Construction method and application of ovarian cancer cell line for overexpression and knockout of Znhit1 gene

Abstract

The invention discloses a construction method and application of an ovarian cancer cell line for overexpression and knockout of a Znhit1 gene, and particularly relates to the technical field of molecular biology and cancer research, the construction method of the ovarian cancer cell line for overexpression of the Znhit1 gene comprises the steps of construction of an overexpression vector, cell transfection and screening, and verification of a stably transfected cell strain; the construction method of the Znhit1 gene knockout ovarian cancer cell line is based on a CRISPR / Cas9 technology and comprises the steps of sgRNA design and synthesis, cell transfection and screening and knockout effect verification, the constructed cell line can be used for screening anti-ovarian cancer drugs, and the curative effect is evaluated by detecting the influence of the drugs on cell proliferation, clone formation or apoptosis. In addition, the invention also provides a kit for constructing the cell line. The cell line constructed by the invention is helpful to clarify the function of the Znhit1 gene in ovarian cancer, and provides an important tool and basis for research, development and treatment of ovarian cancer drugs.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and cancer research. More specifically, the present invention relates to a method for constructing an ovarian cancer cell line overexpressing and knocking out the Znhit1 gene and its application. Background Art

[0002] Ovarian cancer (OC), as one of the common malignant tumors of the female reproductive system, seriously threatens the lives and health of women. Its early symptoms are hidden, and most patients are diagnosed at an advanced stage. In addition, there is a high degree of heterogeneity among different subtypes of ovarian cancer, making clinical treatment face huge challenges. At present, the treatment methods for ovarian cancer mainly include surgery, chemotherapy, targeted therapy, etc., but the overall treatment effect is still not satisfactory, the 5-year survival rate of patients is low, and the quality of life is seriously affected.

[0003] With the continuous in-depth research of life science, the exploration of ovarian cancer has gradually deepened from the cellular level to the molecular level. The role of epigenetic mechanisms in tumorigenesis and development has attracted increasing attention. Among them, chromatin remodeling, as an important epigenetic regulation method, participates in the regulation of many biological processes. The chromatin remodeling factor Znhit1 is one of the core subunits of the SRCAP chromatin remodeling complex and plays a key role in cell proliferation, apoptosis, cell cycle regulation, and differentiation. Existing studies have shown that the abnormal expression of Znhit1 is closely related to the occurrence of uterine fibroids in women. The ChIp-Seq data of uterine fibroid patients show the deposition defect of histone variant H2A.Z, which implies that Znhit1 plays an important role in the disease process and is expected to become a potential therapeutic target.

[0004] However, up to now, the specific function of Znhit1 in ovarian cancer is still unclear. By detecting the expression of Znhit1 in ovarian cancer tissues and normal tissues through the GeneExpression Profiling Interactive Analysis (GEPIA) database, it is found that compared with normal tissues, Znhit1 is highly expressed in ovarian cancer tissues. However, the specific impact of this expression difference on the occurrence and development of ovarian cancer, and whether Znhit1 can be used as an effective target for the precise treatment of ovarian cancer, still lack in-depth research.

[0005] The current dilemma in ovarian cancer research lies in the lack of effective cell models to deeply explore the functional mechanism of the Znhit1 gene in ovarian cancer, making it difficult to clarify its specific role in the tumorigenesis and development signaling pathways. At the same time, due to the lack of accurate research models, during the development of anti-ovarian cancer drugs, it is impossible to efficiently screen out targeted drugs, resulting in a long drug development cycle, high costs, and poor clinical treatment effects.

[0006] Therefore, a method for constructing an ovarian cancer cell line with overexpression and knockout of the Znhit1 gene and its application are proposed. Summary of the Invention

[0007] To overcome the above-mentioned defects of the prior art, the present invention provides a method for constructing an ovarian cancer cell line with overexpression and knockout of the Znhit1 gene and its application to solve the problems raised in the above background technology.

[0008] To achieve the above object, the present invention provides the following technical solution: A method for constructing an ovarian cancer cell line with overexpression of the Znhit1 gene, comprising the following steps: (1) Construct an overexpression vector of the Znhit1 gene: Use BamH1 and EcorV to double-digest the pcDNA-flag-Smug1-polyA basic vector, insert the Znhit1 target fragment to form a pcDNA-flag-Znhit1-polyA recombinant plasmid, and verify it by sequencing; (2) Cell transfection and screening: Transfect the recombinant plasmid obtained in step (1) into ovarian cancer cells, and use G418 gradient screening to obtain a stable transfected cell line; (3) Verification of the stable transfected cell line: Detect the expression level of Znhit1 protein by Western blot to confirm the overexpression effect.

[0009] Preferably, the concentration range of the G418 gradient screening is 200 mg / mL to 1000 mg / mL, and the screening time is 48 hours for each concentration.

[0010] A method for constructing an ovarian cancer cell line with knockout of the Znhit1 gene, comprising the following steps: (1) Design and synthesize an sgRNA targeting the Znhit1 gene: Based on the CRISPR / Cas9 technology, design a specific sgRNA in the exon 2 region of the Znhit1 gene and ligate it to the lentiCRISPR V2 vector; (2) Cell transfection and screening: Transfect the recombinant vector obtained in step (1) into ovarian cancer cells, use puromycin to screen positive cells, and obtain monoclonal cell lines by the limited dilution method; (3)Knockout effect verification: Detect the deletion of Znhit1 protein expression by Western blot, and confirm the mutation of the gene editing site by Sanger sequencing.

[0011] Preferably, the sequence of the sgRNA is selected from any one of the following groups: sg-1-F: CACCGCGTCGCATCAACCGGCAGC; sg-1-R: AAACGCTGCCGGTTGATGCGACGC; sg-2-F: CACCGCGAGCTGAGGGAGTCCCGCG; sg-2-R: AAACCGCGGGACTCCCTCAGCTCGC; sg-3-F: CACCGTCCGCATCGTCATCAAACTG; sg-3-R: AAACCAGTTTGATGACGATGCGGAC.

[0012] Application of an ovarian cancer cell line with overexpression or knockout of Znhit1 gene in screening anti-ovarian cancer drugs, and evaluate the drug efficacy by detecting the effects of the drug on the proliferation, colony formation or apoptosis of the cell line.

[0013] A kit for constructing an ovarian cancer cell line with overexpression or knockout of Znhit1 gene, comprising the following components: (1)pcDNA-flag-Znhit1-polyA recombinant plasmid, or lentiCRISPRv2-sgRNA recombinant plasmid; (2)Transfection reagent Translntro TM EL; (3)Screening antibiotics G418 or puromycin; (4)Western blot detection reagent.

[0014] Technical effects and advantages of the present invention: 1. By successfully constructing ovarian cancer cell lines with overexpression and knockout of Znhit1 gene, it is found through experiments that overexpression of Znhit1 significantly promotes the proliferation ability of A2780 and SKOV-3 ovarian cancer cells. After knocking out the Znhit1 gene, cell proliferation is slow and the colony formation ability is significantly decreased, providing an important cell model and experimental basis for in-depth study of the mechanism of action of Znhit1 gene in the occurrence and development of ovarian cancer.

[0015] 2. The established cell line can be used for screening anti-ovarian cancer drugs. The efficacy of the drugs can be evaluated by detecting the effects of the drugs on the proliferation, colony formation or apoptosis of the cell line, providing an effective screening tool for the research and development of precision targeted therapy drugs for ovarian cancer, helping to improve the clinical treatment effect and the quality of life of patients. Description of the Drawings

[0016] Figure 1 : A: The basic vector pcDNA-flag-Smug1-polyA owned by the laboratory; B: Restriction enzyme digestion map of the vector. Lane m is the marker, lane a is the digestion result. The upper band is the linearized vector, and the lower band is the excised Smug1 fragment; C: Successfully constructed overexpression vector of Znhit1; D, E: Western blot was used to detect the difference in protein expression levels of Znhit1 overexpressed in A2780 and SKOV-3 cells, with β-Actin as the protein internal reference; F, G: CCK-8 method was used to detect the proliferation of ovarian cancer A2780 and SKOV-3 cells. Two-way ANOVA was used for statistical analysis, and the data were expressed as mean ± SD; H: Crystal violet staining method was used to detect the colony formation ability of ovarian cancer A2780 and SKOV-3 cells; I: Statistical results of the relative colony formation number percentage of A2780 and SKOV-3 cells overexpressing Znhit1. Two-tailed unpaired Student’s test was used for statistical analysis, and the data were expressed as mean ± SD, n = 3 (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001); Figure 2 : A: Three sgRNAs were designed on exon2 and named sg-1, sg-2, and sg-3 respectively; B: Schematic diagram of the knockout vector. The vector carries U6 promoter, Cas9, and puromycin puro resistance; C: Sequencing result diagrams of sg-1, sg-2, and sg-3; D: Diagram showing the detection of Znhit1 expression after transfection of sg-1, sg-2, and sg-3 into cells for 48 hours and then screening with puromycin for another 48 hours; E: Immunoblotting diagram showing the detection of Znhit1 expression in monoclonal cell lines 1–6 by Western blot experiment; F: Immunoblotting diagram showing the Znhit1 expression level when monoclonal cell line 2 was passaged to P19; G: Sanger sequencing results of the mutation site in Znhit1-KO cells. The dotted line represents the missing nucleotide, the red line represents the sequence of sg-3, and the yellow line represents the missing base; H: CCK8 assay was used to compare the proliferation of WT and Znhit1-KO cells from the first day to the fifth day. The horizontal axis represents the generation time (days), and the vertical axis represents the absorbance value at 450nm. Two-way ANOVA was used for statistical analysis, and the data are expressed as mean±SD. I: Clone formation diagram of WT and Znhit1-KO cells using crystal violet staining to detect clone formation ability; J: Statistical graph of clone formation rate, statistical analysis was performed using two-tailed unpaired Student's test. Data are expressed as mean±SD, n=3 (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). DETAILED DESCRIPTION

[0017] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without making any creative work shall fall within the scope of protection of the present invention.

[0018] The present invention provides a method for constructing an ovarian cancer cell line overexpressing the Znhit1 gene. The specific process is: Construction of overexpression vector The laboratory's own pcDNA-flag-Smug1-polyA plasmid was used as the basic vector, and the plasmid map (such as Figure 1 A). First, use the BamH1 and EcoRV restriction sites of the vector to perform double enzyme digestion. The double enzyme digestion system is shown in Table 1.1. Incubate at 37°C for 1 hour to linearize the vector and cut off the Smug1 fragment (such as Figure 1 B).

[0019] Table 1.1: Double enzyme digestion system Table1.1:Double digestion system Then the Znhit1 target fragment was inserted into the linearized vector to form the pcDNA-flag-Znhit1-polyA plasmid. The sequence primers for amplifying the target Znhit1 are shown in Table 1.2.

[0020] Table 1.2: Znhit1 primer sequences Table1.2:Znhit1 Primer sequence The connection system is shown in Table 1.3: Table 1.3: Connection system Table1.3:Connection system Ligate overnight at 16°C or for 10 min at room temperature. After ligation, perform transformation, extract plasmid DNA. Subsequently, verify the constructed plasmid by Sanger sequencing. The sequencing results show that the overexpression vector of Znhit1 has been successfully constructed (as shown in Figure 1 C).

[0021] 2. Cell transfection and screening Cell seeding: Seed 1×10 5 cells in a 6-well plate, ensuring that the cells reach 70%-90% confluence at the time of transfection.

[0022] Cell culture: After cell seeding, culture the cells at 37°C and 5% CO2 for 24 h.

[0023] Plasmid DNA dilution: Prepare 4 μg of plasmid DNA and add it to 200 μL of Opti-MEM medium, gently mix well.

[0024] Plasmid DNA-Translntro TM EL complex preparation: Take 4 μL of Translntro TM EL reagent and add it to the diluted plasmid DNA solution prepared above, gently mix well, and let it stand at room temperature for 15 - 20 min.

[0025] Transfection operation: Uniformly add the formed plasmid DNA-Translntro TM EL complex to each well of the cells. Place the cells in an incubator at 37°C and 5% CO2 for culture.

[0026] Medium replacement: After 6 h of transfection, remove the old medium and replace it with fresh complete medium, and continue to culture under the same conditions for 48 h.

[0027] Use G418 for screening. The screening process includes gradually screening from different concentrations of G418 (1000 mg / mL, 800 mg / mL, 600 mg / mL, 400 mg / mL, and 200 mg / mL). After screening for two days at each concentration, change to the next lower concentration. After a series of concentration screenings, select 200 mg / mL of G418 as the concentration for subsequent culture and maintain cell growth under this condition for a period of time.

[0028] After screening, replace it with fresh medium and continue to culture for 24 - 48 h to recover the cell state; 3. Establishment and verification of stable cell lines: Continue to expand the culture using the medium containing G418 to obtain a stable transfected ovarian cancer cell line with overexpression of the Znhit1 gene. Extract total protein for Western blot detection to analyze the expression changes of Znhit1 protein at the protein level (as shown in Figure 1 D, E).

[0029] 4. To detect the proliferation ability of Znhit1 overexpression and its control cells in A2780 and SKOV-3 cells, we performed CCK-8 assays and colony formation assays and statistically analyzed the results. We measured the absorbance values of each group of cells at 450 nm every 24 h through CCK-8 assays to reflect the relative number of cells in the wells and plotted the absorbance value change curves at different culture times. The experimental results showed ( Figure 1 F, G) that at the beginning of the experiment, the absorbance values of each group of cells were basically the same, indicating similar initial seeding densities. As the culture time extended, the absorbance values of each group of cells gradually increased, showing that the cell number increased with time. The proliferation curve of Znhit1 overexpressing cells was significantly higher than that of control cells, indicating that Znhit1 overexpression significantly promoted the proliferation ability of A2780 and SKOV-3 ovarian cancer cells. At the same time, we also confirmed this trend through colony formation assays, and the experimental results showed ( Figure 1 H, I) that the number of colonies formed by cells overexpressing Znhit1 was significantly more than that of control cells, indicating that Znhit1 overexpression promoted the proliferation vitality of A2780 and SKOV-3 cells.

[0030] The method for constructing an ovarian cancer cell line by knocking out the Znhit1 gene based on the CRISPR / Cas9 gene editing technology provided by the present invention is specifically as follows: First, query the mRNA sequence of Znhit1 (Gene ID: 10467) in the NCBI database. Based on factors such as Tm value (56 - 62 °C), GC content (45% - 60%), and secondary structure, 3 groups of 20-bp sgRNAs with higher scores, higher binding specificity, and lower off-target efficiency were screened from the exon 2 region of the Znhit1 whole genome (as shown in Figure 2 A). These sgRNA sequences were added with CACC / AAAC sticky ends at their 5' ends to adapt to subsequent cloning steps. They were respectively named sg-1, sg-2, and sg-3 and sent to Shanghai Sangon Biotech Co., Ltd. for synthesis as shown in Table 1.4.

[0031] Table 1.4: sgRNA oligonucleotide sequences Table1.4: sgRNA Oligonucleotide Squences First, the lentiCRISPRv2 circular plasmid was digested with a single enzyme to linearize it. The restriction enzyme site selected was BsmBI. The digestion system was mixed according to Table 1.5, and incubated at 37 °C for 30 min for digestion. After the vector was linearized, agarose gel electrophoresis was performed to verify the digestion effect.

[0032] Table 1.5: Single digestion system Table1.5:Single digestion system Mix the system according to Table 1.6, and then anneal the complementary sgRNA according to the annealing program in Table 1.7.

[0033] Table 1.6: Annealing reaction system Table1.6:Annealing reaction system A total of 10 μL.

[0034] Table 1.7: Annealing reaction procedure Table1.7:Annealing reaction procedure The artificially synthesized sgRNA was ligated to the LentiCRISPRV2 vector to form the required recombinant plasmid (such as Figure 2 B). The ligation system is shown in Table 1.8 below.

[0035] Table 1.8: Ligation system Table1.8:sgRNA carrier connection system Finally, 1 μL of QuickLigase (NEB M2200S) was added, and the total system was 11 μL. Ligation was performed at room temperature for 10 - 20 min. The recombinant plasmid was transformed into competent cells (DH5α) for expression. A plasmid DNA extraction kit without endotoxin was used to extract plasmid DNA and perform Sanger sequencing. The sequencing results showed that the knockout vector had been successfully constructed (such as Figure 2 C).

[0036] 2. Cell transfection and screening Cell seeding: Seed 1×10 5 cells in a 6-well plate to achieve 70% - 90% confluence at the time of transfection. The cells were cultured for 24 h.

[0037] Dilution of plasmid DNA: Add 4 μg of plasmid DNA to 200 μL of Opti-MEM medium and gently mix well.

[0038] Plasmid DNA - Translntro TM Preparation of the EL complex: Take 4 μL of Translntro TM EL and add it to the diluted plasmid DNA, gently mix well. Let it stand at room temperature for 15 - 20 min.

[0039] Add the plasmid DNA - Translntro TM EL complex to the cells and culture them in an incubator at 37 °C with 5% CO₂.

[0040] Replace the medium 6 h after transfection and continue to culture in an incubator at 37 °C with 5% CO₂ for 48 h.

[0041] Digest and count the ovarian cancer cells afterwards, inoculate monoclonal cells. The LentiCRISPRV2 plasmid has puromycin resistance, and a medium containing puromycin can be added to screen the cells. Set up untransfected cells and cells 48 h after transfection, and add 4 μg / ml puromycin to screen for 48 h respectively. Wait until all the untransfected cells die, and the surviving cells are the successfully transfected positive cells.

[0042] 3. Establishment and verification of stable cell lines: To detect the knockout efficiency of the sgRNA, we inoculated ovarian cancer cells into 6-well plates. When the cell confluence reached 70% - 90%, the sg-1, sg-2, and sg-3 plasmids were transfected into the cells by liposome transfection method. After 48 h, the cells were treated with 4 μg / ml puromycin for 48 h to screen the successfully transfected cells. And the knockout efficiency was verified at the protein level by Western blot assay. The results showed that the sg-1, sg-2, and sg-3 plasmids all had knockout effects, and the knockout effect of sg-3 was the most obvious (as shown in Figure 2 D). Therefore, the sg-3 plasmid was selected to knockout Znhit1 in ovarian cancer cells.

[0043] To screen monoclonal cell lines, we used the limited dilution method in 96-well plates. The sg-3 knockout cells were inoculated into the wells at a single cell per well, and the cell number was recorded after 4 h. When the cells grew to a density of 70% - 100%, 4 μg / ml puromycin was added to screen for 48 h, and the cells after drug screening were then passaged. Then the Western blot assay was used to verify at the protein level whether the monoclonal cell lines were completely knocked out. The results found that the monoclonal 2 cell line had a complete knockout effect (as shown in Figure 2E). To detect whether the knockout effect of the monoclonal cell line recovered with passage, we passaged the monoclonal cell line 2 and detected the knockout effect at passage P19. The results showed that the monoclonal cell line 2 had a complete knockout effect (as shown in Figure 2 F).

[0044] In addition, to detect the mutation site, we designed mutation identification primers at positions approximately 200 bp upstream and downstream of the cleavage site of sg-3. Genomes of WT cells and Znhit1-KO cells were extracted respectively, and PCR amplification was performed using the mutation identification primers. The amplified target bands were ligated to the pCE2TA / Blunt-Zero TOPO Amp vector and subjected to Sanger sequencing. The sequencing results showed that compared with WT cells, a 10-bp base deletion was detected in Znhit1-KO cells (as shown in Figure 2 G).

[0045] 4. Inoculate 1×10 3 WT and Znhit1-KO cells per well into a 96-well plate. After the cells adhered, CCK8 reagent was added to detect the proliferation for 1 - 5 days. The results showed that compared with WT cells, the proliferation of ZNHIT1-KO cells started to slow down from the 3rd day (as shown in Figure 2 H).

[0046] The colony formation ability was detected by crystal violet staining. WT and ZNHIT1-KO cells were inoculated into 60-mm dishes at a density of 2×10 3 . After 14 days of culture, the colony-forming cells were stained with crystal violet. The results showed that compared with WT cells, the colony formation ability of Znhit1-KO cells decreased significantly (as shown in Figure 2 I, J).

[0047] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for constructing an ovarian cancer cell line overexpressing the Znhit1 gene, characterized in that, It includes the following steps: (1) Construct an overexpression vector of the Znhit1 gene: Use double digestion with BamH1 and EcorV to digest the pcDNA-flag-Smug1-polyA basic vector, insert the target fragment of Znhit1 to form the pcDNA-flag-Znhit1-polyA recombinant plasmid, and verify it by sequencing; (2) Cell transfection and screening: Transfect the recombinant plasmid obtained in step (1) into ovarian cancer cells, and use G418 gradient screening to obtain a stable transfected cell line; (3) Verification of the stable transfected cell line: Detect the expression level of Znhit1 protein by Western blot to confirm the overexpression effect.

2. The construction method of an ovarian cancer cell line overexpressing the Znhit1 gene according to claim 1, characterized in that, The concentration range of the G418 gradient screening is 200 mg / mL to 1000 mg / mL, and the screening time is 48 hours for each concentration.

3. A method for constructing a Znhit1 gene knockout ovarian cancer cell line, characterized in that, It includes the following steps: (1) Design and synthesize sgRNA targeting the Znhit1 gene: Based on the CRISPR / Cas9 technology, design a specific sgRNA in the exon 2 region of the Znhit1 gene and ligate it to the lentiCRISPR v2 vector; (2) Cell transfection and screening: Transfect the recombinant vector obtained in step (1) into ovarian cancer cells, use puromycin to screen positive cells, and obtain monoclonal cell lines by the limited dilution method; (3) Verification of the knockout effect: Detect the deletion of Znhit1 protein expression by Western blot and confirm the mutation of the gene editing site by Sanger sequencing.

4. The method for constructing a Znhit1 gene knockout ovarian cancer cell line according to claim 3, characterized in that, The sequence of the sgRNA is selected from any one of the following groups: sg-1-F: CACCGCGTCGCATCAACCGGCAGC; sg-1-R: AAACGCTGCCGGTTGATGCGACGC; sg-2-F: CACCGCGAGCTGAGGGAGTCCCGCG; sg-2-R: AAACCGCGGGACTCCCTCAGCTCGC; sg-3-F: CACCGTCCGCATCGTCATCAAACTG; sg-3-R: AAACCAGTTTGATGACGATGCGGAC.

5. Use of an ovarian cancer cell line with overexpression or knockout of the Znhit1 gene in screening anti-ovarian cancer drugs, characterized in that, Evaluate the drug efficacy by detecting the effect of the drug on the proliferation, colony formation or apoptosis of the cell line.

6. A kit for constructing an ovarian cancer cell line with overexpression or knockout of the Znhit1 gene, characterized in that, It contains the following components: (1) The pcDNA-flag-Znhit1-polyA recombinant plasmid described in claim 1, or the lentiCRISPRv2-sgRNA recombinant plasmid described in claim 2; (2)Transfection Reagent Translntro TM EL; (3) Screening antibiotics G418 or puromycin; (4) Western blot detection reagents.

Images