Cell nucleus sample marking method and mixed sample single cell ATAC sequencing method

By labeling the cell nuclear samples with antibody-oligonucleotide conjugate, the sample distinction problem in single-cell ATAC sequencing technology was solved, and a single batch library construction of multi-sample mixed samples was achieved, reducing sequencing costs and improving data quality.

CN120290449APending Publication Date: 2025-07-11THE THIRD PEOPLES HOSPITAL OF SHENZHEN
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510433644.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing single-cell ATAC sequencing technology is difficult to effectively distinguish different biological samples, resulting in high sequencing costs and inability to promote and use on a large scale.

Method used

The nucleus samples are labeled using antibody-oligonucleotide conjugates, and different nucleus samples are labeled by a variety of antibody-oligonucleotide conjugates of different oligonucleotides, so that differentiation or detection can be performed after mixing.

Benefits of technology

A variety of nucleus samples were realized for single-cell ATAC sequencing in a single reaction, which increased sample number and cell number, significantly reduced experimental costs, and improved sequencing data quality and processing success rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290449A_ABST
    Figure CN120290449A_ABST
Patent Text Reader

Abstract

The invention discloses a cell nucleus sample marking method and a mixed sample single cell ATAC sequencing method, and relates to the field of biomedical research. The cell nucleus sample labeling method comprises the following steps: respectively resuspending at least two cell nucleus samples in a buffer solution to obtain at least two samples to be labeled; different antibody-oligonucleotide conjugates are correspondingly added into the at least two to-be-labeled samples for incubation, at least two labeled cell nucleus samples are obtained respectively, and the antibody-oligonucleotide conjugates are obtained by labeling cell nucleus membrane protein with oligonucleotide; and mixing the at least two marked cell nucleus samples to complete sample marking. According to the single-cell ATAC sequencing kit and the single-cell ATAC sequencing method, the single-cell nucleuses are subjected to inter-specimen distinguishing, the defect that only one sample can be tested at a time can be overcome when operations such as single-cell ATAC sequencing are carried out, single-cell ATAC sequencing can be carried out on multiple cell nucleus samples at a time, and the experiment cost of single-cell ATAC sequencing is greatly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biomedical research, and particularly relates to a method for labeling nuclear samples and a method for multiplexed single-cell ATAC sequencing. Background Art

[0002] With the development of biomedicine, in order to solve the problem that gene high-throughput sequencing technology masks the heterogeneity between cells in the process of biomedical research, single-cell ATAC sequencing technology can reveal the characteristics and interconnections of different cells at the single-cell level. In order to study the biological characteristics of single cells, single-cell ATAC sequencing technology has become the focus of attention of clinical experts and scientific research staff in biomedicine. Single-cell ATAC sequencing technology has a wide range of applications in the research direction of molecular biology. Currently, the commonly used single-cell ATAC technology is mainly the 10xATAC method (CG000209) of 10xgenomics company. This method can perform single-cell ATAC library construction on each cell nucleus at the single-cell level. However, due to the high cost of reagents for a single sample and the large demand for a large number of samples in medical scientific research, there is currently a need to distinguish different biological samples, reduce the cost of a single sample, and achieve multiplexed single-batch library construction for multiple samples.

[0003] Currently, the traditional methods for distinguishing samples are to modify the genome by the cas-9 method and add specific genes for cell labeling by the lentiviral transfection method. However, these methods have not been widely promoted and used clinically due to different reasons such as the need for expensive instruments and equipment, cumbersome operation processes, low sensitivity, and affecting the ATAC results. Summary of the Invention

[0004] The main object of the present invention is to propose a method for labeling nuclear samples and a method for multiplexed single-cell ATAC sequencing, aiming to solve the problem of high sequencing cost caused by the difficulty of distinguishing different biological samples in the existing single-cell ATAC sequencing technology.

[0005] To achieve the above object, the present invention proposes a method for labeling nuclear samples, including the following steps:

[0006] Resuspend at least two nuclear samples in a buffer respectively to obtain at least two samples to be labeled;

[0007] Add different antibody-oligonucleotide conjugates to the at least two samples to be labeled for incubation respectively to obtain at least two labeled nuclear samples, wherein the antibody-oligonucleotide conjugate is obtained by labeling nuclear membrane proteins with oligonucleotides;

[0008] Mix the at least two labeled nuclear samples to complete sample labeling.

[0009] Optionally, the method for labeling the cell nucleus sample includes:

[0010] Resuspend 3 cell nucleus samples in buffer respectively to obtain 3 samples to be labeled;

[0011] Add three different oligonucleotide-antibody conjugates to the 3 samples to be labeled correspondingly and incubate them to obtain 3 labeled cell nucleus samples respectively;

[0012] Mix the 3 labeled cell nucleus samples to complete the sample labeling.

[0013] Optionally, in the step of "add three different oligonucleotide-antibody conjugates to the 3 samples to be labeled correspondingly and incubate them to obtain 3 labeled cell nucleus samples respectively",

[0014] The three oligonucleotide-antibody conjugates include a first oligonucleotide-antibody conjugate, a second oligonucleotide-antibody conjugate and a third oligonucleotide-antibody conjugate;

[0015] The first oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with a first oligonucleotide having a nucleotide sequence as shown in SEQ ID NO.1;

[0016] The second oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with a second oligonucleotide having a sequence as shown in SEQ ID NO.2;

[0017] The third oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with a third oligonucleotide having a sequence as shown in SEQ ID NO.3.

[0018] Optionally, the step of "add three different oligonucleotide-antibody conjugates to the 3 cell nucleus samples to be labeled correspondingly and incubate them to obtain 3 labeled cell nucleus samples respectively" includes:

[0019] Add 2 - 2.2 μl of the corresponding oligonucleotide-antibody conjugate to each cell nucleus sample to be labeled for labeling. After incubating at 4°C for 30 - 40 min, 3 cell nucleus samples with free tags are obtained;

[0020] Add 5 - 6 ml of cell nucleus buffer to each cell nucleus sample with free tag to resuspend the cell nucleus. After centrifuging and discarding the supernatant, repeat the resuspension and centrifugation process 3 times to obtain 3 labeled cell nucleus samples.

[0021] Optionally, the step of "mix the 3 labeled cell nucleus samples to complete the sample labeling" includes:

[0022] Nuclei labeled with the antibody-oligonucleotide conjugate were taken from 3 labeled nuclear samples respectively, mixed, and then resuspended in nuclear buffer to obtain the resuspended nuclear solution, completing the sample labeling.

[0023] Optionally, in the step of "mixing 3 labeled nuclear samples to complete sample labeling",

[0024] 90,000 - 100,000 nuclei labeled with the antibody-oligonucleotide conjugate were aspirated from each of the 3 labeled nuclear samples respectively, mixed, added with 4.5 - 5 ml of nuclear buffer for primary resuspension. After centrifugation to discard the supernatant, 100 μl of nuclear buffer was added for secondary resuspension to obtain the resuspended nuclear solution, completing the sample labeling.

[0025] Optionally, in the step of "taking nuclei labeled with the antibody-oligonucleotide conjugate from 3 labeled nuclear samples respectively, mixing, adding nuclear buffer for resuspension to obtain the resuspended nuclear solution, and completing the sample labeling",

[0026] The nuclear concentration in the resuspended nuclear solution is 2,400 - 2,600 nuclei / μl.

[0027] Optionally, before the step of "resuspending 3 nuclear samples in buffer respectively to obtain 3 samples to be labeled", it further includes:

[0028] Nuclei were extracted from single cells in blood or bone marrow or tumor tissue samples from 3 different sources respectively to obtain 3 nuclear samples.

[0029] Optionally, in the step of "resuspending 3 nuclear samples in buffer respectively to obtain 3 samples to be labeled",

[0030] In the 3 nuclear samples, the number of nuclei in each nuclear sample was controlled to be 500,000 - 600,000 respectively. 1 - 1.2 ml of buffer was added to each nuclear sample respectively. After centrifugation to discard the supernatant, 50 - 55 μl of nuclear buffer was used to resuspend the nuclei respectively to obtain 3 samples to be labeled.

[0031] The present invention also provides a multiplexed single-cell ATAC sequencing method, which includes:

[0032] S10. Labeling at least two nuclear samples using the above nuclear sample labeling method to obtain a mixture containing at least two labeled nuclear samples;

[0033] S20. Performing ATAC library construction and sequencing on the mixture using the 10X genomics method.

[0034] The antibody-oligonucleotide conjugate obtained by labeling nuclear membrane proteins with oligonucleotides in the present invention is used to label the nuclei of single cells. By using a variety of antibody-oligonucleotide conjugates with different oligonucleotides to label different nuclear samples, different nuclear samples can be distinguished or detected after being mixed. Further, the nuclear sample labeling method provided by the present invention can overcome the defect of only being able to test one sample at a time during operations such as single-cell ATAC sequencing, enabling single-cell ATAC sequencing of multiple nuclear samples at once, increasing the number of samples and cells of single-cell ATAC that can be obtained in a single reaction, and greatly reducing the experimental cost of single-cell ATAC sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on the structures shown in these drawings.

[0036] Figure 1 It is a microscope image of the labeled nuclear sample of the present invention after being stained with trypan blue;

[0037] Figure 2 It is a result diagram of single-cell ATAC library construction and sequencing analysis of the present invention.

[0038] The realization, functional features, and advantages of the objectives of the present invention will be further described in conjunction with the embodiments with reference to the drawings. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0039] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings. Those not specified in the embodiments are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase. In addition, the meaning of "and / or" appearing throughout the text includes three parallel solutions. Taking "A and / or B" as an example, it includes solution A, solution B, or the solution where A and B are satisfied simultaneously. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the fact that those of ordinary skill in the art can implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0040] With the development of biomedicine, in order to solve the problem that the high-throughput gene sequencing technology masks the heterogeneity between cells in the process of biomedical research, single-cell ATAC sequencing technology can reveal the characteristics and interconnections of different cells at the single-cell level. In order to study the biological characteristics of single cells, single-cell ATAC sequencing technology has become the focus of attention of clinical experts and scientific research staff in biomedicine. Single-cell ATAC sequencing technology has a wide range of applications in the research direction of molecular biology. The currently commonly used single-cell ATAC technology is mainly the 10xATAC method (CG000209) of 10xgenomics company. This method can construct a single-cell ATAC library for each cell nucleus at the single-cell level. However, due to the high cost of reagents for a single sample and the large demand for a large number of samples in medical scientific research, there is a current need to distinguish different biological samples, reduce the cost of a single sample, and achieve multi-sample mixed sample single-batch library construction.

[0041] Currently, the traditional method for distinguishing samples is to modify the genome by the cas-9 method and add specific genes for cell labeling by the lentiviral transfection method. However, these methods have not been widely promoted and used clinically due to different reasons such as the need for expensive instruments and equipment, cumbersome operation processes, low sensitivity, and affecting ATAC results.

[0042] In view of this, the present invention proposes a method for labeling cell nucleus samples, which can distinguish or detect different cell nucleus samples after mixing. The method for labeling cell nucleus samples includes the following steps:

[0043] Resuspend at least two cell nucleus samples in a buffer respectively to obtain at least two samples to be labeled;

[0044] Add different antibody-oligonucleotide conjugates to the at least two samples to be labeled for incubation respectively to obtain at least two labeled cell nucleus samples, wherein the antibody-oligonucleotide conjugate is obtained by labeling the cell nucleus membrane protein with an oligonucleotide;

[0045] Mix the at least two labeled cell nucleus samples to complete sample labeling.

[0046] The antibody-oligonucleotide conjugate obtained by labeling nuclear membrane proteins with oligonucleotides in the present invention is used to label the nuclei of single cells. By using multiple antibody-oligonucleotide conjugates with different oligonucleotides to label different nuclear samples, different nuclear samples can be distinguished or detected after being mixed. Further, the nuclear sample labeling method provided by the present invention can overcome the defect of only being able to test one sample at a time during operations such as single-cell ATAC sequencing, enabling single-cell ATAC sequencing of multiple nuclear samples at once, increasing the number of samples and cells of single-cell ATAC that can be obtained in a single reaction, and greatly reducing the experimental cost of single-cell ATAC sequencing.

[0047] During the labeling process, the number of nuclear samples that need to be tested in a mixed sample can be the same as the number of different antibody-oligonucleotide conjugates used. That is, two different oligonucleotides can be designed to obtain two antibody-oligonucleotide conjugates to label two nuclear samples, three different oligonucleotides can be designed to obtain three antibody-oligonucleotide conjugates to label three nuclear samples, four different oligonucleotides can be designed to obtain four antibody-oligonucleotide conjugates to label four nuclear samples, and so on. Preferably, three different nucleotides are used to label three nuclear samples. The purpose of the labeling is to increase the number of samples that can be analyzed by splitting through nucleotide labeling under the same sequencing data, saving the cost of a single sample. However, since the total number of cells captured in a single reaction of single-cell ATAC sequencing is between 10,000 cells, in order to have a sufficient number of cells for downstream analysis after splitting by nucleotide labeling, it is preferred to use 2 to 4 different nucleotides to label the nuclear samples, which can ensure that each nuclear sample has a relatively large number.

[0048] Therefore, further, the nuclear sample labeling method includes:

[0049] Step S100: Resuspend 3 nuclear samples in buffer respectively to obtain 3 samples to be labeled;

[0050] Among the 3 nuclear samples, the number of nuclei in each nuclear sample is controlled to be 500,000 to 600,000 respectively. 1 to 1.2 ml of buffer (PBS) is added to each nuclear sample. After centrifugation and discarding the supernatant, each nuclear sample is resuspended with 50 to 55 ul of nuclear buffer to obtain 3 samples to be labeled. Among them, the centrifugation conditions can be centrifugation at 500 rcf at 4°C for 5 minutes.

[0051] Before step S100, it also includes: Extracting the nuclei of single cells from blood or bone marrow or tumor tissue samples from 3 different sources respectively to obtain 3 nuclear samples. The process of extracting the nuclei of single cells in the present invention is not limited. Specifically, each nuclear sample can be extracted by the following method:

[0052] 1) Add 1 million cells into a 2-ml centrifuge tube, centrifuge at 300 rcf and 4 °C for 5 minutes, and remove the supernatant without damaging the cell pellets.

[0053] 2) Add 100 μl of the lysis buffer as shown in Table 1, and gently mix 10 times with a pipette.

[0054] 3) Incubate on ice for 3 - 5 minutes; (Optimize the incubation time according to the cell type. Suboptimal or extended lysis time can change the detection performance.)

[0055] 4) Add 1 ml of the wash buffer as shown in Table 2 to the lysed cells, and gently mix 5 times with a pipette.

[0056] 5) Centrifuge at 500 rcf and 4 °C for 5 minutes, and remove the supernatant without damaging the nuclear pellet.

[0057] 6) Resuspend with 0.5 ml of 1X Nuclei Buffer, and resuspend it in the cryo-diluted nuclear buffer to obtain a nuclear sample.

[0058] Among them, the composition and dosage of the lysis buffer are shown in Table 1; the composition and dosage of the wash buffer are shown in Table 2; the brands and catalog numbers of the related reagents are shown in Table 3.

[0059] Table 1 Composition and Dosage of Lysis Buffer

[0060] lysis buffer Stock Final 2ml Tris-HCI(pH 7.4) 1M 10mM 20μl NaCl 5M 10mM 4μl <![CDATA[MgCI2]]> 1M 3mM 6μl Nonidet P40Substitute 10% 0.1% 20ul BSA 10% 1% 200μl Tween-20 10% 0.1% 20μl Nuclease-fiee Water 1.75ml

[0061] Table 2 Composition and Dosage of Wash Buffer

[0062] wash bufifer Stock Final 2ml Tris-HCI(pH 7.4) 1M 10mM 20μl NaCl 5M 10mM 4μl <![CDATA[MgCI2]]> 1M 3mM 6μl BSA 10% 1% 200μl Tween-20 10% 0.1% 20μl Nuclease-fiee Water 1.75ml

[0063] Table 3 Brands and Catalog Numbers of Related Reagents

[0064] Specific Reagents Brand Catalog Number Nuclei Buffer*(20X) 10x Genomics 2000153 / 2000207 Digitonin Thermo BN2006 Nonidet P40Substitute Thermo 74385 Tween 20Surlact-Amps Detergent Thermo 28320

[0065] Step S200: Correspondingly add three different oligonucleotide-antibody conjugates to 3 samples to be labeled for incubation, and obtain 3 labeled nuclear samples respectively.

[0066] The three oligonucleotide-antibody conjugates include a first oligonucleotide-antibody conjugate, a second oligonucleotide-antibody conjugate, and a third oligonucleotide-antibody conjugate.

[0067] The first oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with the first oligonucleotide;

[0068] The second oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with the second oligonucleotide;

[0069] The third oligonucleotide-antibody conjugate is obtained by labeling a nuclear membrane protein with the third oligonucleotide;

[0070] The nucleotide sequence of the first oligonucleotide is as shown in SEQ ID NO.1, specifically:

[0071] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAACAGTTGAGAAATCGCCGCCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0072] The nucleotide sequence of the second oligonucleotide is as shown in SEQ ID NO.2, specifically:

[0073] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAAACTGTAGACCGTTGGCACCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0074] The nucleotide sequence of the third oligonucleotide is as shown in SEQ ID NO.3, specifically:

[0075] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAACATTAACGTCTCCTCACCCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0076] It should be noted that the present invention is not limited to these three oligonucleotides. The oligonucleotides can also be designed by the method and technology of single-cell ATAC capture of fixed sequences by 10x genomics, that is, the designed oligonucleotide sequences can be ligated to the sequences of the beads of single-cell ATAC of 10x genomics, and 17 bases in the middle part of the oligonucleotide sequences are used to differentially label the samples, so as to obtain oligonucleotides with other nucleotide sequences. After being conjugated with antibodies, they are used to label the cell nuclei. For example, the 17 bases in the middle part of the nucleotide sequence of the first oligonucleotide for differentiation are CAGTTGAGAAATCGCCG, the 17 bases in the middle part of the nucleotide sequence of the second oligonucleotide for differentiation are ACTGTAGACCGTTGGCA, and the 17 bases in the middle part of the nucleotide sequence of the third oligonucleotide for differentiation are CATTAACGTCTCCTCAC.

[0077] Among them, the oligonucleotide-antibody conjugate is synthesized according to the instructions of the oligonucleotide conjugation kit (ab218260).

[0078] In step S200, 2 - 2.2 μl of the corresponding oligonucleotide-antibody conjugate is added to each nucleus sample to be labeled for labeling. After incubation at 4 - 5 °C for 30 - 40 min, 3 nucleus samples with free tags are obtained; 5 - 6 ml of nucleus buffer is added to each nucleus sample with free tags to resuspend the cell nuclei. After centrifugation to discard the supernatant, 5 - 6 ml of nucleus buffer is added again to resuspend the cell nuclei. After centrifugation to discard the supernatant, 5 - 6 ml of nucleus buffer is added again to resuspend the cell nuclei. After centrifugation to discard the supernatant, the labeled nucleus samples are obtained. Three resuspensions can remove the free tags in the nucleus samples. The 3 nucleus samples to be labeled are labeled separately, and 3 labeled nucleus samples are obtained after removing the free tags.

[0079] Among them, the composition and dosage of the nucleus buffer Nuclei Buffer are shown in Table 4:

[0080] Table 4 Composition and dosage of 1x Nuclei Buffer

[0081] Diluted Nuclei Bufier Stock Final 1ml Nuclei Buffer*(20X) 20X 1X 50μl Nuclease-free Water 950μl

[0082] Step S300: Mix the 3 labeled nucleus samples to complete the sample labeling.

[0083] Trypan blue is used to detect the integrity of the cell nuclei and the total cell nucleus concentration, as Figure 1As shown, 90,000 - 100,000 nuclei labeled with antibody - oligonucleotide conjugates were respectively aspirated from each of the 3 labeled nuclear samples, mixed, and then resuspended in nuclear buffer to obtain resuspended nuclear fluid, completing the sample labeling. Resuspending the nuclei with nuclear buffer can better mix the labeled nuclei in the three labeled nuclear samples for subsequent detection and experiments.

[0084] Specifically, 90,000 - 100,000 nuclei labeled with antibody - oligonucleotide conjugates were respectively aspirated from each of the 3 labeled nuclear samples and mixed, then 4.5 - 5 ml of nuclear buffer was added for the first resuspension. After centrifuging and discarding the supernatant, 100 μl of nuclear buffer was added for the second resuspension to obtain resuspended nuclear fluid, completing the sample labeling. The two - step resuspension can fully remove the unlabeled oligonucleotide - antibody conjugates floating in the suspension. By controlling the nuclear concentration in the resuspended nuclear fluid to be 2400 - 2600 nuclei / μl through the two - step resuspension, the nuclear fluid can be in a better state to adapt to subsequent single - cell labeling, and at the same time, the target can capture a sufficient number of nuclei for subsequent analysis.

[0085] The present invention also proposes a method for multiplexed single - cell ATAC sequencing, which includes:

[0086] S10. Label at least two nuclear samples using the above - mentioned nuclear sample labeling method to obtain a mixture containing at least two labeled nuclear samples;

[0087] S20. Perform ATAC library construction and sequencing on the mixture using the 10X genomics method.

[0088] Among them, the 10X genomics method is the 10x ATAC (10x single - cell ATAC) high - throughput sequencing method of 10x genomics company. 10x single - cell ATAC can detect the chromatin accessibility (open regions) at the single - cell level, locate the positions of regulatory elements (such as promoters, enhancers) in the genome, and reveal potential gene regulatory mechanisms.

[0089] The single-cell ATAC sequencing method capable of sample mixing provided by the present invention can distinguish between specimens of single-nucleus samples, greatly reducing the experimental cost of single-cell ATAC sequencing. By labeling the cell nuclei, it is also possible to distinguish between doublets generated during the oil-in-water process of single-cell microfluidics, reducing the doublet rate. This is because if doublets are encapsulated in the same droplet during the oil-in-water process, the information labeled by the oligonucleotide-antibody conjugate can be identified by an algorithm after sequencing. For example, in single-cell sequencing, if two barcodes from different sources are detected in a single droplet, the data can be labeled as "doublet" and filtered, thereby reducing the doublet rate in the final statistics. Therefore, the reliability of the experimental results is improved, the number of single-nucleus ATAC cells captured is increased, and the cost of single-cell ATAC is greatly reduced. In addition, the present invention also significantly shortens the experimental process of conventional nuclear labeling, significantly improves the quality of sequencing data, significantly improves the success rate of nuclear processing, and has high popularization potential.

[0090] The technical solutions of the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0091] Preparation of nuclear samples

[0092] 1) Add 1 million PBMC cells to a 2 ml centrifuge tube, centrifuge at 300 rcf at 4 °C for 5 minutes, and remove the supernatant without damaging the cell pellets;

[0093] 2) Add 100 μl of lysis buffer as shown in Table 1, and gently mix 10 times with a pipette;

[0094] 3) Incubate on ice for 5 minutes;

[0095] 4) Add 1 ml of wash buffer as shown in Table 2 to the lysed cells, and gently mix 5 times with a pipette;

[0096] 5) Centrifuge at 500 rcf at 4 °C for 5 minutes, remove the supernatant without damaging the nuclear pellet;

[0097] 6) Resuspend with 0.5 ml of 1X Nuclei Buffer to obtain a nuclear sample by resuspending it in a cryo-diluted nuclear buffer.

[0098] The PBMC cells of 3 different samples were processed by the above method to obtain 3 nuclear samples.

[0099] Preparation of markers

[0100] The nucleotide sequences of the following first oligonucleotide, second oligonucleotide, and third oligonucleotide are obtained through the method and technical design of single-cell ATAC capture of fixed sequences by 10x genomics.

[0101] The nucleotide sequence of the first oligonucleotide is:

[0102] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAACAGTTGAGAAATCGCCGCCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0103] The nucleotide sequence of the second oligonucleotide is:

[0104] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAAACTGTAGACCGTTGGCACCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0105] The nucleotide sequence of the third oligonucleotide is:

[0106] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGATCACGGTC GCAACATTAACGTCTCCTCACCCTGTCTCTTATACACATCTGACGCTGCC GACGA.

[0107] According to the instruction manual of the oligonucleotide conjugation kit (ab218260),

[0108] The first oligonucleotide is used to label the nuclear membrane protein to obtain a first oligonucleotide-antibody conjugate;

[0109] The second oligonucleotide is used to label the nuclear membrane protein to obtain a second oligonucleotide-antibody conjugate;

[0110] The third oligonucleotide is used to label the nuclear membrane protein to obtain a third oligonucleotide-antibody conjugate.

[0111] Sample Labeling

[0112] A method for labeling a cell nucleus sample, comprising the following steps:

[0113] Control the number of cell nuclei in 3 cell nucleus samples to 500,000 respectively. Add 1 ml of cold PBS to each of the 3 cell nucleus samples, centrifuge at 500 rcf at 4 °C for 5 minutes, then discard the supernatant. Resuspend the cell nuclei with 50 μl of cell nucleus buffer respectively to obtain 3 samples to be labeled;

[0114] Add the first oligonucleotide-antibody conjugate, the second oligonucleotide-antibody conjugate, and the third oligonucleotide-antibody conjugate to the 3 samples to be labeled correspondingly. Add 2 μl of the corresponding oligonucleotide-antibody conjugate to each sample to be labeled for labeling. Incubate at 4 °C for 30 min to obtain 3 cell nucleus samples with free labels;

[0115] Resuspend the cell nuclei in each cell nucleus sample with free labels with 5 ml of cell nucleus buffer, centrifuge at 500 rcf at 4 °C for 5 minutes, then discard the supernatant. Add 5 ml of cell nucleus buffer again to resuspend the cell nuclei, centrifuge at 500 rcf at 4 °C for 5 minutes, then discard the supernatant. Add 5 ml of cell nucleus buffer for the third time to resuspend the cell nuclei, centrifuge at 500 rcf at 4 °C for 5 minutes, then discard the supernatant to obtain 3 labeled cell nucleus samples;

[0116] Respectively aspirate 100,000 cell nuclei conjugated with the labeled antibody-oligonucleotide from each of the 3 labeled cell nucleus samples and mix them. Add 5 ml of cell nucleus buffer for the first resuspension, centrifuge at 500 rcf at 4 °C for 5 minutes, then discard the supernatant. Add 100 μl of cell nucleus buffer for the second resuspension to obtain the resuspended cell nucleus solution, and complete the sample labeling.

[0117] Figure 1 The picture shows the resuspended cell nucleus solution of the above sample labeling after being stained with trypan blue under a 40-fold microscope. The cell nuclei stained blue are complete in karyotype visually.

[0118] Single-cell ATAC sequencing

[0119] Based on the above sample labeling, use the 10X genomics method to perform ATAC library construction and sequencing on the resuspended cell nucleus solution of the mixed 3 labeled cell nuclei.

[0120] As Figure 2 shown, Figure 2 It is a result diagram of single-cell ATAC library construction and sequencing analysis. It can be seen from the figure that the samples can be split into 3 samples, namely S1-S2-S3, by the oligonucleotide-antibody conjugate designed in the early stage. At the same time, some doublet samples (i.e., doublet in the figure) can be identified, and the doublet cells can be removed in the subsequent analysis process.

[0121] Therefore, the method for labeling nuclear samples provided by the present invention can perform single-cell ATAC sequencing on multiple nuclear samples at one time, increasing the number of single-cell ATAC samples and the number of cells that can be obtained in a single reaction, and greatly reducing the experimental cost of single-cell ATAC sequencing.

[0122] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the patent protection scope of the present invention.

Claims

1. A method for labeling a cell nucleus sample, characterized in that, It includes the following steps: Resuspend at least two nuclear samples in a buffer respectively to obtain at least two samples to be labeled; Correspondingly add different antibody-oligonucleotide conjugates to the at least two samples to be labeled and incubate them to obtain at least two labeled nuclear samples respectively, wherein the antibody-oligonucleotide conjugate is obtained by labeling nuclear membrane proteins with oligonucleotides; Mix the at least two labeled nuclear samples to complete sample labeling.

2. The method for labeling a cell nucleus sample according to claim 1, wherein The method for labeling nuclear samples includes: Resuspend 3 nuclear samples in a buffer respectively to obtain 3 samples to be labeled; Correspondingly add three different oligonucleotide-antibody conjugates to the 3 samples to be labeled and incubate them to obtain 3 labeled nuclear samples respectively; Mix the 3 labeled nuclear samples to complete sample labeling.

3. The method for labeling a cell nucleus sample according to claim 2, wherein In the step of "correspondingly add three different oligonucleotide-antibody conjugates to the 3 samples to be labeled and incubate them to obtain 3 labeled nuclear samples respectively", The three oligonucleotide-antibody conjugates include a first oligonucleotide-antibody conjugate, a second oligonucleotide-antibody conjugate, and a third oligonucleotide-antibody conjugate; The first oligonucleotide-antibody conjugate is obtained by labeling nuclear membrane proteins with a first oligonucleotide having a nucleotide sequence as shown in SEQ ID NO.1; The second oligonucleotide-antibody conjugate is obtained by labeling nuclear membrane proteins with a second oligonucleotide having a sequence as shown in SEQ ID NO.2; The third oligonucleotide-antibody conjugate is obtained by labeling nuclear membrane proteins with a third oligonucleotide having a sequence as shown in SEQ ID NO.

3.

4. The method for labeling a cell nucleus sample according to claim 2, wherein, The step of "correspondingly add three different oligonucleotide-antibody conjugates to the 3 samples to be labeled and incubate them to obtain 3 labeled nuclear samples respectively" includes: Add 2-2.2 μl of the corresponding oligonucleotide-antibody conjugate to each sample to be labeled for labeling. After incubating at 4°C for 30-40 min, 3 nuclear samples with free tags are obtained; Add 5-6 ml of nuclear buffer to each nuclear sample with a free tag to resuspend the nuclei. After centrifuging and discarding the supernatant, repeat the resuspension and centrifugation processes 3 times to obtain 3 labeled nuclear samples.

5. The method for labeling a cell nucleus sample according to claim 2, wherein, The step of "mix the 3 labeled nuclear samples to complete sample labeling" includes: Respectively take the nuclei with the labeled antibody-oligonucleotide conjugate from the 3 labeled nuclear samples, mix them, and add nuclear buffer to resuspend them to obtain a resuspended nuclear solution, thus completing sample labeling.

6. The method for labeling a cell nucleus sample according to claim 5, wherein In the step of "mix the 3 labeled nuclear samples to complete sample labeling", Respectively aspirate 90,000-100,000 nuclei with the labeled antibody-oligonucleotide conjugate from the 3 labeled nuclear samples, mix them, add 4.5-5 ml of nuclear buffer for a first resuspension. After centrifuging and discarding the supernatant, add 100 μl of nuclear buffer for a second resuspension to obtain a resuspended nuclear solution, thus completing sample labeling.

7. The method for labeling a cell nucleus sample according to claim 5, wherein, In the step of "taking the nuclei of the labeled antibody-oligonucleotide conjugate from 3 labeled nuclear samples respectively, mixing them, and then adding nuclear buffer to resuspend to obtain the resuspended nuclear solution, thus completing the sample labeling", The nuclear concentration in the resuspended nuclear solution is 2,400 - 2,600 nuclei / μL.

8. The method for labeling a cell nucleus sample according to claim 2, characterized in that, Before the step of "resuspending 3 nuclear samples in buffer respectively to obtain 3 samples to be labeled", it further includes: Extracting the nuclei of single cells from blood or bone marrow or tumor tissue samples from 3 different sources respectively to obtain 3 nuclear samples.

9. The method for labeling a cell nucleus sample according to claim 2, wherein, In the step of "resuspending 3 nuclear samples in buffer respectively to obtain 3 samples to be labeled", Among the 3 nuclear samples, control the number of nuclei in each nuclear sample to be 500,000 - 600,000 respectively. Add 1 - 1.2 mL of buffer to each nuclear sample respectively. After centrifuging and discarding the supernatant, resuspend the nuclei with 50 - 55 μL of nuclear buffer respectively to obtain 3 samples to be labeled.

10. A method for mixed-sample single-cell ATAC sequencing, characterized in that, The mixed single-cell ATAC sequencing method includes: S10. Using the nuclear sample labeling method according to any one of claims 1 - 9 to label at least two nuclear samples to obtain a mixture containing at least two labeled nuclear samples; S20. Using the 10X genomics method to perform ATAC library construction and sequencing on the mixture.

Citation Information

Patent Citations

  • Kit, sample marking method and single cell sequencing method

    CN112280829A

  • Compositions and methods for genome engineering with cas12a proteins

    CN113227367A

  • Single cell sequencing library construction method, obtained sequencing library and application

    CN118207638A

  • CRISPR / Cas-based intracellular mycobacterium tuberculosis in-situ nucleic acid detection method and application

    CN119799929A

  • Sample tag sequence, kit, sample labeling method, single-cell sequencing method

    WO2021204124A1