Recombinant microorganism and application thereof in fermentation production of decarboxylated carnosine

By enhancing the expression of mdtK gene in E. coli and overexpressing specific transport proteins, the problem of insufficient decarboxylic carnosine production is solved, and efficient production and cost-saving decarboxylic carnosine synthesis is achieved.

CN120290447AActive Publication Date: 2025-07-11BEIJING KANSENBIO TECH CO LTD

Patent Information

Application Number
CN202510772306.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-07-11
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

In the prior art, during the synthesis of decarboxylic carnosine by E. coli in the microbial fermentation process, the transport effect of transport protein on decarboxylic carnosine is unknown, resulting in insufficient yield. In addition, precursors such as L-histidine, histamine or β-alanine are added during the production process, which is relatively costly.

Method used

By enhancing the expression of mdtK gene in E. coli, overexpressing specific transport proteins, promoting the efflux of decarboxylic carnosine to the extracellular cell, the overexpression of mdtK gene is achieved through plasmid or genome integration, and the yield of decarboxylic carnosine is increased.

Benefits of technology

It significantly increases the yield of decarboxylic carnosine without increasing bacterial accumulation, reduces production costs, and avoids the addition of precursors such as L-histidine, histamine or β-alanine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses a recombinant microorganism and application thereof in fermentation production of decarboxylated carnosine. Compared with an original strain, the recombinant microorganism disclosed by the invention has the advantages that the expression of the mdtK gene is enhanced; the starting strain is escherichia coli capable of producing decarboxylated carnosine. When the recombinant microorganism is used for fermentation production, the yield of the decarboxylated carnosine can be increased, L-histidine, histamine or beta-alanine and other precursors do not need to be added in the production process, and an effective novel method is provided for industrial production of the decarboxylated carnosine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and specifically, to a recombinant microorganism and its application in the fermentative production of decarboxylated carnosine. Background Art

[0002] Decarboxylated carnosine is a dipeptide composed of β-alanine and histamine. It was first discovered in crustaceans and has also been found in tissues such as the mammalian heart, kidney, and gastrointestinal tract. Decarboxylated carnosine has anti-glycation, antioxidant, anti-inflammatory, and repair effects and is widely used in the cosmetic field. At the same time, decarboxylated carnosine has pharmacological activities such as neuron activation and has application value in the treatment of diseases such as epilepsy, motor, or cognitive defects. Decarboxylated carnosine can be prepared by chemical synthesis or enzymatic catalysis. Compared with these two preparation methods, the microbial fermentation method uses glucose as a raw material to prepare decarboxylated carnosine without adding precursors such as L-histidine, histamine, or β-alanine, and has the advantages of low cost, mild reaction conditions, high production efficiency, and environmental friendliness, and is suitable for large-scale industrial production.

[0003] In Escherichia coli, the synthesis of decarboxylated carnosine by the microbial fermentation method is as follows: Glucose is used to synthesize L-histidine and L-aspartic acid. L-histidine is catalyzed by histidine decarboxylase encoded by hdc genes to generate histamine, and L-aspartic acid is catalyzed by aspartate-α-decarboxylase encoded by panD genes to generate β-alanine. Histamine and β-alanine are catalyzed by non-ribosomal peptide synthetase encoded by ebony genes and sfp phosphopantetheinyl transferase encoded by genes to generate decarboxylated carnosine. Transport is a key factor affecting the yield of microbial fermentation products. Enhancing the transport of products to the extracellular can avoid metabolic burden and feedback inhibition caused by intracellular accumulation of products, which is beneficial to maximizing the yield. However, the transport effect of the transport proteins expressed by Escherichia coli on decarboxylated carnosine is unknown. Therefore, it is still necessary to further study how to improve the yield of the target product. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a new recombinant microorganism that can improve the yield of decarboxylated carnosine.

[0005] The present invention provides a recombinant microorganism. Compared with the starting strain, the expression of mdtK genes is enhanced; the starting strain is Escherichia coli capable of producing decarboxylated carnosine.

[0006] The present invention provides a novel recombinant microorganism capable of enhancing the production of decarboxylated carnosine. By overexpressing a specific transporter protein, it effectively promotes the efflux of decarboxylated carnosine to the extracellular space without having a negative effect on the production of decarboxylated carnosine, thereby achieving an increase in the yield of decarboxylated carnosine. Moreover, the recombinant microorganism of the present invention does not require the addition of precursors such as L-histidine, histamine, or β-alanine during the production process, which helps to save production costs.

[0007] In the recombinant microorganism of the present invention, the overexpression mdtK gene is achieved by making the starting strain contain a plasmid capable of expressing mdtK the gene, or by integrating mdtK the gene into the genome of the starting strain.

[0008] Those skilled in the art can achieve the overexpression of mdtK the gene through conventional means. Whether by integrating mdtK the gene into the genome additionally or by expressing it through a plasmid, the recombinant microorganism can achieve the effect of enhancing the fermentation yield of decarboxylated carnosine.

[0009] In the recombinant microorganism of the present invention, the method for enhancing the expression of mdtK the gene is selected from any one or an optional combination of the following 1) to 6): 1) By introducing a plasmid having the mdtK gene; 2) By increasing the copy number of the mdtK gene on the Escherichia coli chromosome; 3) By changing the promoter sequence of the mdtK gene on the Escherichia coli chromosome; 4) By operably linking a strong promoter to the mdtK gene; 5) By introducing an enhancer of the mdtK gene; 6) By using a gene encoding a corresponding enzyme or protein with high activity or mdtK a homologous gene for enhancement.

[0010] In the recombinant microorganism of the present invention, the gene encoding a corresponding enzyme or protein with high activity is a codon-optimized mdtK gene.

[0011] In the recombinant microorganism of the present invention, the starting strain overexpresses a hisGDCBHAFI gene fragment compared to the wild-type Escherichia coli, and expresses exogenous panD genes, hdc genes, sfp genes, and ebony genes.

[0012] In the recombinant microorganism of the present invention, the hisGDCBHAFI gene is derived from Escherichia coli ; the panD gene is derived from Bacillus subtilis or Corynebacterium g lutamicum ; the hdc gene is derived from Photobacterium phosphoreum ; the sfp gene is derived from Bacillus subtilis ; the ebony gene is derived from Drosophila melanogaster or Zeugodacus cucurbitae .

[0013] Preferably, in the recombinant microorganism of the present invention, the hisGDCBHAFI gene fragment is as shown in SEQ ID NO:1.

[0014] The recombinant Escherichia coli capable of producing decarboxylated carnosine in the present invention can be different, and overexpression of the transporter protein gene mdtK can improve the yield of decarboxylated carnosine.

[0015] The present invention also provides the application of the above recombinant microorganism in the fermentation production of decarboxylated carnosine.

[0016] The present invention also provides the application of the above recombinant microorganism in the microbial transformation for producing decarboxylated carnosine or improving the yield of bioproduction of decarboxylated carnosine.

[0017] The present invention also provides a method for fermentatively producing decarboxylated carnosine, which includes the step of culturing the above recombinant microorganism.

[0018] The present invention also provides a method for constructing a recombinant microorganism capable of producing decarboxylated carnosine, which includes the step of enhancing the expression of the mdtK gene in the starting strain; the starting strain is Escherichia coli capable of producing decarboxylated carnosine.

[0019] In the method of the present invention, compared with the wild-type Escherichia coli, the starting strain overexpresses the hisGDCBHAFI gene fragment, expresses exogenous panD gene, hdc gene, sfp gene and ebony gene; and / or, the mode of enhancing the expression of the mdtK gene is selected from any one of the following 1) to 6), or an optional combination: 1) By introducing a plasmid with the mdtK gene; 2) By increasing the copy number of the mdtK gene on the Escherichia coli chromosome; 3) By changing the promoter sequence of the mdtK gene on the Escherichia coli chromosome; 4) By operably linking a strong promoter to the mdtK gene; 5) By introducing an enhancer of the mdtK gene; 6) By using a gene encoding a corresponding enzyme or protein with high activity or a mdtK homologous gene for enhancement.

[0020] The beneficial effects of the present invention are at least as follows: The present invention provides a new recombinant microorganism for producing decarboxylated carnosine, which can obtain a higher yield, and does not require the addition of precursors such as L-histidine, histamine or β-alanine during the production process, which is beneficial to saving production costs. Detailed implementation mode

[0021] The preferred implementation modes of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for illustrative purposes and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0022] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources or prepared by conventional methods in the art unless otherwise specified.

[0023] Example 1: Construction and transformation of a decarboxylated carnosine-producing strain 1. Construction of a decarboxylated carnosine-producing strain: Using the Escherichia coli MG1655 genome as a template, the gene fragment was amplified with primers hisG-F (atgacagacaacactcgtttacgcatag, SEQ ID NO:7) and hisI-R (tcactgatgccgtttacgcagg, SEQ ID NO:8) hisGDCBHAFI (the sequence is shown in SEQ ID NO:1), and the hisGDCBHAFI fragment was ligated to the backbone of the pTrc99a plasmid (purchased from Addgene plasmid, plasmid number 155179) to obtain the recombinant plasmid pTrc99a-hisGDCBHAFI.

[0024] Using Bacillus subtilis source BspanD gene (the sequence shown in GenBank: 939033) and Photobacterium phosphoreum source PphdcGene (sequence shown in GenBank: AAO65983.1), and the BspanD gene and Pphdc gene expression module Ptrc-BspanD-Pphdc, the sequence of which is shown in SEQ ID NO:2. The Ptrc-BspanD-Pphdc fragment was ligated to the backbone of the pCDFDuet-1 plasmid (purchased from Addgene plasmid, plasmid number 172718) to obtain the recombinant plasmid pCDF-BspanD-Pphdc.

[0025] Using Bacillus subtilis derived from sfp gene (sequence shown in GenBank: BAA09125.1) and Drosophila melanogaster derived from Dmebony gene (sequence shown in GenBank: CAA11962.1), and Dmebony the gene sequence was optimized for Escherichia coli codons, and the sfp gene and Dmebony gene expression module Ptrc-sfp-Dmebony, the sequence of which is shown in SEQ ID NO:3, were artificially synthesized. The Ptrc-sfp-Dmebony fragment was ligated to the backbone of the pBbA1k plasmid (purchased from Addgene plasmid, plasmid number 35336) to obtain the recombinant plasmid pBbA1k-sfp-Dmebony.

[0026] The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc and pBbA1k-sfp-Dmebony were electrotransformed into MG1655 to obtain the recombinant strain STR01.

[0027] 2. Construction of a carnosine-producing strain expressing transporter genes with plasmids: Select 10 specific transporter genes related to efflux in the Escherichia coli genome acrD , acrF , fsr , emrD , emrE , mdfA , mdtG , mdtK , bcr and kefG, the corresponding NCBI numbers are AAC75523.1, AAC76298.1, AAC73581.1, AAC76696.2, AAC73644.1, AAC73929.1, AAC74137.1, AAT48136.1, AAC75243.1, AAC76376.1 respectively. The gene sequences were amplified using the Escherichia coli genome as a template and constructed on the plasmid pBbA1k-sfp-Dmebony through Gibson assembly to obtain plasmids pBbA1k-sfp-Dmebony-acrD, pBbA1k-sfp-Dmebony-acrF, pBbA1k-sfp-Dmebony-fsr, pBbA1k-sfp-Dmebony-emrD, pBbA1k-sfp-Dmebony-emrE, pBbA1k-sfp-Dmebony-mdfA, pBbA1k-sfp-Dmebony-mdtG, pBbA1k-sfp-Dmebony-mdtK, pBbA1k-sfp-Dmebony-bcr and pBbA1k-sfp-Dmebony-kefG that express 10 transporter genes respectively.

[0028] The plasmid pBbA1k-sfp-Dmebony-acrD expressing the transporter gene and the recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc were introduced into MG1655 by electroporation to obtain the carnosine decarboxylase-producing strain STR02 expressing the transporter gene with the plasmid. acrD Similarly, the other 9 plasmids expressing transporter genes were each introduced into MG1655 by electroporation with the recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc, and the carnosine decarboxylase-producing strains STR03 to STR11 expressing the transporter gene with the plasmid were obtained respectively.

[0029] The recombinant strains STR01 to STR11 were cultured overnight on an LB plate. Single colonies were picked and inoculated into test tubes containing 5 mL of LB medium, and cultured at 37 °C and 200 rpm for 12 hours. Then, they were inoculated into 500 mL baffled flasks containing 50 mL of fermentation medium at an inoculation amount of 5%, and cultured at 37 °C and 200 rpm until the OD600 reached 0.6. Then, 0.1 mM IPTG was added, the culture temperature was reduced to 25 °C, and the culture was continued for 48 h. The fermentation medium formula includes (1 L): 20 g of glucose, 0.8 g of magnesium sulfate heptahydrate, 4 g of diammonium hydrogen phosphate, 6.67 g of potassium dihydrogen phosphate, 1.35 g of potassium citrate, 20.9 g of 3-morpholinopropanesulfonic acid, 2.5 g of yeast powder, 50 mg of ferrous sulfate heptahydrate, 10 mg of calcium chloride dihydrate, 11 mg of zinc sulfate heptahydrate, 2.5 mg of manganese sulfate tetrahydrate, 5 mg of copper sulfate pentahydrate, 0.5 mg of ammonium molybdate, and 0.1 mg of sodium borate decahydrate. The product concentration of the 48 h fermentation sample was detected by high performance liquid chromatography, and the growth of the strains was detected by a spectrophotometer. The results are shown in Table 1.

[0030] Table 1

[0031] The above results show that for strain STR09 expressing the transporter protein gene with a plasmid mdtK compared with strain STR01 that does not express the transporter protein gene with a plasmid, the production of decarboxylated carnosine increased by 51.22%, and the OD 600 was basically the same, indicating that expressing the transporter protein gene with a plasmid mdtK can significantly increase the production of decarboxylated carnosine without affecting the accumulation of the bacterial cells.

[0032] Example 2. Effect of integrating and expressing mdtK genes on the production of decarboxylated carnosine 1. Integrating and expressing lacZ genes at the mdtK locus in the Escherichia coli genome using the Ptrc promoter: Using the mdtK gene from Escherichia coli, an mdtKThe gene expression module Ptrc-mdtK has a sequence as shown in SEQ ID NO:4. Using the Escherichia coli MG1655 (ATCC 700926) genome as a template, the upstream homologous arm lacZ-U was amplified with primers lacZ-U-F (gctggttgccaacgatcagatgg, SEQ ID NO:9) and lacZ-U-R (gccggatgattaattgtcaaagcctggggtgcctaatgagt, SEQ ID NO:10), and the downstream homologous arm lacZ-D was amplified with primers lacZ-D-F (tgcaacgagcatcccgctaataataaccgggcaggccatgtc, SEQ ID NO:11) and lacZ-D-R (aaattcgaaattactgcgacggctg, SEQ ID NO:12). The three parts of lacZ-U, Ptrc-mdtK and lacZ-D were subjected to overlap extension PCR to obtain the targeting fragment lacZ-Donor. Using the plasmid pTargeF (purchased from Addgene plasmid, plasmid number 62226) as a template, primers pTarget-lacZ-F (gcgctgggtcggttacggccgttttagagctagaaatagcaagttaaaataaggctag, SEQ ID NO:13) and pTarget-lacZ-R (ggccgtaaccgacccagcgcactagtattatacctaggactgagctagctg, SEQ ID NO:14) were used for amplification to obtain the plasmid pTarget-lacZ. The targeting fragment lacZ-Donor, the plasmid pTarget-lacZ and the plasmid pCas (purchased from Addgene plasmid, plasmid number 62225) were electrotransformed into Escherichia coli MG1655 to obtain a recombinant strain STR12 with integrated expression lacZ at the mdtK locus. The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-BspanD-Pphdc and pBbA1k-sfp-Dmebony were electrotransformed into STR12 to obtain the recombinant strain STR13.

[0033] 2. Integrated expression mdtK Effect of the According to the fermentation method in Example 1, the recombinant strains STR01 and STR13 were fermented. The detection results after 48 hours showed that the carnosine decarboxylase production in the fermentation broth of STR01 and STR13 strains was 0.79 g / L and 1.08 g / L respectively, indicating that the integrated expression mdtK gene could increase the carnosine decarboxylase production by 36.71%.

[0034] Example 3. Verification of carnosine decarboxylase-producing strains constructed with genes from different sources mdtK Effect of the gene 1. Construction of carnosine decarboxylase-producing strains: Using Corynebacterium g lutamicum -sourced CgpanD gene (sequence shown in GenBank: 1021120) and Photobacterium phosphoreum -sourced Pphdc gene, an CgpanD gene and Pphdc gene expression module Ptrc-CgpanD-Pphdc controlled by the synthetic Ptrc promoter, with the sequence shown in SEQ ID NO:5. The Ptrc-CgpanD-Pphdc fragment was ligated to the backbone of the pCDFDuet-1 plasmid (purchased from Addgene plasmid, plasmid number 172718) to obtain the recombinant plasmid pCDF-CgpanD-Pphdc.

[0035] Using Bacillus subtilis -sourced sfp gene and Zeugodacus cucurbitae -sourced Zcebony gene (sequence shown in NCBI: XP_011180928.2), and Zcebony the gene sequence was optimized for Escherichia coli codons, and an sfp gene and Zcebony gene expression module Ptrc-sfp-Zcebony controlled by the synthetic Ptrc promoter, with the sequence shown in SEQ ID NO:6. The Ptrc-sfp-Zcebony fragment was ligated to the backbone of the pBbA1k plasmid (purchased from Addgene plasmid, plasmid number 35336) to obtain the recombinant plasmid pBbA1k-sfp-Zcebony. The recombinant plasmids pTrc99a-hisGDCBHAFI, pCDF-CgpanD-Pphdc and pBbA1k-sfp-Zcebony were electrotransformed into MG1655 to obtain the recombinant strain STR14.

[0036] 2. Construction of carnosine decarboxylase-producing strains expressing mdtK gene with a plasmid Amplify using the Escherichia coli genome as a template mdtK the gene sequence and construct it on plasmid pBbA1k-sfp-Zcebony through Gibson assembly to obtain the recombinant plasmid pBbA1k-sfp-Zcebony-mdtK. Electrotransform the recombinant plasmids pBbA1k-sfp-Zcebony-mdtK, pTrc99a-hisGDCBHAFI, pCDF-CgpanD-Pphdc into MG1655 to obtain the carnosine decarboxylase-producing strain STR15 expressing the gene with plasmids mdtK .

[0037] 3. Verify the effect of the gene in carnosine decarboxylase-producing strains constructed with genes from different sources mdtK : Ferment the recombinant strains STR14 and STR15 according to the fermentation method in Example 1. The detection results after 48 h show that the carnosine decarboxylase yields in the fermentation broths of strains STR14 and STR15 are 0.24 g / L and 0.37 g / L respectively, indicating that expressing the gene with plasmids can increase the carnosine decarboxylase yield by 54.17%. This shows that in carnosine decarboxylase-producing strains constructed with genes from different sources, the effect of expressing the gene in enhancing the carnosine decarboxylase yield is consistent mdtK . mdtK Although the present invention has been described in detail with general descriptions and specific embodiments above, on the basis of the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention

[0038] ​

Claims

1. A recombinant microorganism, characterized in that, Compared with the starting strain, the recombinant microorganism enhances mdtK the expression of the gene; the starting strain is Escherichia coli capable of producing decarboxylated carnosine.

2. The recombinant microorganism according to claim 1, characterized in that The enhancement mdtK The expression of the gene is selected from any one of the following 1) to 6), or an optional combination: 1) By introducing a plasmid having the mdtK gene; 2) By increasing the copy number of said mdtK gene on the Escherichia coli chromosome; 3) By changing the promoter sequence of the mdtK gene on the Escherichia coli chromosome; 4) By operably linking a strong promoter to said mdtK gene; 5) By introducing mdtK the enhancer of the gene; 6) Enhanced by using genes or mdtK homologous genes encoding the corresponding enzymes or proteins with high activity.

3. The recombinant microorganism according to claim 2, wherein The gene encoding the corresponding enzyme or protein with high activity is codon-optimized mdtK gene.

4. The recombinant microorganism according to any one of claims 1-3, characterized in that, Compared with the wild-type Escherichia coli, the starting strain overexpresses hisGDCBHAFI gene fragment, and expresses exogenous panD gene, hdc gene, sfp gene and ebony gene.

5. The recombinant microorganism according to claim 4, wherein The said hisGDCBHAFI gene is derived from Escherichia coli ; The said panD gene is derived from Bacillus subtilis or Corynebacterium glutamicum ; The said hdc gene is derived from Photobacterium phosphoreum ; The said sfp gene is derived from Bacillus subtilis ; the said ebony gene is derived from Drosophila melanogaster or Zeugodacus cucurbitae .

6. Use of the recombinant microorganism according to any one of claims 1 - 5 in the fermentative production of decarboxylated carnosine.

7. Use of the recombinant microorganism according to any one of claims 1 - 5 in the microbial transformation for the production of decarboxylated carnosine or in increasing the yield of bioproduction of decarboxylated carnosine.

8. A method for fermentatively producing decarboxylated carnosine, characterized in that, Comprising the step of culturing the recombinant microorganism according to any one of claims 1 - 5.

9. A method for constructing a recombinant microorganism for producing decarboxylated carnosine, characterized in that, Including the step of enhancing the expression of the mdtK gene in the starting strain; the starting strain is Escherichia coli capable of producing decarboxylated carnosine.

10. The method according to claim 9, wherein Compared with the wild-type Escherichia coli, the starting strain overexpresses hisGDCBHAFI gene fragments, and expresses exogenous panD genes, hdc genes, sfp genes and ebony genes; and / or, enhancing mdtK The method of enhancing the expression of the gene is selected from any one of the following 1) to 6), or an optional combination: 1) By introducing a plasmid having the mdtK gene; 2) By increasing the copy number of the mdtK gene on the Escherichia coli chromosome; 3) By changing the promoter sequence of the mdtK gene on the Escherichia coli chromosome; 4) by operably linking a strong promoter to said mdtK gene; 5) By introducing mdtK the enhancer of the gene; 6) Enhanced by using a gene encoding a corresponding enzyme or protein with high activity or mdtK a homologous gene.

Citation Information

Patent Citations

  • Method for preparing decarboxylated carnosine through whole-cell catalysis

    CN114350692A

  • Application of transport protein TdcC in increasing yield of L-carnosine

    CN117486982A

  • Application of non-ribosome peptide synthetase in production of decarboxylated carnosine

    CN117925744A

  • Biological enzyme method synthesis process of decarboxylated carnosine

    CN118685472A

  • Method for increasing L-carnosine yield of escherichia coli by increasing PRPP supply

    CN119979435A

Cited By

  • PhPepD mutant and application thereof in fermentation production of L-carnosine

    CN121249628A

  • Method for preparing decarboxylated carnosine by using non-ribosome peptide synthetase DpEbony

    CN122235248A

  • Production method of decarboxylated carnosine

    CN122466037A