Gly-C-F mutant protein and method for increasing yield of nostoc flagelliforme polysaccharide and application of Gly-C-F mutant protein

Abstract

The invention belongs to the technical field of industrial microorganisms, and discloses a Gly-C-F mutant protein modified through point mutation and applied to increase of the yield of nostoc flagelliforme polysaccharides, and the amino acid sequence of the mutant protein is SEQ ID NO.1. According to the method disclosed by the invention, amino acid residues subjected to Cys oxidation modification in Gly protein are replaced by heterologous expression and point mutation methods to obtain Gly mutant protein with reduced enzyme activity, and the Gly mutant protein is named as Gly-C-F; the enzyme activity is reduced relative to the original Gly protein, so that the nostoc flagelliforme polysaccharide yield is increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of industrial microorganisms, and in particular relates to a Gly-C-F mutant protein, a method and an application for improving the yield of nostoc flagelliforme polysaccharide. Background Art

[0002] Nostoc flagelliforme is a terrestrial cyanobacterium with unique photoautotrophic ability and can synthesize organic substances through photosynthesis. During its growth, nostoc flagelliforme secretes abundant extracellular polysaccharides, and nostoc flagelliforme polysaccharide is a natural macromolecular compound with various biological activities. Research shows that nostoc flagelliforme polysaccharide can not only enhance immunity, inhibit tumor growth, and resist oxidative stress, but also has significant antibacterial, anti-inflammatory and lipid-lowering effects. In addition, it can regulate the balance of intestinal flora, promote the proliferation of beneficial bacteria, and increase the level of s-IgA in saliva, thereby alleviating immune-related symptoms such as pollen allergy. Nostoc flagelliforme polysaccharide has a unique structure and diverse biological activities, and has broad application prospects in the fields of food, medicine and biological materials.

[0003] Microbial extracellular polysaccharides have broad application prospects in multiple fields due to their renewable nature, good biosafety, degradability and excellent biocompatibility. Compared with the traditional production method relying on heterotrophic bacteria fermentation, cyanobacteria, as a photoautotrophic microorganism, are becoming a new potential source for developing natural polysaccharides due to their advantages of rapid reproduction, strong environmental adaptability and easy large-scale cultivation. In recent years, the research on synthesizing extracellular polysaccharides by cyanobacteria has attracted increasing attention, providing new ideas for the sustainable production of microbial polysaccharides.

[0004] The main factor restricting the large-scale production of its exopolysaccharide is the low yield of nostoc flagelliforme polysaccharide. At present, the yield of microbial polysaccharides is mainly improved by optimizing extraction methods, culture conditions and fermentation processes, establishing high-throughput screening, gene transduction or gene editing technologies to obtain strains with high polysaccharide yields. For example, Chinese invention patent CN119351494A, the patent name is: A method for preparing lactic acid bacteria exopolysaccharide. This invention optimizes the medium components and culture conditions, mixes the separately obtained seed solutions of lactic acid bacteria and yeast for co-culture, and further optimizes the medium components and culture conditions to obtain an exopolysaccharide culture solution. Chinese invention patent CN119570643A, the patent name: This invention discovers an ags1 gene fragment related to the synthesis of cell wall α-1,3-glucan, the mycelium aggregation factor, from Monascus ruber, and through experimental research, it is found that compared with the original strain, the extracellular polysaccharide content in the liquid fermentation broth of the recombinant Monascus ruber strain with this gene fragment knocked out is significantly increased, while the extracellular polysaccharide content in the liquid fermentation broth of the recombinant Monascus ruber strain with this gene fragment overexpressed is decreased. Chinese invention patent CN119372091A, the patent name is: Lactobacillus rhamnosus strain Z160 and its application in the preparation of selenium-rich exopolysaccharide. This invention can improve the yield of its exopolysaccharide by adding a selenium source when culturing strain Z160. Although the prior art can improve the yield of microbial polysaccharides, there are generally problems such as high cost, low efficiency and complex operation, and it is not applicable to the production of nostoc flagelliforme polysaccharide. After a comprehensive search, no relevant patents or literatures on improving polysaccharide yield by regulating protein cys oxidative modification have been found yet.

[0005] In view of this technical blank, the present invention innovatively starts from the perspective of protein oxidative modification and discovers that: the activity of a specific protein is negatively correlated with the yield of nostoc flagelliforme polysaccharide, and the activity of this protein is enhanced after Cys oxidative modification, which will inhibit polysaccharide synthesis. Based on this discovery, the present invention adopts site-directed mutagenesis technology to block the Cys oxidative modification site of the key protein, effectively reducing its enzyme activity, thereby relieving the inhibition of polysaccharide synthesis to improve the yield of nostoc flagelliforme polysaccharide and promoting its application in the industrial production of nostoc flagelliforme polysaccharide. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a Gly-C-F mutant protein, method and application for improving the yield of nostoc flagelliforme polysaccharide.

[0007] The technical solution adopted by the present invention to solve its technical problems is:

[0008] A Gly-C-F mutant protein modified by site-directed mutagenesis and applied to improve the yield of nostoc flagelliforme polysaccharide, and the amino acid sequence of the mutant protein is SEQ ID NO.1.

[0009] Use of the Gly-C-F mutant protein as described above in increasing the yield of Nostoc flagelliforme polysaccharide.

[0010] Construction method of the Gly-C-F mutant protein as described above, comprising the following steps:

[0011] (1) Construction of the Gly recombinant plasmid in Nostoc flagelliforme;

[0012] (2) Reverse PCR amplification of the Gly recombinant plasmid to obtain the template plasmid of the Gly-C-F mutant bacteria;

[0013] (3) Digest the template plasmid DNA with DMT enzyme;

[0014] (4) Transformation of the PCR product;

[0015] (5) Confirmation of the mutant Gly-C-F.

[0016] Furthermore, the specific steps are as follows:

[0017] (1) Extraction of the Nostoc flagelliforme genome: Extract according to the instructions of the genome extraction kit;

[0018] (2) Obtaining the Gly gene fragment: Using the above-extracted genome as the DNA template, and Gly-F and Gly-R as the specific primers for the Gly gene, perform PCR amplification according to the following reaction system and program, and recover after detecting the amplification product by agarose gel electrophoresis; among them, the sequence of Gly-F is SEQ ID NO.2, and the sequence of Gly-R is SEQ ID NO.3;

[0019] PCR reaction system:

[0020]

[0021]

[0022] PCR amplification program:

[0023]

[0024] (3) Preparation of E. coli DH5α competent cells:

[0025] (a) Pick a single colony from the LB plate and inoculate it into 5 mL of LB medium, and culture it overnight with shaking at 37°C;

[0026] (b) Take 1 mL of the overnight culture and inoculate it into 50 mL of LB medium, and culture it until the OD600 reaches 0.5;

[0027] (c) Pre-cool the centrifuge tube, centrifuge at 4°C, and collect the cell precipitate;

[0028] (d) Resuspend the cells with 10 mL of 0.1 mol / L CaCl2 solution, let stand on ice for 30 min, and then centrifuge at 4 °C to recover the cells.

[0029] (e) Resuspend again with 10 mL of 0.1 mol / L CaCl2 solution, centrifuge, and discard the supernatant.

[0030] (f) Resuspend with 5 mL of pre-cooled 0.1 mol / L CaCl2 solution containing 15% (v / v) glycerol, aliquot 100 μL per tube, and store at -80 °C.

[0031] The entire above process should be carried out on ice or under low-temperature conditions.

[0032] (4) Linearization of Escherichia coli pET-28a: Linearize the plasmid using double digestion with NotⅠ and SacⅠ:

[0033] Linearize the plasmid according to the following reaction system, verify the digested fragments by agarose gel electrophoresis, and purify and recover the correct fragments.

[0034] PCR reaction system:

[0035]

[0036] (5) Ligation and transformation of the Gly gene fragment with the linearized pET-28a vector

[0037] (a) The purified and recovered Gly fragment is digested with SacⅠ and NotⅠ and then recovered. Mix it with the pET-28a vector DNA fragment obtained by double digestion with NotⅠ and SacⅠ according to the following system, and incubate at 22 °C in a metal bath for 2 h to obtain the recombinant product.

[0038] Ligation reaction system:

[0039]

[0040] (b) Add 10 μL of the ligated recombinant product to the E. coli DH5α competent cell suspension, incubate on ice for 30 min. This operation is carried out in a laminar flow hood.

[0041] (c) Incubate in a metal bath at 42 °C for 90 sec, then on ice for 2 min.

[0042] (d) Add 1 mL of antibiotic-free LB liquid medium, and incubate at 37 °C and 200 rpm in a shaker for 1.5 h.

[0043] (e) Centrifuge the resuscitated bacterial solution at 4500 rpm for 5 min. After discarding 900 μL of the supernatant, resuspend the bacteria in the lower layer by pipetting up and down. Take 100 μL and spread it on an LB solid plate containing 50 μg / ml kanamycin resistance, and incubate it overnight in a 37°C incubator for 12 - 16 h;

[0044] (5) Obtain the template plasmid of the Gly-C-F mutant bacteria by inverse PCR of the Gly recombinant plasmid:

[0045] Design mutant primers according to the mutation sites:

[0046] The sequence of Gly-C-F-F is SEQ ID NO.4, and the sequence of Gly-C-F-R is SEQ ID NO.5;

[0047] Perform PCR amplification according to the following reaction system and procedure. After the reaction is completed, take 10 μL of the PCR product for agarose gel electrophoresis to confirm the PCR product;

[0048] PCR reaction system:

[0049]

[0050] PCR amplification procedure:

[0051]

[0052] (6) Digest the template plasmid DNA with DMT: After the PCR reaction is completed, add DMT to the PCR reaction solution. Add 1 μL of DMT to every 50 μL of the total PCR reaction solution, mix gently, and incubate at 37°C for 1 hour;

[0053] (7) Transformation of the PCR product:

[0054] (a) Add every 2 - 5 μL of the DMT enzyme digestion product to every 50 μL of competent cells. Add the ligation product when the competent cells are just thawed, flick to mix gently, and incubate on ice for 20 - 30 minutes;

[0055] (b) Heat shock in a 42°C water bath for 45 seconds, and immediately place it on ice for 2 minutes;

[0056] (c) Add 250 μl of LB medium equilibrated to room temperature, and culture at 200 rpm and 37°C for 1 hour;

[0057] (d) Take 100 - 200 μl of the bacterial solution and spread it evenly on an LB resistant plate containing 50 μg / ml kanamycin resistance, and incubate it overnight in a 37°C incubator;

[0058] (8) Confirmation of the mutant Gly-C-F: Pick 4 - 8 colonies, extract the plasmid on a small scale, and confirm it by sequencing.

[0059] A method for improving the yield of Nostoc flagelliforme polysaccharide by modifying Gly protein through point mutation. The method is to heterologously express the Gly protein in Nostoc flagelliforme in Escherichia coli, and replace the 421st cysteine residue with phenylalanine through point mutation to construct the Gly-C-F mutant protein. The amino acid sequence of the Gly-C-F mutant protein is SEQ ID NO.1, so as to reduce the Gly protease activity, and then use the natural transformation method to transform it into Nostoc flagelliforme cells, thereby improving the yield of Nostoc flagelliforme polysaccharide.

[0060] The advantages and positive effects achieved by the present invention are as follows:

[0061] 1. The method of the present invention replaces the amino acid residues undergoing cys oxidation modification in the protein by heterologous expression and point mutation in Escherichia coli to obtain a mutant protein with reduced enzyme activity, named Gly-C-F; its enzyme activity is reduced relative to the original protein, thereby improving the yield of Nostoc flagelliforme polysaccharide.

[0062] 2. The method of the present invention is simple and easy to operate, suitable for large-scale popularization and application, and has important theoretical and practical significance for further constructing high-yield polysaccharide genetic engineering bacteria, and has broad application prospects.

[0063] 3. The present invention mutates the protein in Nostoc flagelliforme by heterologous expression and point mutation. There is a negative correlation between protease activity and the yield of Nostoc flagelliforme polysaccharide, and the protease activity increases after cys oxidation modification of the protein. After cys oxidation modification, it has an inhibitory effect on polysaccharide synthesis. To improve the polysaccharide yield, the protease activity needs to be reduced. Replace the 421st cysteine residue with phenylalanine, thereby improving the yield of Nostoc flagelliforme polysaccharide. By combining heterologous expression of Nostoc flagelliforme protein and point mutation, its enzyme activity can be reduced, and then it is transformed into Nostoc flagelliforme strain by natural transformation method, thereby improving the yield of Nostoc flagelliforme polysaccharide. The method of the present invention is simple, easy to operate, and low in cost, and can be used to improve the yield of Nostoc flagelliforme polysaccharide, and has important theoretical and practical significance for further constructing high-yield polysaccharide genetic engineering bacteria, and has broad application prospects.

[0064] 4. There is a negative correlation between the protein and the yield of Nostoc flagelliforme polysaccharide, and the protease activity increases after cys oxidation modification. The present invention reduces the enzyme activity of the protein by point-mutating the cys oxidation modification residues of the protein, thereby promoting the synthesis of Nostoc flagelliforme polysaccharide. The method of the present invention is simple, easy to operate, and low in cost, and can be used to improve the yield of Nostoc flagelliforme polysaccharide. Description of the Drawings

[0065] Figure 1 It is the correlation diagram between protease activity and the yield of Nostoc flagelliforme polysaccharide in the present invention;

[0066] Figure 2 It is the diagram of the change in enzyme activity before and after the protein undergoes oxidation modification in the present invention;

[0067] Figure 3 This is the fragment gel electrophoresis diagram in the present invention; among them, M is DNA Marker; Gly represents Gly protein;

[0068] Figure 4 This is the gel electrophoresis diagram of linearized amplification of pET-28a vector in the present invention; among them, M is DNA Marker;

[0069] Figure 5 This is the gel electrophoresis diagram of reverse PCR amplification of Gly-C-F in the present invention; among them, M is DNA Marker;

[0070] Figure 6 This is the sequencing result diagram of Gly-C-F DNA sequence (A) and protein sequence (B) in the present invention;

[0071] Figure 7 This is the comparison diagram of enzyme activity determination before and after protein mutation in the present invention; among them, WT: original protein; Gly-C-F: mutated protein;

[0072] Figure 8 This is the comparison diagram of polysaccharide yield determination before and after protein mutation in the present invention; among them, WT: original Nostoc flagelliforme strain; Gly-C-F: Nostoc flagelliforme strain after protein mutation. Detailed implementation manners

[0073] The present invention will be further described below in conjunction with embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0074] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For the parts not specifically annotated in this article, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literatures or relevant specifications, manuals, etc. before the filing date of this invention application for implementation.

[0075] A Gly-C-F mutant protein modified by point mutation, the amino acid sequence of the mutant protein is SEQ ID NO.1:

[0076] MHILGNTTPSSGYILALDLGTTGNRAFVFNADGKIVGQAYKELTQYYPQPGWLEHDPEQIWQDTCWVIKTAIANAKIAPSAIAALGLTVQRETCLIWDKTTGKPIHRAIVWQDRRTAPLCHQLQEQGYADEIYDRTGLIIDAYFSATKLRWLLDNFTDVDLNNVLAGTIDTWVLWNLTGGKVHATDHSNASRTMLMNLKTCEWDENLLKLFQIPAHILPQIQPSLGVFGVTDATLLGAEIPITAILGDQQAALFGHGCDRPGLMKCTYGTGSFLVAHTGNQIVRSHHQLISTVGWTQANSKDTLDVGYALEGSMFTSGACIQWLRDRLKLIKTAGETEAMANQVKDNGGVYFVPAFSGLGAPYWDMSARGAFFGITASVQPEHLVRAVLEAIAYQVLEVVQAINASSSTPVGRLTVDGGACENNFLMQFQADVLGIPVERPIMRDTTVQGAAFAAGLAVGFWESYEALVEQRQIERVFEPRSDFSLSNFGTWQKAVKRTLAWEE。

[0077] The method for constructing the Gly-C-F mutant protein as described above comprises the following steps:

[0078] (1) Construction of recombinant plasmid in Nostoc flagelliforme;

[0079] (2) Obtaining the template plasmid of Gly-C-F mutant bacteria by inverse PCR amplification of the recombinant plasmid;

[0080] (3) Digesting the template plasmid DNA with DMT enzyme;

[0081] (4) Transformation of PCR products;

[0082] (5) Confirmation of mutant Gly-C-F.

[0083] Furthermore, the specific steps are as follows:

[0084] (1) Extraction of Nostoc flagelliforme genome: Extract according to the instructions of the genome extraction kit (Vazyme, DC104-01);

[0085] Gly-F: SEQ ID NO.2:

[0086] CGAGCTCATGCACATACTTGGCAACACAACTCCATCATT

[0087] Gly-R: SEQ ID NO.3:

[0088] ATTTGCGGCCGCCTATTCCTCCCAAGCGAGAGTGCGTTT

[0089] Table 1 PCR reaction system

[0090]

[0091] Table 2 PCR amplification program

[0092]

[0093]

[0094] (2) Preparation of E. coli DH5α competent cells:

[0095] (a) Pick a single colony from an LB plate and inoculate it into 5 mL of LB medium. Incubate overnight with shaking at 37°C.

[0096] (b) Take 1 mL of the overnight culture and inoculate it into 50 mL of LB medium. Incubate until the OD600 is approximately 0.5.

[0097] (c) Pre-chill a centrifuge tube and centrifuge at 4°C to collect the cell pellet.

[0098] (d) Resuspend the cells in 10 mL of 0.1 mol / L CaCl2 solution and let stand on ice for 30 min. Then centrifuge at 4°C to recover the cells.

[0099] (e) Resuspend again in 10 mL of 0.1 mol / L CaCl2 and centrifuge to discard the supernatant.

[0100] (f) Resuspend in 5 mL of pre-chilled 0.1 mol / L CaCl2 solution containing 15% glycerol, aliquot 100 μL per tube, and store at -80°C.

[0101] The entire above process needs to be carried out on ice or under low-temperature conditions.

[0102] (3) Linearization of E. coli pET-28a: Linearize the plasmid using double digestion with NotⅠ and SacⅠ:

[0103] Perform plasmid linearization according to the reaction system in Table 3. Verify the digested fragments by agarose gel electrophoresis and purify and recover the correct fragments. The results are as Figure 4 shown.

[0104] Table 3 PCR reaction system

[0105]

[0106] (a) The purified and recovered fragment was digested with SacⅠ and NotⅠ, and then recovered and mixed with the vector DNA fragment obtained by double digestion with NotⅠ and SacⅠ according to the system in Table 4, and ligated in a metal bath at 22℃ for 2 h to obtain a recombinant product;

[0107] Table 4 Ligation reaction system

[0108]

[0109] (b) 10 μL of the ligated product was added to the competent cell suspension of E.coli DH5α and incubated on ice for 30 min. This operation was carried out in a laminar flow hood;

[0110] (c) Incubate in a metal bath at 42℃ for 90 sec and then on ice for 2 min;

[0111] (d) Add 1 mL of antibiotic-free LB liquid medium and resuscitate in a shaker at 37℃ and 200 rpm for 1.5 h;

[0112] (e) Centrifuge the resuscitated bacterial solution at 4500 rpm for 2 min, discard 900 μL of the supernatant, resuspend the lower bacterial cells by pipetting, take 100 μL and spread it on an LB solid plate containing 50 μg / ml kanamycin resistance, and culture it overnight in an incubator at 37℃ for 12 - 16 h;

[0113] (4) Reverse PCR of the recombinant plasmid to obtain the template plasmid of the Gly-C-F mutant bacteria::

[0114] Design mutant primers according to the mutation sites:

[0115] Gly-C-F-F: SEQ ID NO.4; TGTAGATGGTGGTGCTTTCGAGAACAATTTTCTCATGCAGGly-C-F-R: SEQ ID NO.5; GAAAGCACCACCATCTACAGTTAATCGCC

[0116] Perform PCR amplification according to the reaction systems and procedures in Table 5 and Table 6. After the reaction, take 10 μL of the PCR product for agarose gel electrophoresis to confirm the PCR product. The results are as Figure 5 shown.

[0117] Table 5 PCR reaction system

[0118]

[0119] Table 6 PCR amplification program

[0120]

[0121] (6) Digest the template plasmid DNA with DMT: After the PCR reaction is completed, add DMT to the PCR reaction solution. Add 1 μL of DMT to every 50 μL of the total PCR reaction solution, mix gently, and incubate at 37 °C for 1 hour;

[0122] (7) Transformation of the PCR product:

[0123] (a) Add 2 - 5 μl of the DMT enzyme digestion product to 50 μl of DMT competent cell (add the ligation product when the competent cell is just thawed), flick gently to mix, and incubate on ice for 20 - 30 minutes.

[0124] (b) Heat shock in a 42 °C water bath for 45 seconds, and immediately place on ice for 2 minutes.

[0125] (c) Add 250 μl of LB medium equilibrated to room temperature, and culture at 200 rpm and 37 °C for 1 hour.

[0126] (d) Take 100 - 200 μl of the bacterial solution and spread it evenly on the LB resistant plate, and culture overnight in a 37 °C incubator.

[0127] (8) Confirmation of the mutant Gly - C - F: Pick 4 - 8 colonies, extract plasmid mini - preparation, and confirm by sequencing.

[0128] Use of the Gly - C - F mutant protein as described above in increasing the yield of Nostoc flagelliforme polysaccharide.

[0129] A method for increasing the yield of Nostoc flagelliforme polysaccharide by modifying a protein through point mutation, characterized in that: the method is to heterologously express the protein in Nostoc flagelliforme in Escherichia coli, construct a Gly - C - F mutant protein by replacing the 421st cysteine residue with phenylalanine through point mutation, the amino acid sequence of the Gly - C - F mutant protein is SEQ ID NO.1, to reduce protease activity, and use the natural transformation method to transform it into Nostoc flagelliforme, thereby increasing the yield of Nostoc flagelliforme polysaccharide.

[0130] Specifically, the related preparation and detection are as follows:

[0131] Example 1: Construction and expression of the mutant recombinant protein, determination of enzyme activity, and acquisition of the engineering strain

[0132] I. Correlation analysis between protease activity and the yield of Nostoc flagelliforme polysaccharide, and determination of enzyme activity before and after the protein undergoes cys oxidative modification

[0133] 1. Correlation analysis between protease activity and the yield of Nostoc flagelliforme polysaccharide:

[0134] The yield of Nostoc flagelliforme polysaccharide was determined by the phenol-sulfuric acid method.

[0135] The specific method for the determination of Gly (Glycerol Kinase) protease activity is as follows:

[0136] Prepare the Gly enzyme activity reaction system according to Table 1, then add 30 μL of protein sample for reaction, quickly mix well and start timing. Measure the absorbance at 340 nm at the start (0 s), denoted as A1; after accurately reacting at 37 °C for 15 min, use a UV-visible spectrophotometer to measure the absorbance at 340 nm at 15 min, denoted as A2; calculate ΔA = A1 - A2.

[0137] Definition of unit: One enzyme activity unit is defined as the formation of 1 μmol of NADH per mg of tissue protein per minute. The specific enzyme activity calculation formula is:

[0138]

[0139] Vtotal: Total volume of the reaction system, 2.5×10 -4 L;

[0140] ε: Molar extinction coefficient of NADH, 6.22×10 3 L / mol / cm;

[0141] d: 0.5 cm;

[0142] Venzyme: Volume of the enzyme solution added, 0.03 mL;

[0143] △t: Reaction time;

[0144] Cpr: Sample protein concentration, mg / mL;

[0145] △A: ΔA = A1 - A2.

[0146] Table 1 Preparation of the Gly reaction system

[0147] Solution Addition amount Final concentration 200 mmol / L Tris-HCl (PH8.0) 110 μL 100 mmol / L 10 mmol / L NADPH 4.4 μL 0.2 mmol / L <![CDATA[500 mmol / L MgCl2]]> 44 μL 100 mmol / L 100 mmol / L ATP 11 μL 5 mmol / L 100 mmol / L Glycerol 6.6 μL 3 mmol / L <![CDATA[ddH2O]]> 44 μL

[0148] The yield of Nostoc flagelliforme polysaccharide and the activities of related enzymes were determined under the induction of 4 mol / L H2O2. Origin 20.0 was used to analyze whether there was a correlation between the two. The results are as Figure 1 shown. The protease activity of Gly decreased with the increase in polysaccharide yield, and the correlation analysis R 2 = 0.8170. It can be seen from the figure that there is a negative correlation between protease activity and the yield of Nostoc flagelliforme polysaccharide.

[0149] 2. Determination of enzyme activity before and after the cys oxidation modification of the protein:

[0150] The protein was modified with H2O2 at different concentrations for 15 min, and then the enzyme activities before and after modification were measured according to the method in 1.1. The results are as Figure 2 shown. By comparison, it was found that the protease activity after modification was enhanced.

[0151] II. Construction of Escherichia coli recombinant plasmid containing point mutation

[0152] 1. Extraction of Nostoc flagelliforme genome:

[0153] (1) The Nostoc flagelliforme cells cultured to an absorbance value of about 0.8 at 750 nm were examined under a microscope. Nostoc flagelliforme with a chain-like cell state was selected for genome extraction.

[0154] (2) Take 10 mL of Nostoc flagelliforme cell suspension, centrifuge to discard the supernatant, and use fresh BG11 medium. Wash twice, transfer the cell precipitate to a mortar pre-cooled with liquid nitrogen, quench with liquid nitrogen and then grind for about 20 min, avoiding repeated freezing and thawing of the cells during the grinding process.

[0155] (3) Transfer the ground Nostoc flagelliforme powder to a pre-cooled EP tube and extract it according to the instructions of the genome extraction kit (Vazyme, DC104-01).

[0156] 2. Obtaining of gene fragments:

[0157] Using the above-extracted genome as the DNA template and Gly-F and Gly-R as the specific primers of the gene, PCR amplification was carried out according to the reaction systems and procedures in Table 2 and Table 3. After detecting the amplification products by agarose gel electrophoresis, they were recovered, and the purified Gly fragment was obtained. The results of agarose gel electrophoresis are as Figure 3 shown, and the results show that the bands are clear and bright and the sizes are correct, which can be used for subsequent experiments.

[0158] Gly-F: CGAGCTCATGCACATACTTGGCAACACAACTCCATCATT

[0159] Gly-R: ATTTGCGGCCGCCTATTCCTCCCAAGCGAGAGTGCGTTT

[0160] Table 2 PCR reaction system

[0161] PCR reaction components 50 μL reaction system <![CDATA[ddH2O]]> Up to 50 μL 2×Phanta Max Buffer 25 μL dNTP Mix 1 μL Forward primer 2 μL Reverse primer 2 μL Phanta Max Super-Fidelity DNA Polymerase 1 μL Template DNA 200 ng / μL

[0162] Table 3 PCR amplification program

[0163]

[0164] 3. Linearization of E. coli pET-28a: The plasmid was linearized using double digestion with NotⅠ and SacⅠ:

[0165] The plasmid was linearized according to the reaction system in Table 4, and the digested fragments were verified by agarose gel electrophoresis. The correct fragments were purified and recovered.

[0166] Table 4 PCR reaction system

[0167] Reaction system 25 μL reaction system 50 μL reaction system 10×Quick Cut Buffer 2.5 μL 5 μL NotⅠ 0.5 μL 1 μL SacⅠ 0.5 μL 1 μL Plasmid / target fragment <500 ng ≤1 μg <![CDATA[ddH2O]]> Up to 25 μL up to 50 μL

[0168] 4. Ligation and transformation of gene fragments with the linearized pET-28a vector:

[0169] (1) The purified and recovered Gly fragment was digested with SacⅠ and NotⅠ, and then recovered and mixed with the vector DNA fragment obtained by double digestion with NotⅠ and SacⅠ according to the system in Table 5. The mixture was incubated at 22°C in a metal bath for 2 h to obtain the recombinant product;

[0170] (2) 10 μL of the ligated product was added to the E. coli DH5α competent cell suspension and incubated on ice for 30 min. This operation was carried out in a laminar flow hood.

[0171] (3) Incubate in a metal bath at 42°C for 90 sec and then on ice for 2 min.

[0172] (4) Add 1 mL of antibiotic-free LB liquid medium and incubate at 37°C in a shaker at 180 rpm for 1.5 h.

[0173] (5) The resuscitated bacterial solution was centrifuged at 4500 rpm for 2 min. After discarding 900 μL of the supernatant, the lower bacterial cells were pipetted and mixed well. 100 μL was taken and spread on an LB solid plate containing 50 μg / ml kanamycin resistance, and incubated overnight in a 37°C incubator.

[0174] Table 5 Ligation reaction system

[0175] Reaction system 20 μL reaction system T4 DNA Ligase Buffer (10×) 2 μL Vector DNA (4 kb) 50 ng (0.020 pmol) Fragment DNA (1 kb) 37.5 ng (0.060 pmol) <![CDATA[Sterile Water iuhsnuj uw]]> up to 20 μL T4 DNA Ligase 1 μL

[0176] 5. Obtaining the template plasmid of Gly-C-F mutant bacteria by inverse PCR of the recombinant plasmid:

[0177] Mutation primers were designed according to the mutation sites:

[0178] Gly-C-F-F: SEQ ID NO.4; TGTAGATGGTGGTGCTTTCGAGAACAATTTTCTCATGCAG

[0179] Gly-C-F-R: SEQ ID NO.5; GAAAGCACCACCATCTACAGTTAATCGCC

[0180] Perform PCR amplification according to the reaction systems and procedures in Tables 6 and 7. After the reaction, take 10 μL of the PCR product for agarose gel electrophoresis to confirm the PCR product.

[0181] Table 6 PCR Reaction System

[0182]

[0183] Table 7 PCR Amplification Procedure

[0184]

[0185]

[0186] 6. Digest the template plasmid DNA with DMT: After the PCR reaction, add DMT to the PCR reaction solution. Add 1 μL of DMT to every 50 μL of the total PCR reaction solution, mix gently, and incubate at 37 °C for 1 hour.

[0187] 7. Transformation of the PCR product:

[0188] (a) Add 2 - 5 μL of the DMT enzyme digestion product to 50 μL of DMT competent cell (just add the ligation product when the competent cell has just thawed), flick gently to mix, and incubate on ice for 20 - 30 minutes.

[0189] (b) Heat shock in a 42 °C water bath for 45 seconds, and immediately place on ice for 2 minutes.

[0190] (c) Add 250 μL of LB medium equilibrated to room temperature, and culture at 200 rpm and 37 °C for 1 hour.

[0191] (d) Take 100 - 200 μL of the bacterial solution and spread it evenly on an LB resistance (50 μg / ml Kan) plate, and culture overnight in a 37 °C incubator.

[0192] 8. Confirmation of the mutant Gly - C - F:

[0193] Pick 4 - 8 colonies, extract the plasmid on a small scale, and confirm by sequencing. The sequencing results are as Figure 6 shown. The sequencing results are correct, and the construction of the mutant Gly - C - F is successful.

[0194] III. Extraction and Purification of Proteins and the Mutant Protein Gly - C - F

[0195] (1) The correctly sequenced recombinant plasmid was transformed into E. coli BL21(DE3) competent cells. After overnight culture in a 37°C constant temperature incubator, single colonies were picked and inoculated into a 5 mL LB test tube containing 50 μg / ml kanamycin resistance, and cultured overnight at 37°C and 180 rpm on a shaker.

[0196] (2) The overnight cultured bacterial solution was inoculated into 100 mL of LB liquid medium containing 50 μg / ml kanamycin resistance according to a volume ratio of 1:50, and cultured with shaking to expand the culture. After about 1.5 h, the OD 600 value was about 0.8 to end the culture.

[0197] (3) Isopropyl β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.5 mmol / L was added, and the protein was induced to express at low temperature at 20°C for 20 h.

[0198] (4) The bacterial cells were collected by centrifugation at 4°C and 8000 rpm for 15 min, and the cell pellet was suspended with lysis buffer. According to the total volume of the added buffer, 1% lysozyme and 1% protein inhibitor PMSF of the total volume percentage were added.

[0199] (5) The cells were disrupted by sonication in an ice bath for 25 min. The disrupted bacterial solution was centrifuged at 4°C and 10,000 rpm for 30 min, and the supernatant was the crude protein after expression.

[0200] (6) The Gly-C-F mutant protein was purified using a Ni + -NTA resin chromatography column.

[0201] IV. Enzyme Activity Assay of Protein and Gly-C-F Mutant Protein

[0202] Catalyze glycerol and NADP + to generate NADPH and 3-phosphoglycerol. NADPH has a characteristic absorption peak at 340 nm, while NADP + does not; by measuring the increase rate of absorbance at 340 nm, the activity was calculated. The specific steps were measured according to the method in I.1. The results are as Figure 7 shown. It can be seen that the activity of the Gly-C-F mutant protein is reduced by 24.36% compared with the activity of the original protein, so as to increase the production of Nostoc flagelliforme polysaccharide.

[0203] V. Transformation of Gly-C-F Mutant Protein into Nostoc flagelliforme

[0204] In the present invention, the Gly-C-F mutant protein gene was successfully introduced into the Nostoc flagelliforme strain by the conjugation transfer method, and an engineered strain carrying a point mutation was successfully constructed. To evaluate the polysaccharide production capacity of this strain, the extracellular polysaccharide yield was quantitatively analyzed by the phenol-sulfuric acid method. AsFigure 8 As shown, compared with the original strain, the polysaccharide yield of the engineered strain increased by 8.6%, indicating that the Gly-C-F mutant protein plays a significant role in promoting the synthesis of Nostoc flagelliforme polysaccharide.

[0205] Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art can understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.

Claims

1. A Gly-C-F mutant protein modified by point mutation and applied to improve the yield of Nostoc flagelliforme polysaccharide, characterized in that: The amino acid sequence of the mutant protein is SEQ ID NO.

1.

2. Use of the Gly-C-F mutant protein as described in claim 1 in increasing the yield of Nostoc flagelliforme polysaccharide.

3. The method for constructing the Gly-C-F mutant protein according to claim 1, characterized in that: It includes the following steps: (1) Construction of the Gly recombinant plasmid in Nostoc flagelliforme; (2) Obtaining the template plasmid of the Gly-C-F mutant bacterium by inverse PCR amplification of the Gly recombinant plasmid; (3) Digesting the template plasmid DNA with DMT enzyme; (4) Transformation of the PCR product; (5) Confirmation of the mutant Gly-C-F.

4. The construction method according to claim 3, wherein: The specific steps are as follows: (1) Extraction of the Nostoc flagelliforme genome: Extract according to the instructions of the genome extraction kit; (2) Obtaining the Gly gene fragment: Using the above-extracted genome as the DNA template, Gly-F and Gly-R as the specific primers of the Gly gene, perform PCR amplification according to the following reaction system and program, and recover after detecting the amplification product by agarose gel electrophoresis; among them, the sequence of Gly-F is SEQ ID NO.2, and the sequence of Gly-R is SEQ ID NO.3; PCR reaction system: PCR amplification program: (3) Preparation of E. coli DH5α competent cells: (a) Pick a single colony from the LB plate and inoculate it into 5 mL of LB medium, and culture it overnight at 37 °C with shaking; (b) Take 1 mL of the overnight culture and inoculate it into 50 mL of LB medium, and culture it until the OD600 reaches 0.5; (c) Pre-cool the centrifuge tube, centrifuge at 4 °C, and collect the cell pellet; (d) Resuspend the cells with 10 mL of 0.1 mol / L CaCl2 solution, let it stand on ice for 30 min, and then centrifuge at 4 °C to recover the cells; (e) Resuspend again with 10 mL of 0.1 mol / L CaCl2 solution, centrifuge and discard the supernatant; (f) Resuspend with 5 mL of pre-cooled 0.1 mol / L CaCl2 solution containing 15% (v / v) glycerol, aliquot 100 μL per tube, and store at -80 °C; The above entire process needs to be carried out on ice or under low-temperature conditions; (4) Linearization of E. coli pET-28a: Linearize the plasmid by double digestion with NotⅠ and SacⅠ: Perform plasmid linearization according to the following reaction system, verify the digested fragment by agarose gel electrophoresis, and purify and recover the correct fragment; PCR reaction system: (5) Ligation and transformation of the Gly gene fragment with the linearized pET-28a vector (a) The purified and recovered Gly fragment is digested with SacⅠ and NotⅠ and then recovered, and is mixed with the pET-28a vector DNA fragment obtained by double digestion with NotⅠ and SacⅠ according to the following system, and ligated in a metal bath at 22 °C for 2 h to obtain a recombinant product; Ligation reaction system: (b) Add 10 μL of the ligated recombinant product to the E. coli DH5α competent cell suspension, incubate on ice for 30 min, and this operation is carried out in a laminar flow hood; (c) Incubate in a metal bath at 42 °C for 90 sec, and then incubate on ice for 2 min; (d) Add 1 mL of antibiotic-free LB liquid medium, and recover at 37 °C and 200 rpm in a shaker for 1.5 h; (e) The resuscitated bacterial solution was centrifuged at 4500 rpm for 5 min. After discarding 900 μL of the supernatant, the bacteria in the lower layer were pipetted and mixed evenly. 100 μL was taken and spread on an LB solid plate containing 50 μg / ml kanamycin resistance, and cultured overnight in a 37 °C incubator for 12 - 16 h; (5) The template plasmid of the Gly-C-F mutant bacteria was obtained by inverse PCR of the Gly recombinant plasmid: Mutation primers were designed according to the mutation sites: The sequence of Gly-C-F-F is SEQ ID NO.4, and the sequence of Gly-C-F-R is SEQ ID NO.5; PCR amplification was carried out according to the following reaction system and procedure. After the reaction ended, 10 μL of the PCR product was taken for agarose gel electrophoresis to confirm the PCR product; PCR reaction system: PCR amplification procedure: (6) Digest the template plasmid DNA with DMT: After the PCR reaction ended, DMT was added to the PCR reaction solution. 1 μL of DMT was added to every 50 μL of the total PCR reaction solution, gently mixed, and incubated at 37 °C for 1 hour; (7) Transformation of the PCR product: (a) Add every 2 - 5 μL of the DMT enzyme digestion product to every 50 μL of competent cells. Add the ligation product when the competent cells have just thawed, flick gently to mix evenly, and incubate on ice for 20 - 30 minutes; (b) Heat shock in a 42 °C water bath for 45 seconds, and immediately place on ice for 2 minutes; (c) Add 250 μl of LB medium equilibrated to room temperature, and culture at 200 rpm and 37 °C for 1 hour; (d) Take 100 - 200 μl of the bacterial solution and spread it evenly on an LB resistance plate containing 50 μg / ml kanamycin resistance, and culture overnight in a 37 °C incubator; (8) Confirmation of the mutant Gly-C-F: Pick 4 - 8 colonies, extract the plasmid in small amounts, and confirm by sequencing.

5. A method for improving the yield of Nostoc flagelliforme polysaccharide by modifying Gly protein through point mutation, which is characterized in that: The method is to heterologously express the Gly protein in Nostoc flagelliforme in Escherichia coli, construct the Gly-C-F mutant protein by substituting the 421st cysteine residue with phenylalanine through point mutation. The amino acid sequence of the Gly-C-F mutant protein is SEQ ID NO.1 to reduce the Gly protease activity, and use the natural transformation method to transform it into Nostoc flagelliforme cells, thereby increasing the yield of Nostoc flagelliforme polysaccharide.

Images