Chicken-derived riemerella anatipestifer and application thereof

Abstract

The invention relates to the technical field of veterinary biological products, and particularly discloses riemerella anatipestifer cRA / HeN2024, the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.32898, the preservation date is December 4, 2024, the preservation unit is China General Microbiological Culture Collection Center, and the preservation address is Yard 1, Beichen West Road, Chaoyang District, Beijing. The riemerella anatipestifer cRA / HeN2024 is type 1 riemerella anatipestifer and is separated from fallopian tube exudate of 15-day-old sick chicken showing respiratory tract symptoms; the isolated strain has a far genetic evolution relationship with the existing duck-origin and goose-origin riemerella anatipestifer, and the inactivated vaccine prepared from the strain has excellent immunogenicity and can effectively prevent and treat air sacculitis, salpingitis and pericarditis after chicken is infected with RA.

Description

Technical Field

[0001] The present invention belongs to the technical field of veterinary biological products, and particularly relates to a chicken-origin Riemerella anatipestifer and its application. Background Art

[0002] Riemerella anatipestifer (RA) belongs to the family Flavobacteriaceae and the genus Riemerella. RA can cause infections in poultry such as ducks, geese, and turkeys, mainly affecting young ducks. Clinical manifestations include increased eye and nasal secretions, respiratory symptoms, diarrhea, and neurological symptoms. Gross lesions are mainly characterized by perihepatitis, pericarditis, airsacculitis, and meningitis. Acute infections can lead to a large number of deaths of young ducks, and surviving young ducks show poor growth and retarded development, losing their feeding value.

[0003] RA was first isolated from ducks in the United States in 1932 and has since spread worldwide. The disease was first reported in Guangzhou, China in 1975, and currently occurs throughout the country. Currently, 21 serotypes of RA are recognized, and there is almost no cross-protection among the serotypes. In recent years, it has been reported that the incidence of chicken infection with RA has gradually increased in China. Both laying hens and broilers can be infected, and the infected age ranges from 20 to 200 days old. Clinical symptoms of chicken infection with RA can include respiratory symptoms, facial swelling, movement disorders, weight loss, decreased egg production rate, and decreased chicken embryo hatching rate. Postmortem examination shows airsacculitis, pericarditis, perihepatitis, etc. In general, the pathological changes after chicken infection with RA are similar to those in ducks and geese. Currently, the prevention and treatment of Riemerella anatipestifer disease mainly rely on vaccination, biosecurity measures, good feeding management, and the use of antibacterial drugs. However, currently, there are only commercial vaccines against duck-origin RA on the market, and there is no commercial vaccine against chicken-origin RA. As the losses caused by RA infection to the chicken farming industry are increasing, there is an urgent need for relevant vaccine products for the prevention of chicken-origin RA. Summary of the Invention

[0004] Aiming at the problem that the current commercial vaccines against duck-origin Riemerella anatipestifer have poor prevention and treatment effects on chicken infection with Riemerella anatipestifer, the present invention provides a chicken-origin Riemerella anatipestifer and its application in vaccines.

[0005] The present invention provides a strain of Riemerella anatipestifer, which is Riemerella anatipestifer cRA / HeN2024, with a preservation number of CGMCC No. 32898, a preservation date of December 4, 2024, and a preservation unit of the China General Microbiological Culture Collection Center, with a preservation address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The above-mentioned Riemerella anatipestifer is the chicken-origin Riemerella anatipestifer.

[0007] The above-mentioned Riemerella anatipestifer was collected from the oviduct exudate of diseased chickens showing respiratory symptoms.

[0008] The above-mentioned Riemerella anatipestifer is the type 1 Riemerella anatipestifer.

[0009] The present invention also provides the use of Riemerella anatipestifer in the preparation of an inactivated vaccine for preventing and treating chicken-origin Riemerella anatipestifer infection.

[0010] The present invention also provides an inactivated vaccine of Riemerella anatipestifer, which is prepared by propagating the Riemerella anatipestifer cRA / HeN2024 described in claim 1, passing the purity test, inactivating it, and then adding an adjuvant.

[0011] For the above-mentioned inactivated vaccine of Riemerella anatipestifer, the amount of inactivated Riemerella anatipestifer cRA / HeN2024 bacteria in the inactivated vaccine is 5.0×10 8 -1.5×10 10 CFU / mL.

[0012] For the above-mentioned inactivated vaccine of Riemerella anatipestifer, the amount of inactivated Riemerella anatipestifer cRA / HeN2024 bacteria in the inactivated vaccine is 1.0×10 9 CFU / mL.

[0013] The present invention also provides a preparation method of an inactivated vaccine of Riemerella anatipestifer, comprising the following steps:

[0014] S1. Primary seed propagation: Inoculate the isolated strain cRA / HeN2024 into a TSB medium containing 5% bovine serum, place it in a constant temperature shaker at 37°C for 20 h, then take the culture and streak it on a TSA plate containing 5% bovine serum, anaerobically culture it at 37°C for 16 h, pick 10 typical colonies, inoculate them into a TSB slant containing 5% bovine serum respectively, and then place it at 37°C for 24 h. After passing the purity test, it is used as the primary seed;

[0015] S2. Secondary seed propagation: Inoculate the primary seed into a TSB medium containing 5% bovine serum, place it in a constant temperature shaker at 37°C for 20 h, take a sample and pass the purity test to be used as the secondary seed;

[0016] S3. Inactivation: Aerobically culture the strain Riemerella anatipestifer cRA / HeN2024 in a fermenter. Fill the TSB medium at 70% of the fermenter capacity, sterilize it at 121°C for 30 min. When the temperature of the medium cools down to 37°C, add fetal bovine serum to make its final concentration 1%. Then inoculate the secondary seed liquid at 1% of the total amount of the medium, and culture it by gradually increasing the aeration volume at 37°C for 12 h. Conduct pure inspection and viable count, add formaldehyde solution at 0.2% of the total amount of the bacterial liquid, mix well, and inactivate it at 37°C for 48 h.

[0017] S4. Concentration: Concentrate the completely inactivated bacterial liquid by centrifugation, and adjust the final concentration of the bacterial liquid with sterile PBS to be not less than 1.5×10 9 CFU / mL.

[0018] S5. Preparation of oil phase: Take 94 parts of white oil for injection and 6 parts of Span-80, mix them, add 1 part of aluminum stearate, heat and melt until transparent, mix evenly, and obtain the oil phase after high-pressure sterilization.

[0019] S6. Preparation of water phase: Take 96 parts of the separated strain cRA / HeN2024 bacterial liquid, add 4 parts of Tween-80 after high-pressure sterilization, and mix well to obtain the water phase.

[0020] S7. Vaccine preparation: First start emulsification by adding the oil phase, then slowly add the prepared water phase. The ratio of the oil phase to the water phase is 2:1, and continue emulsification for 30 min. Add 1% thimerosal solution before the end of emulsification to make its final concentration 0.01%.

[0021] In the preparation method of the above Riemerella anatipestifer inactivated vaccine, the emulsification temperature in step S7 is 25 - 28°C.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] 1. The chicken-derived Riemerella anatipestifer cRA / HeN2024 provided by the present invention is isolated from the oviduct exudate of diseased chickens showing respiratory symptoms, showing oviduct tropism, and this strain has strong pathogenicity to chickens.

[0024] 2. The results of the plate agglutination test show that when the undiluted type 1 Riemerella anatipestifer positive serum is mixed with the isolated strain provided by the present invention, agglutination occurs; but when the positive serum is diluted 100 times, the agglutination phenomenon disappears, indicating that there are certain serological differences between the chicken-derived Riemerella anatipestifer of the present invention and the previously prepared duck-derived Riemerella anatipestifer positive serum.

[0025] 3. Through sequencing and analysis, the OmpA sequence of the chicken-origin Riemerella anatipestifer cRA / HeN2024 provided by the present invention has a low homology with the reported duck-origin and goose-origin Riemerella anatipestifer, and has a relatively distant genetic evolutionary relationship.

[0026] 4. The inactivated vaccine prepared from the chicken-origin Riemerella anatipestifer isolated by the present invention has excellent immunogenicity and can effectively prevent and treat air sac inflammation, salpingitis and pericarditis that occur after chickens are infected with RA. Description of the Drawings

[0027] Figure 1 It is the colony morphology diagram of the isolated strain cRA / HeN2024 of the present invention on a blood agar plate.

[0028] Figure 2 It is the Gram staining microscopic examination diagram of the isolated strain cRA / HeN2024 of the present invention.

[0029] Figure 3 It is the agarose gel electrophoresis diagram of the PCR amplification product of 16s rRNA of the isolated strain cRA / HeN2024 of the present invention; Lane 1 is the isolated strain; Lane 2 is the negative control; M is the DL2000 DNA Marker.

[0030] Figure 4 It is the genetic evolutionary tree of the nucleotide sequences of the ompA gene of the isolated strain cRA / HeN2024 of the present invention and the reference strain, and the ▲ in the figure represents the isolated strain.

[0031] Figure 5 It is the homology comparison result of the nucleotide sequences of the ompA gene of the isolated strain cRA / HeN2024 of the present invention and the reference strain.

[0032] Figure 6 It is the nucleotide comparison result of the isolated strain cRA / HeN2024 of the present invention and the reference strain Yh4 (JN871503.1).

[0033] Figure 7 It is the amino acid comparison result of the isolated strain cRA / HeN2024 of the present invention and the reference strain Yh4 (JN871503.1).

[0034] Figure 8 It is the multi-site lesion diagram of diseased chickens, where A is the air sac lesion; B is the salpingitis lesion; C is the pericardial effusion.

[0035] Figure 9It is a histological lesion diagram of diseased chickens; in the figure: A shows the histological lesion of the heart, presenting granular degeneration of cardiomyocytes and interstitial inflammatory cell infiltration (HE×400); B shows the histological lesion of the liver, presenting inflammatory cell infiltration (HE×400); C shows the histological lesion of the spleen, with a decrease in lymphocytes in the germinal center (HE×100); D shows the histological lesion of the lung, presenting congestion, edema and inflammatory cell infiltration (HE×400); E shows the histological lesion of the kidney, with inflammatory cell infiltration (HE×100); F shows the lesion of the oviduct.

[0036] Figure 10 It is a gross lesion diagram after immune challenge; among them, A is the air sac, without exudate; B is the oviduct, without exudate; C is the pericardium, without effusion. Specific implementation mode

[0037] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0038] Example 1: Isolation and identification of Riemerella anatipestifer from chickens

[0039] 1. Collection of diseased materials

[0040] The diseased materials were obtained from the oviduct exudate of 15-day-old laying hens showing respiratory symptoms in a laying hen farm in Henan.

[0041] 2. Isolation and identification

[0042] (1) Isolation

[0043] The aseptically collected oviduct exudate of diseased chickens was streaked on blood agar plates, tryptone soy agar (TSA) plates containing 5% bovine serum, MacConkey agar plates and ordinary nutrient agar plates, and cultured anaerobically in a 37°C constant temperature incubator for 12-24 h. The results are shown in Figure 1 .

[0044] The results showed that grayish-white, semi-transparent, neatly edged, smooth-surfaced, protruding, non-hemolytic dew-drop-like colonies could be formed on blood agar plates; colonies with similar morphology could be formed on tryptone soy agar plates containing 5% bovine serum, but no growth occurred on MacConkey agar and ordinary nutrient agar plates.

[0045] (2) Gram staining and microscopic examination

[0046] Single colonies of pure cultured bacteria were picked onto a clean glass slide and subjected to Gram staining. As shown in Figure 2 , Gram-negative short bacilli could be observed under the microscope, most of them were single, some were paired, and occasionally arranged in filaments, non-motile, and without spores.

[0047] Pick a single colony for purification and inoculate it on a tryptic soy agar plate containing 5% bovine serum. Incubate anaerobically at 37°C for 12 h.

[0048] (3) Biochemical identification

[0049] Add 5% bovine serum to a conventional fermentation tube, inoculate the purified strain, and incubate anaerobically in a 37°C constant temperature incubator for 48 - 72 h, then observe continuously for 48 h. The biochemical results of the isolated strain are shown in Table 1.

[0050] Table 1 Biochemical test results

[0051]

[0052] Note: “-” negative; “+” positive.

[0053] The results showed that the isolated strain could not ferment glucose, sucrose, maltose, fructose, lactose, galactose, mannitol; the nitrate reduction test, indole test, methyl red (MR) test, VP test, and hydrogen sulfide test were all negative; the catalase test and oxidase test were positive, which was in line with the basic biochemical characteristics of Riemerella anatipestifer.

[0054] (4) Serotype identification

[0055] The serological identification of the isolated strain was carried out by the plate agglutination method. The isolated and purified strain was inoculated into tryptic soy broth (TSB) medium containing 5% bovine serum and cultured in a 37°C constant temperature shaker for 12 - 24 h. After centrifugation, the bacterial cell precipitate was washed with PBS and resuspended. 10 μL of the bacterial cell suspension and an equal volume of Riemerella anatipestifer positive serum were taken for the agglutination test respectively. At the same time, positive and negative controls were set, and the experimental results were observed and recorded.

[0056] The results of the serological plate agglutination test showed that the isolated strain reacted positively with the RA1 type rabbit anti - positive serum and negatively with the 2nd, 4th, 5th, 6th, 7th, 10th, and 14th types, and the blank control reaction was negative.

[0057] (5) PCR identification

[0058] According to the 16s rRNA sequence of Riemerella anatipestifer, a pair of primers was designed, and the primer sequences were:

[0059] F: 5’ - AGAGTTTGATCMTGGCTCAG - 3’ (SEQ ID NO.1);

[0060] R: 5’ - TACGGCTACCTTGTTACGACTT - 3’ (SEQ ID NO.2).

[0061] The primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0062] Bacterial nucleic acids were extracted by the boiling method. The bacterial solution of the isolated strain was washed with sterile PBS, boiled for 10 min, and the supernatant was taken after centrifugation as the template for PCR amplification. The amplification reaction was carried out according to the DNA polymerase instruction manual. The reaction procedure was pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 90 sec, for a total of 30 cycles, and final extension at 72°C for 5 min.

[0063] The PCR amplification products were electrophoresed on 1% agarose gel, and the electrophoresis results were observed on a gel imager. The results are shown in Figure 3 , and the size of the target fragment was about 1465 bp, which was consistent with the expectation.

[0064] The obtained target fragment was ligated to the pMD18-T vector and then transformed into Top10 competent cells. Positive colonies were picked for PCR identification, and the bacterial solution of the positive colonies was sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The sequencing results were subjected to BLAST alignment analysis with the gene sequence of RA in GenBank. The results showed that the homology of the 16s rRNA sequence with the RA reference strain ATCC 11845 reached 99.67%. It was named cRA / HeN2024.

[0065] Partial sequence of 16s rRNA of the isolated strain cRA / HeN2024:

[0066] AGGGAGGGTAGACTGCAAGCCGAGCGGTAGAGTATCTTCGGATACTTGAGAGCGGCGTACGGGTGCGGAACACGTGTGCAACCTGCCTTTATCAGAGGGATAGCCTTTCGAAAGGAAGATTAATACCTCATAATATACTGATTGGCATCAATTAGTATTGAAAGCTCTGGCGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCAATGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGACAATGGGTGGAAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTACAGAGATAAACCTACTCTCGTGAGGGTAGCTGAAGGTACTGTACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGCAGGCGGGCTAGTAAGTCAGTGGTGAAAGCCTACAGCTTAACTGTAGAACTGCCGTTGATACTGCTAGTCTTGAGTATAGTTGAGGTAGCTGGAATGAGTAGTGTAGCGGTGAAATGCATAGATATTACTCAGAACACCGATTGCGAAGGCAGGTTACCAAGTTATAACTGACGCTGAGGGACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGCTAACTCGTTTTTGGGCTTTAGGGTTCAGAGACTAAGCGAAAGTGATAAGTTAGCCACCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGGGGATCATGGGGTTTAATTCGATGA(SEQ ID NO.3).

[0067] (6) ompA gene sequencing

[0068] Design a pair of cRA / HeN2024ompA gene amplification primers, and the primer sequences are as follows:

[0069] ompA-F: GGCGTTAGTTCTTGACTGGC (SEQ ID NO.4);

[0070] ompA-R: TTCAAACGCACGTCCCATAA (SEQ ID NO.5);

[0071] The length of the PCR amplification product is 1375bp.

[0072] The obtained sequence was compared for homology with the published reference strains of Riemerella anatipestifer in the Gen Bank database (see Table 2), and a phylogenetic tree and a homology rate map were constructed, as Figure 4 and Figure 5 shown.

[0073] Table 2 Sequence information of reference strains

[0074]

[0075] *NA indicates unknown. Combining the results of Table 2 and Figure 4 it can be known from the result analysis that the isolate cRA / HeN2024 belongs to a separate branch. Among them, the ompA gene of cRA / HeN2024 and the Chinese duck-derived strains Yh4

[0076] (JN871503.1), WJ4 (MF953475.1) and YXb1 (MF458999.1) in the reference strains belong to the same large evolutionary lineage and have a relatively close genetic distance; while the genetic distance from the Chinese chicken-derived strains 20190604J2-1 (CP072196.1), S63 (CP110126.1) and RA-20011 (MT380216.1) in the reference strains is slightly farther. It is suggested that the isolate cRA / HeN2024 in this experiment may be transmitted across species from duck-derived Riemerella anatipestifer.

[0077] Combining the results of Table 2 and Figure 5 it can be seen that the nucleotide homology of the ompA gene between the isolate cRA / HeN2024 and Riemerella anatipestifer in the reference strains is 89.1% - 97.0%. Its homology with the Chinese duck-derived strain Yh4 (JN871503.1) in the reference strains is the highest, which is 97.0%; the homology with the Korean duck-derived strain KVCC-BA0001842 (JX069949.1) is the lowest, which is 89.1%.

[0078] To further explore the differences between the isolate cRA / HeN2024 and the reference strain Yh4 (JN871503.1) with the highest homology, nucleotide alignment and amino acid alignment were performed between the isolate cRA / HeN2024 and Yh4 (JN871503.1). The results of nucleotide alignment are shown in Figure 6 and Table 3, and the results of amino acid alignment are shown in Figure 7 and Table 4.

[0079] Table 3 Nucleotide mutation sites of the isolate cRA / HeN2024 compared with the reference strain Yh4 (JN871503.1)

[0080]

[0081] Table 4 Amino acid mutation sites of the isolate cRA / HeN2024 compared with the reference strain Yh4 (JN871503.1)

[0082]

[0083] Combined with Figure 6 、 Figure 7 and the results of Table 3 and Table 4, it can be seen that there are 35 nucleotide mutations in the isolate cRA / HeN2024 compared with the reference strain Yh4 (JN871503.1), and correspondingly 8 missense mutations in amino acids.

[0084] (7) Drug sensitivity

[0085] The drug sensitivity test of the isolated strain was carried out by the disk agar diffusion method (K-B method). The bacterial suspension of the purified and cultured isolated strain was evenly spread on the blood agar plate. The drug sensitivity disks of 16 selected antibacterial drugs were pasted on the culture medium and anaerobically cultured in a constant temperature incubator at 37°C for 24 - 48 h. The diameter of the inhibition zone was measured using a vernier caliper. The drug sensitivity was determined with reference to the antimicrobial susceptibility test standards established by the Clinical and Laboratory Standards Institute (CLSI) of the United States. The results are shown in Table 5.

[0086] Table 5 Results of the drug sensitivity test of the isolated strain

[0087]

[0088] Note: R: Resistant; I: Intermediate; S: Sensitive.

[0089] As can be seen from Table 5, the isolated strain cRA / HeN2024 is sensitive to cefotaxime, ofloxacin, ciprofloxacin, neomycin, kanamycin, and penicillin; intermediate to cefradine; and resistant to azithromycin, trimethoprim, florfenicol, tetracycline, lincomycin, and clindamycin.

[0090] Example 2: Virulence determination test of the isolated strain cRA / HeN2024

[0091] Fifteen healthy laying hens raised to 15 days old were selected and randomly divided into 2 infection groups and 1 control group, with 5 hens in each group. The two infection groups were respectively injected with 0.5 mL per hen of the purified isolated strain with a bacterial liquid concentration of 1.0×10 9 CFU / mL by intramuscular injection and intraperitoneal injection. The control group was injected with sterile culture medium of the same volume. They were raised in isolation, and the signs and clinical manifestations of the chickens in each group were observed and recorded every day for 7 days. Finally, the experimental animals were dissected to observe the tissue lesions and samples from the lesion sites were collected for subsequent detection.

[0092] The results of the infection groups showed that after infecting with the isolated strain for 12 - 24 h, some chickens showed symptoms such as listlessness, loss of appetite, and huddling together. After 36 - 48 h of infection, the above symptoms were alleviated or disappeared. The chickens with clinical symptoms were dissected, and the results are shown in Figure 8 , it can be seen that there was yellow effusion in the pericardium, yellow caseous exudate in the air sac, and caseous exudate in the oviduct. The control group had no clinical symptoms and no abnormalities were found during dissection. RA was still isolated from the bodies of the chickens in the infection groups.

[0093] The histopathological results are shown in Figure 9 , and the observation results showed that there were focal inflammatory cell infiltrations in the liver, mainly lymphocytes; the spleen showed rupture, shrinkage, and disappearance of the myelocyte nuclei; the heart showed inflammatory cell infiltration in the pericardium, mainly lymphocytes, as well as granular degeneration of cardiomyocytes, interstitial inflammatory cell infiltration, and necrosis of myocardial fibers; the lungs were congested and edematous with inflammatory cell infiltration; the oviduct contained exudate mixed with epithelial cells.

[0094] Example 3: Immunogenicity determination

[0095] The isolated strain cRA / HeN2024 was inoculated into TSB medium containing 5% bovine serum, cultured overnight at 37°C and then counted. After collecting the bacterial cells, they were respectively diluted to four groups of 1.0×10 6 , 1.0×10 7 , 1.0×10 8 , 1.0×10 9 CFU / mL. The inactivated bacterial liquid that passed the inactivation test was washed with sterile PBS. Take 96 parts of the prepared inactivated bacterial liquid and 4 parts of sterilized Tween - 80 and mix them well in a sterilized container to obtain the aqueous phase; take 94 parts of white oil for injection and 6 parts of Span - 80, mix them, add 1 part of aluminum stearate, heat and melt until transparent, mix evenly, and sterilize by high - pressure steam for later use to obtain the oil phase. Slowly add 2 parts of the oil phase to 1 part of the aqueous phase and emulsify. After passing the sterility test, it was used for chicken immunization.

[0096] After raising 50 one-day-old healthy chicks to 7 days old, they were randomly divided into 5 groups with 10 chicks in each group. They were respectively subcutaneously injected in the neck with inactivated vaccines containing different antigen contents, 0.25 mL per animal, and the control group was immunized with the same dose of vaccine without antigen. 14 days after the primary immunization, they were challenged, and each animal was intramuscularly injected with 0.5 mL of the isolated strain cRA / HeN2024 at 1.0×10 9 CFU / mL. They were continuously observed for 14 days after the challenge to detect the protective effect of the vaccine, and the results are shown in Table 6.

[0097] Table 6 Results of the immunogenicity test of the isolated strain cRA / HeN2024

[0098]

[0099] As can be seen from Table 6, when the antigen content was 1.0×10 8 CFU / mL, the challenge protection rate reached 90%; when the antigen content was 1.0×10 9 CFU / mL, the challenge protection rate reached 100%.

[0100] Example 4: Preparation of the vaccine

[0101] (1) Primary seed propagation

[0102] The isolated strain cRA / HeN2024 was inoculated into TSB medium containing 5% bovine serum and cultured in a constant temperature shaker at 37°C for 20 h. Then, the culture was streaked on a TSA plate containing 5% bovine serum and anaerobically cultured at 37°C for 16 h. 10 typical colonies were picked and respectively inoculated into a TSB slant containing 5% bovine serum, and then cultured at 37°C for 24 h. After passing the purity test, they were used as primary seeds. They were stored at 4°C and the usage period did not exceed 14 days.

[0103] (2) Secondary seed propagation

[0104] The primary seeds were inoculated into TSB medium containing 5% bovine serum and cultured in a constant temperature shaker at 37°C for 20 h. Those that passed the purity test of the samples were used as secondary seeds. They were stored at 4°C and the usage period did not exceed 3 days.

[0105] (3) Concentration and inactivation

[0106] Aeration culture of Riemerella anatipestifer strain cRA / HeN2024 was carried out in a fermenter. The TSB medium was filled into the fermenter at 70% of its capacity and sterilized at 121 °C for 30 min. When the temperature of the medium cooled to 37 °C, fetal bovine serum was added to make its final concentration 1%. Then, the secondary seed liquid was inoculated at 1% of the total amount of the medium, and the culture was carried out by gradually increasing the aeration volume at 37 °C for 12 h. Pure inspection and viable count were performed, and formaldehyde solution was added at 0.2% of the total amount of the bacterial liquid, mixed well, and inactivated at 37 °C for 48 h. The completely inactivated bacterial liquid was concentrated by centrifugation, and the concentration of the bacterial liquid was adjusted with sterile PBS to be not less than 1.5×10 9 CFU / mL.

[0107] (4) Preparation of the oil phase

[0108] Take 94 parts of white oil for injection and 6 parts of Span-80, mix them, add 1 part of aluminum stearate, heat and melt until transparent, mix evenly, and sterilize under high pressure for standby.

[0109] (5) Preparation of the water phase

[0110] Take 96 parts of the bacterial liquid of the isolated strain cRA / HeN2024, add 4 parts of Tween-80 after high-pressure sterilization, and mix well.

[0111] (6) Emulsification

[0112] First, add 2 parts of the oil phase, start the emulsification, then slowly add 1 part of the prepared water phase. After adding, emulsify for another 30 min (the emulsification temperature should be controlled between 25 and 28 °C). Before the end of emulsification, add 1% thimerosal solution to make its final concentration 0.01%. The concentration of the bacterial liquid in the final vaccine is 1.0×10 9 CFU / mL, quantitatively sub-packaged, and sealed with a lid.

[0113] (7) Vaccine inspection

[0114] Appearance of properties: Milky white emulsion;

[0115] Dosage form: Absorb a small amount of the vaccine and drop it on the surface of cold water. Except for the first drop, all show oil droplets that do not spread, showing a water-in-oil type;

[0116] Stability: Absorb 10 mL of the vaccine, place it in a centrifuge tube, centrifuge at 3000 r / min for 15 min, and the water phase precipitated at the bottom of the tube is not higher than 0.5 mL.

[0117] Viscosity: Determined according to the appendix of the current "Chinese Veterinary Pharmacopoeia", and it meets the requirements.

[0118] Fill volume: Check the fill volume according to the appendix of the current "Chinese Veterinary Pharmacopoeia", and it meets the requirements.

[0119] Sterility test: The sterility test was carried out according to the appendix of the current Chinese Veterinary Pharmacopoeia, and no growth was observed.

[0120] Example 5: Vaccine safety and potency tests

[0121] (1) Safety verification

[0122] Ten 7-day-old healthy laying hens were selected and immunized with the vaccine preparation prepared in Example 4 by subcutaneous injection into the neck at a dose of 0.4 mL per chicken, and observed continuously for 14 days.

[0123] The experimental results showed that all the test chickens were healthy and alive, and no other abnormal clinical symptoms appeared.

[0124] (2) Potency test

[0125] Twenty 7-day-old healthy chickens were selected. Ten chickens in the immunization group were subcutaneously injected with 0.25 mL of the vaccine into the neck, and ten chickens in the control group were not vaccinated. Fourteen days after vaccination, blood was collected from all chickens to separate serum, and the serum antibody titer was detected. The blood was collected to determine the antibody agglutination titer. The geometric mean of the antibody titers in the sera of the chickens in the immunization group was not less than 1:16, and the geometric mean of the antibody titers in the sera of the chickens in the control group was not higher than 1:2.

[0126] Example 6: Vaccine potency test

[0127] Three batches of inactivated vaccines were prepared according to the method of Example 4. Forty 7-day-old healthy chickens were selected. Ten chickens in each immunization group were subcutaneously injected with 0.25 mL of the vaccine into the neck, and ten chickens in the control group were not vaccinated. Fourteen days after vaccination, all chickens were intramuscularly injected with 0.5 mL of the bacterial solution of the isolated strain cRA / HeN2024 (1.0×10 9 CFU / mL) for challenge, and observed for 14 days. The results are shown in Figure 10 and Table 7.

[0128] Table 7 Results of the potency test of the inactivated vaccine

[0129]

[0130] As can be seen from Table 7, the geometric mean of the serum antibody titers of each batch of vaccines in the immunization group reached 1:18.75 - 1:23.21, and the challenge protection rate reached 90% and above (9 / 10 - 10 / 10), and all the chickens in the control group developed the disease. It can be seen that Figure 10 the air sacs of the chickens challenged after vaccination by injection had no exudate, the oviducts had no exudate, and the pericardium had no effusion.

[0131] The above are only the preferred embodiments of the present invention, which do not limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A strain of Riemerella anatipestifer, characterized in that: The Riemerella anatipestifer is Riemerella anatipestifer cRA / HeN2024, with the preservation number of CGMCC No. 32898, the preservation date of December 4, 2024, the preservation unit of the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the preservation address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Riemerella anatipestifer according to claim 1, characterized in that: The Riemerella anatipestifer is a chicken-origin Riemerella anatipestifer.

3. The Riemerella anatipestifer according to claim 2, characterized in that: This Riemerella anatipestifer was isolated from the oviduct exudate of diseased chickens showing respiratory symptoms.

4. The Riemerella anatipestifer according to claim 1, characterized in that: The Riemerella anatipestifer is Riemerella anatipestifer serotype 1.

5. Use of the Riemerella anatipestifer according to claim 1 in the preparation of an inactivated vaccine for preventing and treating chicken-origin Riemerella anatipestifer infection.

6. A Riemerella anatipestifer inactivated vaccine, characterized in that: This vaccine is prepared by breeding the Riemerella anatipestifer cRA / HeN2024 according to claim 1, passing the purity test after inactivation, and then adding adjuvants.

7. The inactivated vaccine against Riemerella anatipestifer according to claim 6, wherein: The amount of inactivated Riemerella anatipestifer cRA / HeN2024 bacteria in the inactivated vaccine is 5.0×10 8 -1.5×10 10 CFU / mL.

8. The inactivated vaccine against Riemerella anatipestifer according to claim 7, wherein: The amount of inactivated Riemerella anatipestifer cRA / HeN2024 bacteria in the inactivated vaccine is 1.0×10 9 CFU / mL.

9. The preparation method of the inactivated vaccine against Riemerella anatipestifer according to any one of claims 6-8, characterized in that: It includes the following steps: S1. Primary seed propagation: Inoculate the isolated strain cRA / HeN2024 into a TSB medium containing 5% bovine serum, place it in a constant temperature shaker at 37°C for 20 h, then streak the culture on a TSA plate containing 5% bovine serum, anaerobically culture it at 37°C for 16 h, pick 10 typical colonies, inoculate them into a TSB slant containing 5% bovine serum respectively, and then culture them at 37°C for 24 h. After passing the purity test, they are used as primary seeds. S2. Secondary seed propagation: Inoculate the primary seeds into a TSB medium containing 5% bovine serum, place it in a constant temperature shaker at 37°C for 20 h, and take samples for purity test. After passing the test, they are used as secondary seeds. S3. Inactivation: Aerobically culture the Riemerella anatipestifer cRA / HeN2024 strain in a fermenter, fill 70% of the fermenter volume with TSB medium, sterilize it at 121°C for 30 min. When the medium temperature cools to 37°C, add fetal bovine serum to make its final concentration 1%; then inoculate the secondary seed liquid at 1% of the total amount of the medium, and culture it by gradually increasing the aeration volume at 37°C for 12 h; conduct purity test and viable count, add formaldehyde solution at 0.2% of the total amount of the bacterial liquid, mix well, and inactivate it at 37°C for 48 h. S4, Concentration: The completely inactivated bacterial solution is concentrated by centrifugation, and the final concentration of the bacterial solution is adjusted with sterile PBS to be not less than 1.5×10 9 CFU / mL; S5. Preparation of the oil phase: Mix 94 parts of white oil for injection and 6 parts of Span-80, add 1 part of aluminum stearate, heat and melt until transparent, mix evenly, and obtain the oil phase after high-pressure sterilization. S6. Preparation of the water phase: Take 96 parts of the bacterial liquid of the isolated strain cRA / HeN2024, add 4 parts of Tween-80 after high-pressure sterilization, and mix well to obtain the water phase. S7. Vaccine preparation: First, start the emulsification by adding the oil phase, then slowly add the prepared water phase. The ratio of the oil phase to the water phase is 2:1, and continue emulsifying for 30 min; add a 1% thimerosal solution before the end of emulsification to make its final concentration 0.01%.

10. The preparation method of the inactivated vaccine against Riemerella anatipestifer according to claim 9, characterized in that: The emulsification temperature in step S7 is 25 - 28°C.

Images