNA methyltransferase catalytic structural domain DRM2, and can be combined with guide RNA to efficiently and accurately add DNA methylation to a target position.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an epigenetic modification editor for targeted addition of DNA methylation and its application. More particularly, it relates to an epigenetic modification editor for adding DNA methylation based on the CRISPR / dCas9 system, which can target and add DNA methylation modifications to the genomic DNA of plants such as rice, thereby precisely regulating the expression level of related genes. Background Art

[0002] Epigenetic regulation refers to heritable changes in gene expression that occur without changing the DNA sequence. As an important part of epigenetic regulation, DNA methylation plays an important role in a variety of biological processes: such as genomic imprinting, X chromosome inactivation, aging, tumorigenesis, and maintaining genomic stability by inhibiting transposon jumping. In plants, methylation modifications on cytosine can occur at CG, CNG, and CHH sites. Its natural mutation frequency is much higher than the genetic variation of the DNA sequence itself, and most of the DNA methylation variations in plants can be stably inherited across generations. These natural epigenetic mutants not only enrich the phenotypic diversity of the species, but also play an important role in plant domestication and environmental adaptation. Generally speaking, DNA methylation located in the promoter region of a gene inhibits gene expression. The first reported epigenetic allelic mutant Epi-d1 in rice was caused by increased DNA methylation in the promoter region of the DWARF1 gene, which inhibited the expression of the DWARF1 gene and resulted in dwarf plants. The first gain-of-function epigenetic mutant Epi-df in rice showed dwarf plants and abnormal flower development. This abnormal phenotype was caused by the loss of DNA methylation in the 5' upstream region of the FIE1 gene, which encodes an important member of the rice PRC2 complex. Therefore, site-directed alteration of the methylation status at specific sites, and thereby alteration of the expression of corresponding genes, is an important way to promote phenotypic diversity and environmental adaptability of species, and has broad application prospects in crop improvement.

[0003] The applicant has developed a plant epigenetic modification editor for targeted DNA demethylation (CN115627272A), which consists of two parts. The first part includes a fusion protein of a CRISPR / Cas9-related protein and multiple copies of the yeast transcriptional activator GCN4 peptide. The second part includes a fusion protein of the human DNA demethylase TET1 catalytic domain and a single-chain antibody that can specifically recognize the GCN4 peptide. This plant epigenetic modification editor for targeted DNA demethylation can efficiently and precisely remove DNA methylation at the target site of the CRISPR / Cas9 system, which is of great significance in improving important traits of crops by targeted DNA demethylation. For example, the applicant's previous research found that there is a negative correlation between the DNA methylation level upstream of the rice OsACT1 gene and cold tolerance at the booting stage. Low-methylated rice varieties are cold-tolerant, while high-methylated rice varieties are cold-sensitive. Therefore, targeted DNA demethylation can increase the cold tolerance of rice at the booting stage (CN118240832A). However, in some cases, the presence of DNA methylation or high levels of DNA methylation also has beneficial effects on crops obtaining excellent traits. Therefore, targeted DNA methylation addition in crops is also of great significance. However, there is currently little research related to targeted DNA methylation addition, especially in monocotyledonous plants (such as rice), and there is no research report related to targeted DNA methylation addition. Summary of the Invention

[0004] In view of the problems existing in the prior art, the first aspect of the present invention provides an epigenetic modification editor for targeted DNA methylation addition, which comprises:

[0005] A fusion protein of a CRISPR / dCas9-related protein and n copies of the yeast transcriptional activator GCN4 peptide, named dCas9-nGCN4, where n is a positive integer, and the CRISPR / dCas9-related protein loses its cleavage activity, and a fusion protein of a single-chain antibody scFv and the catalytic domain DRM2 of tobacco DNA methyltransferase, named scFv-DRM2, where the single-chain antibody scFv can specifically recognize the GCN4 peptide.

[0006] In some embodiments, the CRISPR / dCas9-related protein can be selected from: SpCas9, FnCas9, StlCas9, St3Cas9, NmCas9, SaCas9, AsCpf1, LbCpf1, FnCpf1, VOQ SpCas9, EQR SpCas9, VRERSpCas9, RHA FnCas9, SpCas9-NG, KKH SaCas9, xCas9 series, and SpCas9-NG series.

[0007] In some embodiments, the CRISPR / dCas9-related protein may comprise the amino acid sequence shown in SEQ ID NO:1 or consist thereof.

[0008] In some embodiments, the CRISPR / dCas9-related protein may be encoded by a coding gene comprising the nucleotide sequence shown in SEQ ID NO:2 or consisting thereof.

[0009] In some embodiments, n may be a positive integer from 1 to 20.

[0010] In some embodiments, the GCN4 peptide may comprise the amino acid sequence shown in SEQ ID NO:3 or consist thereof.

[0011] In some embodiments, the n copies of the yeast transcriptional activator GCN4 peptide may be interconnected by a linker. Optionally, the linker may comprise the amino acid sequence shown in SEQ ID NO:4 or consist thereof; Further optionally, the n copies of the yeast transcriptional activator GCN4 peptide may comprise the amino acid sequence shown in SEQ ID NO:5 or consist thereof.

[0012] In some embodiments, the dCas9-nGCN4 may comprise the amino acid sequence shown in SEQ ID NO:6 or consist thereof.

[0013] In some embodiments, the single-chain antibody scFv may comprise the amino acid sequence shown in SEQ ID NO:8 or consist thereof.

[0014] In some embodiments, the tobacco DNA methyltransferase catalytic domain DRM2 may comprise the amino acid sequence shown in SEQ ID NO:7 or consist thereof.

[0015] In some embodiments, the scFv-DRM2 may comprise the amino acid sequence shown in SEQ ID NO:9 or consist thereof.

[0016] The second aspect of the present invention provides an expression vector encoding the epigenetic modification editor for targeted addition of DNA methylation provided in the first aspect of the present invention.

[0017] In some embodiments, in the expression vector, the dCas9-nGCN4 and scFv-DRM2 in the epigenetic modification editor for targeted addition of DNA methylation are respectively driven by a monocotyledonous plant promoter for expression.

[0018] In some embodiments, the monocotyledonous plant promoter is the maize Ubiquintin promoter.

[0019] In some embodiments, the expression vector further encodes a guide RNA, which can target dCas9-nGCN4 in the epigenetic modification editor for targeted addition of DNA methylation to a genomic polynucleotide sequence complementary to the guide RNA sequence; further optionally, the guide RNA targets the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630), and optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:25 or consists of the same.

[0020] The third aspect of the present invention provides a polynucleotide encoding the fusion protein scFv-DRM2 mentioned in the first aspect of the present invention.

[0021] The fourth aspect of the present invention provides a host cell comprising the expression vector provided in the second aspect of the present invention or the polynucleotide provided in the third aspect of the present invention.

[0022] The fifth aspect of the present invention provides a composition comprising the epigenetic modification editor for targeted addition of DNA methylation provided in the first aspect of the present invention and a guide RNA, wherein the guide RNA can target dCas9-nGCN4 in the epigenetic modification editor for targeted addition of DNA methylation to a genomic polynucleotide sequence complementary to the guide RNA sequence.

[0023] In some embodiments, the genomic polynucleotide sequence complementary to the guide RNA sequence is derived from rice.

[0024] In some embodiments, the guide RNA targets the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630); optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:25 or consists of the same.

[0025] The application of the epigenetic modification editor for targeted addition of DNA methylation provided in the first aspect of the present invention, the expression vector provided in the second aspect of the present invention, the polynucleotide provided in the third aspect of the present invention, or the host cell provided in the fourth aspect of the present invention in targeted addition of DNA methylation in plants also belongs to the content of the present invention; optionally, the plant is rice.

[0026] The sixth aspect of the present invention provides a method for targeted addition of DNA methylation, which includes providing the epigenetic modification editor for targeted addition of DNA methylation provided in the first aspect of the present invention and a guide RNA to a target polynucleotide, wherein a fragment complementary to the guide RNA exists on the target polynucleotide.

[0027] The seventh aspect of the present invention provides a method for cultivating a rice line sensitive to low temperature stress during the booting stage, which includes using transgenic, hybridization, and / or gene editing techniques to provide the epigenetic modification editor for targeted addition of DNA methylation and the guide RNA provided in the first aspect of the present invention to the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630), wherein there is a fragment complementary to the guide RNA on the upstream regulatory sequence of the rice OsACT1 (LOC_Os08g37630); optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO: 25 or consists of the same. Brief Description of the Drawings

[0028] Figure 1 Schematic diagram of the vector structure of the epigenetic modification editor for targeted addition of DNA methylation.

[0029] Figure 2 Schematic diagram of the targeted site of the OsACT1 gene and the results of Bisulfite-PCR detection of DNA methylation, where each row represents the sequencing results of a clone.

[0030] Figure 3 Detection results of the expression level of OsACT1 in the rice line with added methylation editing.

[0031] Figure 4 Detection results of the cold tolerance of the rice line with added methylation editing. Detailed Description of the Embodiments

[0032] The present invention aims to provide an editing tool for targeted DNA methylation addition and a corresponding method for targeted DNA methylation addition. The present invention is mainly achieved based on the following discovery: By binding the catalytic domain of tobacco DNA methyltransferase DRM2 to the protein related to the SunTag system, DNA methylation can be efficiently and precisely added at the target site of the CRISPR / dCas9 system. Specifically, the present invention optimally integrates the CRISPR / dCas9 system of the SunTag system, and uses an optimized monocotyledonous plant promoter (such as the maize Ubiquintin promoter) to drive the fusion protein of the CRISPR / dCas9-related protein lacking cleavage activity and n copies of the yeast transcriptional activator GCN4 peptide (named dCas9-nGCN4, where n represents a positive integer) and the fusion protein of a single-chain antibody (scFv, which can specifically recognize the GCN4 peptide) and the catalytic domain of tobacco DNA methyltransferase (DRM2, as an effector protein) (named scFv-DRM2), so as to achieve site-specific addition of DNA methylation in important food crops such as rice, and further regulate the expression level of downstream genes, enabling important food crops such as rice to produce corresponding phenotypes, such as the phenotype of being sensitive to low temperature stress during the booting stage of rice. Epigenetic modification editing expands the scope of gene editing. Its characteristics of fine-tuning gene expression and being heritable make it very promising for application in the genetic improvement of important crop traits.

[0033] Specifically, the present invention provides an epigenetic modifier for targeted DNA methylation addition (especially provides an epigenetic modifier for targeted DNA methylation addition applicable to monocotyledonous plants (such as rice)), which can include two parts. One part is the fusion protein of the CRISPR / dCas9-related protein lacking cleavage activity and one or more copies of the yeast transcriptional activator GCN4 peptide (dCas9-nGCN4), and the other part is the fusion protein of a single-chain antibody and the catalytic domain of tobacco DNA methyltransferase (scFv-DRM2).

[0034] In some embodiments, the CRISPR / dCas9-related protein lacking cleavage activity can be selected from: SpCas9, FnCas9, StlCas9, St3Cas9, NmCas9, SaCas9, AsCpf1, LbCpf1, FnCpf1, VOQ SpCas9, EQRSpCas9, VRER SpCas9, RHA FnCas9, SpCas9-NG, KKH SaCas9, xCas9 series and SpCas9-NG series. It has been reported in the literature that the two DNA cleavage domains of Cas9-related proteins can be inactivated by amino acid mutations, so that the Cas9 protein only retains the ability to bind double-stranded DNA without causing double-strand DNA breaks, which is called dCas9 (deactivated Cas9).

[0035] In some embodiments, the CRISPR / dCas9-related protein can have the ability to bind DNA without double-strand cleavage activity. For example, the CRISPR / dCas9-related protein can comprise or consist of the amino acid sequence shown in SEQ ID NO:1. Correspondingly, the coding gene of the CRISPR / dCas9-related protein can comprise or consist of the nucleotide sequence shown in SEQ ID NO:2.

[0036] In some embodiments, the n copies of the yeast transcriptional activator GCN4 peptide segment can be 1 to 20 (i.e., n = 1 - 20) copies of the yeast transcriptional activator GCN4 peptide segment. For example, n = 1 - 15, 1 - 10, 1 - 8, 1 - 5, 1 - 3 or 1 - 2, and specifically can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0037] In some embodiments, the GCN4 peptide segment can comprise or consist of the amino acid sequence shown in SEQ ID NO:3. In the case of multiple copies, each GCN4 peptide segment can be interconnected via a linker, and the linker can comprise or consist of the amino acid sequence shown in SEQ ID NO:4.

[0038] In some embodiments, the CRISPR / dCas9-related protein is fused with 10 copies of the yeast transcriptional activator GCN4 peptide segment. After the 10 copies of the yeast transcriptional activator GCN4 peptide segment are linked together, they can comprise or consist of the amino acid sequence shown in SEQ ID NO:5. In this case, the fusion protein dCas9-nGCN4 can comprise or consist of the amino acid sequence shown in SEQ ID NO:6.

[0039] In some embodiments, the catalytic domain of tobacco DNA methyltransferase (DRM2) may comprise or consist of the amino acid sequence shown in SEQ ID NO:7.

[0040] In some embodiments, the scFv that can specifically recognize the GCN4 peptide segment may comprise or consist of the amino acid sequence shown in SEQ ID NO:8.

[0041] In some embodiments, the fusion protein scFv-DRM2 may comprise or consist of the amino acid sequence shown in SEQ ID NO:9.

[0042] In some embodiments, the maize Ubiquintin promoter is used to drive the expression of the fusion proteins dCas9-nGCN4 and scFv-DRM2, respectively, wherein the maize Ubiquintin promoter may comprise or consist of the nucleotide sequence shown in SEQ ID NO:10, and can be used to optimize the expression of the vector in monocotyledonous model crops such as rice.

[0043] On the other hand, the present invention also provides a composition, which comprises the above-mentioned epigenetic modification editor for targeted addition of DNA methylation and the guide RNA, wherein the guide RNA can guide the fusion protein dCas9-nGCN4 to a genomic polynucleotide sequence complementary to the corresponding guide RNA sequence (for example, it may be derived from rice), and at the same time, the GCN4 peptide segment is responsible for recruiting the scFv-DRM2 fusion protein, so as to effectively add DNA methylation at the target site, and further regulate (for example, reduce or increase) the expression level of the targeted gene.

[0044] The present invention will be further described below in conjunction with specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention, rather than to limit the content of the present invention.

[0045] In the following text, only some exemplary embodiments are simply described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present invention. Therefore, the drawings and the description are considered to be exemplary in nature rather than restrictive.

[0046] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: "Molecular Cloning: A Laboratory Manual" (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0047] The acquisition methods of various biological materials described in the examples only provide an experimental acquisition method to achieve the specifically disclosed purpose, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and ethical principles can be replaced and used according to the prompts in the examples. The test materials used in the following examples are all purchased from regular biochemical reagent stores unless otherwise specified.

[0048] The nucleotides involved in the following examples can all be synthesized by existing technologies.

[0049] Example 1. Construction of vectors for epigenetic modification editors targeting the addition of DNA methylation

[0050] In this example, the vector of the epigenetic modification editor targeting the addition of DNA methylation was modified from the vector Zmubi-Suntag-14aa disclosed in the patent document CN115627272A.

[0051] Specifically, the forward primer CP9346 (SEQ ID NO: 11) and the reverse primer CP9347 (SEQ ID NO: 12) were used to amplify the coding sequence of the DRM2 catalytic domain using tobacco (Nicotiana tabacum L.) cDNA as a template, and it was ligated to the BsiWI (NEB, R0553V) restriction site of the Zmubi-Suntag-14aa vector to replace the coding sequence of the demethylase TET1 catalytic domain in the original vector (Zmubi-Suntag-14aa) with the coding sequence of the tobacco DRM2 catalytic domain, obtaining a new vector, which was named Zmubi-SunTag14aa-DRM2 (also referred to as SunTagng14aa-ubipro in this article). The plasmid structure schematic diagram of the vector is as Figure 1 shown.

[0052] Specifically, in the Zmubi-SunTag14aa-DRM2 vector constructed in this example, the expression of the fusion protein dCas9-nGCN4 and the fusion protein scFv-DRM2 was driven by the maize Ubiquintin promoter respectively. Among them, the fusion protein dCas9-nGCN4 contains 10 copies of the GCN4 peptide segment (i.e., n = 10). The amino acid sequence of the fusion protein dCas9-nGCN4 is as shown in SEQID NO: 6, and the amino acid sequence of the fusion protein scFv-DRM2 is as shown in SEQ ID NO: 9.

[0053] For the construction of the guide RNA expression cassette. Using the OsU6-sgRNA plasmid (SEQ ID NO: 13) as a template, the first fragment was amplified using the forward primer CP9788 (SEQ ID NO: 14) and the reverse primer CF8415 (SEQ ID NO: 15). The second fragment was amplified using the forward primer CF8414 (SEQ ID NO: 16) and the reverse primer XP0730 (SEQ ID NO: 17). The two fragments were ligated to the PmeI digestion site of Zmubi-SunTag14aa-DRM2 by homologous recombination to construct an expression vector of an epigenetic modification editor targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 (LOC_Os08g37630). The nucleotide sequence of the guide RNA expressed by it is as shown in SEQ ID NO: 25.

[0054] Alternatively, as an epigenetic modification editor targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 (LOC_Os08g37630), a combined system containing the fusion protein dCas9-nGCN4, the fusion protein scFv-DRM2, and the guide RNA (SEQ ID NO: 25) can be directly used, or a combined system of the Zmubi-SunTag14aa-DRM2 vector and the guide RNA (SEQ ID NO: 25) can be directly used, without the need to construct the above three in the same vector. In these systems, the guide RNA can target the fusion protein dCas9-nGCN4 to the upstream regulatory sequence of OsACT1 (LOC_Os08g37630), and at the same time, the GCN4 peptide segment is responsible for recruiting the scFv-DRM2 fusion protein, so as to effectively add DNA methylation at the target site, and then regulate the expression level of downstream genes.

[0055] During the vector modification process, the PCR system was as follows: 10 ng of plasmid template, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM each), 1 μL of Phanta Max Super-Fidelity DNA Polymerase (1 unit / μL) (Nanjing Novoprotein Biological Technology Co., Ltd., P505-d1), and made up to 50 μL with ddH2O. The PCR reaction program was: 94°C for 2 min; (94°C for 30 s, 60°C for 30 s, 72°C for 30 s) for 32 cycles; 72°C for 10 min, and held at 16°C.

[0056] The digestion system is as follows: 5 μL of 10×CutSmart Buffer, 1 μL of restriction endonucleases (BsiWI, 10 units / μL, PmeI, 10 units / μL), 1 μg of the vector to be digested, supplemented with ddH2O to 50 μL, and digested at 37°C for at least 8 hours.

[0057] Table 1: List of primers used in this example

[0058] Primer name Primer sequence (5’-3’) CP9346 cgagatcctcctcccgtacg ATGTTTATGTCTGGACATTATGGAC (SEQ ID NO:11) CP9347 gaggtcggaccggtcgtacg GAGACAATTCGTTTGCCCAAACC (SEQ ID NO:12) CP9788 ACCATGTTGGCAAGCTGTTT tatgtacagcattacgtagg (SEQ ID NO:14) CF8415 ctgaactttttgacagtgac AACCTGAGCCTCAGCGCAGC (SEQ ID NO:15) CF8414 gtcactgtcaaaaagttcag GTTTTAGAGCTAGAAATAGCAAGTTA (SEQ ID NO:16) XP0730 atgttactagatcgggGTTT gatggtgcttactgtttag (SEQ ID NO:17)

[0059] Example 2. Detection of DNA methylation levels in T2 generation plants of rice transformed with epigenetic modification editors targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 Figure 2

[0060] Use the epigenetic modification editor constructed in Example 1 to target the addition of DNA methylation to the upstream regulatory sequence of OsACT1 to transform rice (Kendao 8). Agrobacterium transformation and screening refer to the reported method (Hiei, Y. et al. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6, 271-282, doi:10.1046 / j.1365-313x.1994.6020271.x (1994)). Use the CTAB (Hexadecyl trimethylammonium Bromide) method to extract the genomic DNA of the transgenic T2 generation of rice and dissolve it in 100 μl of ddH2O.

[0061] Bisulfite treatment can deaminate cytosine that is not methylated in DNA to convert it into uracil, while methylated cytosine remains unchanged. After PCR amplification, all uracils are converted into thymines. Finally, Sanger sequencing is performed on the PCR product and compared with the untreated sequence to determine whether cytosine is methylated.

[0062] We separately took 500 ng of DNA from transgenic negative strains (as negative controls) and 2 independent transgenic editing strains (methylation addition strain 1 and methylation addition strain 2) for bisulfite treatment, and the operation was carried out with reference to the instruction manual of EZ DNAMethylation-Gold Kit (ZYMO RESEARCH, D5005). The final product was dissolved in 15 μL of ddH2O. PCR amplification was carried out using the forward primer CP5356 (SEQ ID NO:18) and the reverse primer CP5357 (SEQ ID NO:19) upstream of the target sequence.

[0063] PCR reaction system: 30 ng of bisulfite-treated genomic DNA, 25 μL of 2×PCR buffer for KOD-Multi&Epi, 1.5 μL of forward primer (10 μM), 1.5 μL of reverse primer (10 μM), 1 μL of KOD-Multi&Epi- (KME-101, TOYOBO), and supplemented with ddH2O to 50 μL. PCR reaction program: 94 °C for 2 min; (98 °C for 10 s, 55 °C for 30 s, 68 °C for 30 s) for 40 cycles; 68 °C for 10 min, and hold at 16 °C.

[0064] The PCR products were separated by 1% agarose gel, and the PCR amplification bands were recovered using Zymoclean Gel DNA Recovery Kit (ZYMORESEARCH, D4008) and dissolved in 15 μl of ddH2O. 50 ng of the recovered product was ligated with 1 μL of pEASY-Blunt Cloning vector using pEASY-Blunt Cloning Kit (TransGen Biotech Co., Ltd., Beijing, CB101-01). The ligation method was carried out with reference to the instruction manual. The ligation product was transformed into Escherichia coli DH5α and cultured overnight at 37 °C on a plate with kanamycin resistance. 10 monoclonal colonies were picked and cultured in liquid medium containing kanamycin until OD 2.0, and sequencing was carried out using the M13R primer (SEQ ID NO:20) on the vector. The sequencing results were analyzed according to the online analysis software Web-based Kismeth software (http: / / katahdin.mssm.edu / kismeth / revpage.pl), and the change in methylation level after removing the same clones was statistically analyzed. The results are as Primer nameAs shown, it can be seen that the transgenic negative control has a lower DNA methylation level in the region near the target site, while the two rice plants transformed with the epigenetic modification editor that adds DNA methylation at the target site have a higher DNA methylation level at the target site. This result indicates that the epigenetic modification editor constructed in Example 1 to add DNA methylation to the upstream regulatory sequence of OsACT1 can indeed increase the DNA methylation level at the guide RNA target site after transforming rice.

[0065] Table 2: List of primers used in this example

[0066] Primer sequence (5’-3’) CP5356 YGTTAAAGAATTTGGTTTTGAT (Y represents C and T bases) (SEQ ID NO:18) CP5357 AACATAACACCTTTTAAAACCATA (SEQ ID NO:19) M13R CAGGAAACAGCTATGACC (SEQ ID NO:20) Example 3. Detection of OsACT1 expression levels in T2 generation plants of rice transformed with epigenetic modification editors targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1

[0067] Figure 3 Primer name

[0068] In this example, the expression level of OsACT1 was detected by RT-PCR. We selected samples before and after cold treatment at the booting stage of transgenic negative lines (negative control) and two independent transgenic editing lines (methylation addition line 1 and methylation addition line 2) (the specific operation of cold treatment at the booting stage is: when the distance between the flag leaf and the second leaf from the top of rice tillers is -5 to -2 cm (i.e., the anthers are in the meiosis stage to the mononuclear stage), the rice is treated at 15 °C for 7 days in a temperature-controlled solar greenhouse, and after the treatment, it is transferred back to normal growth conditions). The total RNA of rice young panicles was extracted using TRNzol Universal RNA Extraction Reagent (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP424) and dissolved in 100 μL of DEPC water. 2 μg of total RNA was taken, and reverse transcription was performed using HiScript III 1st Strand cDNA Synthesis Kit (Nanjing Novoprotein Biological Technology Co., Ltd., R312-02), and the final product was diluted to 200 μl of ddH2O. The OsACT1 transcript was amplified using the OsACT1 transcript-specific forward primer CP9742 (SEQ ID NO:21) and reverse primer CP9743 (SEQ ID NO:22), and the transcript of the UBQUINTIN (LOC_Os01g22490) gene was amplified using the forward primer HX9046 (SEQ ID NO:23) and reverse primer HX9047 (SEQ ID NO:24) as an internal reference.

[0069] RT-qPCR reaction system: 3 μL of cDNA, 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix (Q711-02, Nanjing Novoprotein Scientific Inc.), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), supplemented with ddH2O to 20 μL. RT-qPCR reaction program: 95°C for 3 min; (95°C for 20 s, 60°C for 20 s, 72°C for 10 s) for 40 cycles, and the fluorescence value was read for each cycle.

[0070] The results are as Primer sequence (5’-3’) shown. It can be seen that the expression level of OsACT1 in the transgenic negative control remained basically unchanged before and after cold treatment, while in the two lines with DNA methylation editing added upstream of OsACT1, the expression levels of OsACT1 both decreased significantly after cold treatment.

[0071] The results of Example 2 and Example 3 above show that the epigenetic modification editor targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 can not only effectively add DNA methylation to the rice genome at the targeted site or increase the DNA methylation level at the targeted site, but also finely regulate the expression level of downstream genes.

[0072] Table 3: List of primers used in this example

[0073] CP9742 GCTCCCGGAGATGAGTTCCT (SEQ ID NO:21) CP9743 CCGGTGGGGGAGGATTATAC (SEQ ID NO:22) HX9046 GAAGGAGGAGGAAATCGAAC (SEQ ID NO:23) HX9047 CTTCACAGAGGTGATGCTAAGG (SEQ ID NO:24) Example 4. Identification of cold tolerance at the booting stage in T2 generation plants of rice transformed with epigenetic modification editors targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 Figure 4

[0074] Figure 4 Figure 4

[0075] We carried out cold treatment at the booting stage on transgenic negative lines (negative control) and two independent transgenic editing lines (methylation addition line 1 and methylation addition line 2). Specifically: when the distance between the flag leaf and the second leaf from the top of the rice tiller growth reached -5 to -2 cm (i.e., the anthers were in the meiosis stage to the uninucleate stage), the rice was treated at 15°C for 7 days in a temperature-controlled solar greenhouse, and after the treatment ended, it was transferred back to normal growth conditions, and the seed setting rate was counted at maturity.

[0076] The seed setting rate results after cold treatment at the booting stage of rice are as Figure 4 shown in Figures A and B, where ​ Figure A shows the photo of the number of seeds set after cold treatment at the booting stage of rice, ​ Figure B shows the statistical results of the seed setting rate after cold treatment at the booting stage of rice.

[0077] From ​As can be seen from the results shown in Panels A and B, the seed setting rates of the lines with DNA methylation editing after cold treatment were significantly lower than those of the transgenic negative control, manifested as the number of plump grains of rice in Methylation addition line 1 and Methylation addition line 2 being significantly lower than that of the negative control, and the number of empty and shrunken grains of rice in Methylation addition line 1 and Methylation addition line 2 being significantly higher than that of the negative control.

[0078] The results of Examples 2-4 show that the epigenetic modification editor targeting the addition of DNA methylation to the upstream regulatory sequence of OsACT1 can not only effectively add DNA methylation at the target site or increase the DNA methylation level at the target site, but also finely regulate the expression level of downstream genes and produce corresponding phenotypes.

[0079] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An epigenetic modification editor for targeted addition of DNA methylation, characterized in that, The epigenetic modification editor comprises: A fusion protein of a CRISPR / dCas9-related protein and n copies of the yeast transcriptional activator GCN4 peptide segment, named dCas9-nGCN4, where n is a positive integer, and the CRISPR / dCas9-related protein loses cleavage activity, and A fusion protein of a single-chain antibody scFv and the catalytic domain DRM2 of tobacco DNA methyltransferase, named scFv-DRM2, where the single-chain antibody scFv can specifically recognize the GCN4 peptide segment.

2. The epigenetic modification editor according to claim 1, characterized in that, The CRISPR / dCas9-related protein is selected from: SpCas9, FnCas9, StlCas9, St3Cas9, NmCas9, SaCas9, AsCpf1, LbCpf1, FnCpf1, VOQSpCas9, EQR SpCas9, VRER SpCas9, RHA FnCas9, SpCas9-NG, KKH SaCas9, xCas9 series and SpCas9-NG series; Optionally, the CRISPR / dCas9-related protein comprises the amino acid sequence shown in SEQ ID NO:1 or consists of the same; Further optionally, the CRISPR / dCas9-related protein is encoded by a coding gene comprising the nucleotide sequence shown in SEQ ID NO:2 or consisting of the same.

3. The epigenetic modification editor according to claim 1 or 2, characterized in that, n is a positive integer from 1 to 20; and / or The GCN4 peptide segment comprises the amino acid sequence shown in SEQ ID NO:3 or consists of the same; and / or The n copies of the yeast transcriptional activator GCN4 peptide segments are interconnected by a linker. Optionally, the linker comprises the amino acid sequence shown in SEQ ID NO:4 or consists of the same; Further optionally, the n copies of the yeast transcriptional activator GCN4 peptide segments comprise the amino acid sequence shown in SEQ ID NO:5 or consists of the same.

4. The epigenetic modification editor according to any one of claims 1-3, characterized in that, The dCas9-nGCN4 comprises the amino acid sequence shown in SEQ ID NO:6 or consists of the same.

5. The epigenetic modification editor according to any one of claims 1-4, wherein The single-chain antibody scFv comprises the amino acid sequence shown in SEQ ID NO:8 or consists of the same; and / or The catalytic domain DRM2 of tobacco DNA methyltransferase comprises the amino acid sequence shown in SEQ ID NO:7 or consists of the same; Optionally, the scFv-DRM2 comprises the amino acid sequence shown in SEQ ID NO:9 or consists of the same.

6. An expression vector encoding the epigenetic modification editor for targeted addition of DNA methylation according to any one of claims 1-5; Optionally, in the expression vector, the dCas9-nGCN4 and scFv-DRM2 in the epigenetic modification editor for targeted addition of DNA methylation are respectively driven to be expressed by a monocotyledonous plant promoter; Further optionally, the monocotyledonous plant promoter is the maize Ubiquintin promoter; Further optionally, the expression vector also encodes a guide RNA, which can target dCas9-nGCN4 in the epigenetic modification editor for targeted addition of DNA methylation to a genomic polynucleotide sequence complementary to the guide RNA sequence; Still further optionally, the guide RNA targets the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630), optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:25 or consists of the same.

7. A polynucleotide encoding the fusion protein scFv-DRM2 mentioned in any one of claims 1-5.

8. A host cell comprising the expression vector according to claim 6 or the polynucleotide according to claim 7.

9. A composition comprising the epigenetic modification editor for targeted addition of DNA methylation according to any one of claims 1-5 and a guide RNA, wherein the guide RNA can target dCas9-nGCN4 in the epigenetic modification editor for targeted addition of DNA methylation to a genomic polynucleotide sequence complementary to the guide RNA sequence; Optionally, the genomic polynucleotide sequence complementary to the guide RNA sequence is derived from rice; Still further optionally, the guide RNA targets the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630); Further optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:25 or consists of the same.

10. Use of the epigenetic modification editor for targeted addition of DNA methylation according to any one of claims 1-5, the expression vector according to claim 6, the polynucleotide according to claim 7 or the host cell according to claim 8 for targeted addition of DNA methylation in plants; Optionally, the plant is rice.

11. A method for targeted addition of DNA methylation, which comprises providing the epigenetic modification editor for targeted addition of DNA methylation according to any one of claims 1-5 and a guide RNA to a target polynucleotide, wherein there is a fragment complementary to the guide RNA on the target polynucleotide.

12. A method for cultivating a rice line sensitive to low temperature stress at the booting stage, which comprises using transgenic, hybridization and / or gene editing techniques to provide the epigenetic modification editor for targeted addition of DNA methylation according to any one of claims 1-5 and a guide RNA to the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630), wherein there is a fragment complementary to the guide RNA on the upstream regulatory sequence of rice OsACT1 (LOC_Os08g37630); optionally, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:25 or consists of the same.

Citation Information

Patent Citations

  • Plant epigenetic modification editor for targeted removal of DNA methylation

    CN115627272A

  • Cold-tolerant gene OsACT1 in booting stage of rice and application of cold-tolerant gene OsACT1

    CN118240832A