Method for detecting diallele editing cells based on CRISPR / Cas12a technology
By designing a CRISPR/Cas12a system that specifically crRNA binds to Cas12a protein, the problem of rapid and accurate identification of CRISPR/Cas9-induced biallelic editing cells was solved, and simple and efficient detection was achieved.
Patent Information
- Application Number
- CN202411769301.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2044-12-04
AI Technical Summary
The prior art is difficult to quickly and accurately identify CRISPR/Cas9-induced biallelic editing cells, and the detection methods are complex and have low sensitivity.
Design the nucleotide sequence of specific crRNA binding to the third exon of the porcine CD71 gene and binds to the Cas12a protein. It is used to detect it using the CRISPR/Cas12a system, and achieve rapid identification by specifically amplifying the target and using fluorescent or colloidal gold test strip detection system.
The rapid and accurate screening of CRISPR/Cas9-induced biallele editing cells was achieved, which simplified the operation process and improved the detection efficiency and sensitivity.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection technologies, and particularly to a method for detecting biallelically edited cells based on CRISPR / Cas12a technology. Background Art
[0002] The CD71 gene, also known as transferrin receptor 1, is a type II transmembrane glycoprotein composed of 760 amino acids, located on chromosome 13 of pigs, with a size of approximately 51 kb. CD71 has important functions in the field of cancer. The expression level of CD71 in cancer tissues is significantly higher than that in normal tissues. By using specific antibodies to bind to CD71, the abnormal proliferation process of cells can be effectively inhibited, and apoptosis can be induced. At the same time, CD71 participates in the induction of signal transduction in T cells to activate T cells and trigger non-antibody-dependent immune response reactions. Therefore, screening for biallelically edited cells of the CD71 gene is of great significance for in-depth study of its functions.
[0003] However, efficiently and accurately detecting biallelically edited cells has always been a challenge. Existing detection methods have problems such as complex operation, time-consuming, and low sensitivity. The CRISPR / Cas12a system is a technology based on RNA-guided DNA endonuclease. Its core lies in the formation of a complex by the Cas12a protein and a specifically designed CRISPR RNA (crRNA). This complex can precisely recognize and target a DNA region containing a specific PAM sequence, cut downstream of the PAM sequence, generating DNA double-strand breaks. After the Cas12a protein cuts the target DNA, it enters an activated state and exhibits non-specific collateral cleavage activity, capable of cutting nearby non-target DNA molecules. This property has been applied to the CRISPR / Cas12a-based nucleic acid detection system, showing great potential in the field of mutation detection. Summary of the Invention
[0004] The technical problem solved by the present invention is how to quickly and accurately identify CRISPR / Cas9-induced biallelically edited cells.
[0005] To solve the above technical problem, in the first aspect of the present invention, there is provided a crRNA, and the nucleotide sequence of its binding target is SEQ ID NO.6.
[0006] In the above text, the target of the above CD71 gene is located in the third exon of the porcine CD71 gene.
[0007] In the above-mentioned crRNA, the crRNA is obtained by in vitro transcription from a transcription template; The transcription template is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO. 10 and the single-stranded DNA molecule shown in SEQ ID NO. 13.
[0008] Among the crRNAs described above, the nucleotide sequence of the crRNA is SEQ ID NO. 16.
[0009] In a second aspect, the present invention provides a product comprising the crRNA described in the first aspect.
[0010] The product described above further comprises a Cas12a protein.
[0011] In an embodiment of the present invention, specifically, it is an LbCas12a protein.
[0012] The product described above further comprises a primer pair for specifically amplifying the target site; the primer pair is composed of the single-stranded DNA molecule shown in SEQ ID NO. 2 and the single-stranded DNA molecule shown in SEQ ID NO. 3.
[0013] The product described above further comprises a single-stranded DNA probe, and different groups are respectively labeled at both ends of the single-stranded DNA probe; and / or the groups are fluorescent groups, quenching groups and / or biotin.
[0014] The above single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 5 - 50 nt.
[0015] In an embodiment of the present invention, the single-stranded DNA probe in the CRISPR / Cas12a fluorescence detection system is 6-FAM-TTATT-BHQ1; the single-stranded DNA probe in the CRISPR / Cas12a colloidal gold test strip detection system is 6-FAM-TTTTTTTATTTTTTT-C6Biotin.
[0016] The product described above is a kit, a test strip or a fluorescence detection system.
[0017] In a third aspect, the present invention provides any one of the following substances: A1) The Cas12a protein and the crRNA described in the second aspect, or the complex formed by the two; A2) The primer pair described in the second aspect.
[0018] In a fourth aspect, the present invention provides the application of the crRNA described in the first aspect or the product described in the second aspect in any one of the following: B1) Detecting or assisting in detecting biallelic editing of the CD71 gene; B2) Preparing a product for detecting or assisting in detecting biallelic editing of the CD71 gene; B3) Detecting or assisting in detecting samples with bi-allelic editing of the CD71 gene; B4) Preparing a product for detecting or assisting in detecting samples with bi-allelic editing of the CD71 gene.
[0019] Alternatively, the present invention provides a method for detecting or assisting in detecting samples with bi-allelic editing of the CD71 gene, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, performing PCR amplification with a primer pair composed of the single-stranded DNA molecule shown in SEQ ID NO.2 and the single-stranded DNA molecule shown in SEQ ID NO.3 to obtain a PCR product; C2) Preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in the second aspect, the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect; C3) Reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying whether the sample to be tested is a sample with bi-allelic editing of the CD71 gene.
[0020] In the above text, the sample with bi-allelic editing of the CD71 gene is a sample in which gene editing is performed on the target region shown in SEQ ID NO.7 in the third exon of the CD71 gene in the sample, so that gene editing occurs in the target regions on both homologous chromosomes of the sample.
[0021] The above method is for non-disease diagnosis purposes.
[0022] In the above text, the sample to be tested is a cell or an organism.
[0023] In the examples of the present invention, an example is a cell after CD71 gene editing, which can be a wild-type CD71 gene cell, a mono-allelic edited CD71 gene cell, and / or a bi-allelic edited CD71 gene cell.
[0024] The above wild-type CD71 gene cell is a cell in which the CD71 gene on both homologous chromosomes has not been gene-edited; The above mono-allelic edited CD71 gene cell is a cell in which the CD71 gene on one homologous chromosome has gene editing in the target region (SEQ ID NO.7) in the third exon, and the CD71 gene on the other homologous chromosome remains unchanged; The above bi-allelic edited CD71 gene cell is a cell in which the CD71 gene on both homologous chromosomes has gene editing in the target region (SEQ ID NO.7) in the third exon.
[0025] The present invention provides crRNAs of the CD71 gene, constructs a CRISPR / Cas12a system using the same, conducts CRISPR / Cas12a detection, and realizes the screening of CRISPR / Cas9-induced CD71 gene biallelically edited cells. This method is simple, easy, fast, and convenient for economically and effectively screening a large number of mutant cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the electrophoresis result after PCR amplification of wild-type porcine ileal epithelial cells in Example 1 of the present invention.
[0027] Figure 2 This is the sequencing result of the wild-type standard plasmid of the porcine CD71 gene in Example 1 of the present invention.
[0028] Figure 3 This is the detection result of the fluorescence intensity of crRNAs targeting the wild-type sequence of the porcine CD71 gene in Example 1 of the present invention. Different lowercase letters indicate significant differences ( P <0.05).
[0029] Figure 4 This is the detection result of the activity of crRNAs targeting the wild-type sequence of the porcine CD71 gene by colloidal gold test strips in Example 1 of the present invention.
[0030] Figure 5 This is the result of detecting CD71 gene-edited cells in some monoclonal cells by the crRNA-F1, crRNA-F2, and crRNA-F3 fluorescence reporter systems in Example 2 of the present invention. Different lowercase letters indicate significant differences ( P <0.05).
[0031] Figure 6 This is the result of detecting CD71 gene-edited cells in monoclonal cells by the crRNA-F3 fluorescence reporter system in Example 3 of the present invention. Different lowercase letters indicate significant differences ( P <0.05).
[0032] Figure 7 This is the result of screening CD71 gene-edited cells in monoclonal cells by the crRNA-F3 colloidal gold test strip system in Example 3 of the present invention.
[0033] Figure 8 This is the TA cloning result of CRISPR / Cas9-induced biallelically edited cells at the sgRNA editing site in Example 3 of the present invention.
[0034] Figure 9 This is the sensitivity test result of the crRNA-F3 system in Example 4 of the present invention. ** indicates extremely significant differences compared with the negative control group ( P<0.01), * indicates a significant difference compared with the negative control group ( P <0.05), ns indicates no significant difference compared with the negative control group ( P >0.05). Detailed implementation manners
[0035] The present invention will be further described in detail below in conjunction with specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0036] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0037] The present invention will be described below in conjunction with specific embodiments. These embodiments are only examples and do not limit the scope of the present invention. Unless otherwise specified, the embodiments are carried out under conventional experimental conditions, such as the Molecular Cloning Experiment Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended by the manufacturer's instructions.
[0038] The main reagents used in the following embodiments: LbCas12a protein (EDE0005) was purchased from Guangzhou Aidy Gene Technology Co., Ltd.; 10×LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidy Gene Technology Co., Ltd.; KOD enzyme (KFX-101) was purchased from Baolinco (Beijing) Biotechnology Co., Ltd.; E. coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; CloneSmarter TOPO Cloning Vector Kit (C5865-50) was purchased from Zhongmei Taihe Biotechnology (Beijing) Co., Ltd.; Plasmid endotoxin-free extraction kit (CW2105S) was purchased from ComWin Biotech Co., Ltd.; PCR primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen; The RNA purification and recovery kit (12183018A) is produced by Invitrogen; The single-stranded DNA fluorescent probe is synthesized by Sangon Biotech (Shanghai) Co., Ltd.; The single-stranded DNA colloidal gold probe (EDN-THD02) is purchased from Guangzhou Aidy Gene Technology Co., Ltd.; The Cas12-specific nucleic acid colloidal gold test strip (JY0301) is purchased from Guangzhou Aidy Gene Technology Co., Ltd.; Rnase-Free Water (9012) is purchased from Beijing Liuhetong Economic and Trade Co., Ltd.
[0039] The main instruments are as follows: PCR instrument (BIO-RAD, C1000 Touch TM ) Desktop high-speed refrigerated centrifuge (Thermo Scientific, Heraeus Multifuge X1R); Bacterial incubator (SANYO, MIR-254); Constant temperature water bath (Changzhou Nuoji Instrument Co., Ltd., HHS-21-4); Vortex oscillator (Stuart-equipment, SA8); Electronic weighing balance (Sartorius Scientific Instrument Co., Ltd., Sartorius SQP); Gel imaging system (BIO-RID, Universal HoodⅡ); Quantitative fluorescence PCR instrument (Thermo Scientific, QuantStudio™5).
[0040] Porcine ileal epithelial cells (IPI-2I) are described in the following literature: Xu Changjiang, Wang Xiaopeng, Xu Kui, Zhang Xiuling, Xiang Guangming, Zhao Haiquan, Mou Yulian, Lin Xiao, Li Kui. Construction of IPI-2I cell line with pAPN gene knockout using CRISPR / Cas9 editing system. China Animal Husbandry & Veterinary Medicine, 2021, 48(7): 2282-2290.
[0041] Example 1. Design of PCR-CRISPR / Cas12a nucleic acid detection system 1. Construction of standard plasmid Extract the DNA of wild-type (WT) porcine ileal epithelial cells (IPI-2I). Design primers for amplification of the sequence containing sgRNA in the third exon of the CD71 gene (GenBank: NC_010455.5) (the primer sequences are shown in Table 1). The sequence of the sgRNA target is GTAGCCAATCATAAATCCTA (SEQ ID NO.1). The amplified fragment size is 591 bp, and the PCR amplification system is shown in Table 2.
[0042] Table 1 Primer sequences
[0043] Table 2 PCR amplification system
[0044] PCR reaction procedure: Pre-denaturation at 94 °C for 2 min; denaturation at 94 °C for 10 s, annealing at 60 °C for 30 s, extension at 68 °C for 36 s, 36 cycles; extension at 72 °C for 5 min.
[0045] After the PCR amplification is completed, agarose gel electrophoresis is carried out. The electrophoresis results are as Figure 1 shown. M is the GsDL1002 DNA Marker with a size of 1000 bp; NC is the negative control; WT-1 to WT-9 are respectively the DNA samples after PCR amplification of wild-type porcine ileal epithelial cells. It can be seen that the PCR product is successfully amplified, and a single band with a size of approximately 591 bp appears at the expected position.
[0046] The PCR product is purified by gel extraction. The purified product is ligated into the pClone-EZ-TOPO vector (Sino-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50) through TA cloning. The ligation product is sequenced and verified to obtain the wild-type standard plasmid pClone-EZ-TOPO-WT of the porcine CD71 gene. The plasmid sequencing results are as Figure 2 shown. The blue selected region is the reverse complementary sequence of the sgRNA target shown in SEQ ID NO.1, and the red box selected region is the PAM sequence.
[0047] 2. crRNA target design According to the DNA sequence within 40 bp upstream and downstream of the sgRNA of the third exon of the porcine CD71 gene, search for the PAM sequence marked by TTN or TTTN, and extend 20 bp - 25 bp downstream of the PAM sequence as the candidate target sites recognized by the CRISPR / Cas12a system. Then, design 3 candidate target sites according to rules such as sequence GC content and sequence complementarity, and name them crRNA-T1 (SEQ ID NO.4), crRNA-T2 (SEQ ID NO.5), and crRNA-T3 (SEQ ID NO.6) respectively (the candidate target site sequences are shown in Table 3).
[0048] The sequences covered by the above 3 candidate target sites and the sgRNA target site, TTTTTTATCCTTAGGATTTATGATTGGCTAC, are the sequences targeted by crRNA for cleavage (SEQ ID NO.7).
[0049] Table 3 Candidate target site sequences
[0050] 3. Preparation of specific crRNA in vitro transcription templates According to the candidate target site sequences, add the T7 promoter sequence (TAATACGACTCACTATAGGG) and the crRNArepeat region template sequence (TAATTTCTACTAAGTGTAGAT) respectively to form the positive-strand DNA sequences of specific crRNA in vitro transcription templates, crRNA-T7-F1 (SEQ ID NO.8), crRNA-T7-F2 (SEQ ID NO.9), and crRNA-T7-F3 (SEQ ID NO.10).
[0051] According to the complementary base pairing of the positive-strand DNA sequences, form the negative-strand DNA sequences crRNA-T7-R1 (SEQ ID NO.11), crRNA-T7-R2 (SEQ ID NO.12), and crRNA-T7-R3 (SEQ ID NO.13) respectively.
[0052] Table 4 Positive and negative strand DNA sequences of specific crRNA in vitro transcription templates
[0053] Synthesize the positive and negative strand DNA single strands respectively, and prepare the specific crRNA in vitro transcription templates by annealing, and configure the annealing reaction system as shown in Table 5.
[0054] Table 5 Annealing reaction system
[0055] Place the prepared system in a PCR instrument (BIO-RAD, C1000 Touch TM ), incubate at 95 °C for 10 min, then immediately turn off the PCR instrument to allow the double-stranded DNA to cool naturally at room temperature, and incubate on ice for 5 min after 90 min. The annealed product can be used for in vitro transcription of crRNA.
[0056] 4. In vitro transcription of specific crRNA Using the T7 in vitro transcription kit (Invitrogen, AM1354), prepare the in vitro transcription system for specific crRNA as shown in Table 6.
[0057] Table 6 In vitro transcription of specific crRNA
[0058] Incubate the transcription system overnight in a 37 °C incubator. Recover the crRNA using an RNA purification and recovery kit (Invitrogen, 12183018A). The recovered crRNA sequences are shown in Table 7.
[0059] Table 7 crRNA sequences Name Sequence (5′-3′) Length Corresponding sequence name crRNA-F1 UAAUUUCUACUAAGUGUAGAUUCCUUAGGAUUUAUGAUUGG 41 bp SEQ ID NO.14 crRNA-F2 UAAUUUCUACUAAGUGUAGAUUUUAUCCUUAGGAUUUAUGA 41 bp SEQ ID NO.15 crRNA-F3 UAAUUUCUACUAAGUGUAGAUUUAUCCUUAGGAUUUAUGAUUGG 44 bp SEQ ID NO.16 5. Establishment of the PCR-CRISPR / Cas12a nucleic acid detection system (1) The CRISPR / Cas12a fluorescence detection system is as shown in Table 8 below: Table 8 CRISPR / Cas12a fluorescence detection system
[0060] The above DNA probe is a single-stranded DNA probe double-labeled with 6-FAM group and BHQ group, which is 6-FAM-TTATT-BHQ1.
[0061] The above PCR product is obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as the DNA template and the CD71-F / CD71-R primers.
[0062] The above crRNAs are crRNA-F1, crRNA-F2, and crRNA-F3, respectively.
[0063] Prepare the crRNA-F1, crRNA-F2, and crRNA-F3 detection systems according to the above system respectively. Set up four technical replicates for each detection system, and set up a system without crRNA as a negative control (NC).
[0064] The prepared detection systems were respectively reacted at 37 °C in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™ 5), and the fluorescence intensity was detected every 30 s for a total of 120 times.
[0065] The results are as Figure 3 shown. Compared with the negative control group, the fluorescence intensities of the crRNA-F1, crRNA-F2, and crRNA-F3 groups were all significantly increased ( P < 0.05), demonstrating that crRNA-F1, crRNA-F2, and crRNA-F3 all have a targeted cleavage effect on the wild-type sequence of the CD71 gene (SEQ ID NO.7).
[0066] (2) The CRISPR / Cas12a colloidal gold test strip detection system is shown in Table 9: Table 9 CRISPR / Cas12a colloidal gold test strip detection system
[0067] The above colloidal gold probe is a single-stranded colloidal gold probe double-labeled with Biotin group and 6-FAM group, which is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO.17)-C6Biotin.
[0068] The above PCR products were obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as the DNA template with the CD71-F / CD71-R primers.
[0069] The above crRNAs are respectively crRNA-F1, crRNA-F2, and crRNA-F3.
[0070] The crRNA-F1, crRNA-F2, and crRNA-F3 detection systems (denoted as WT in the figure) were respectively prepared according to the above system. Four technical replicates were set up for each detection system, and a system without crRNA was set up as a negative control (NC).
[0071] The prepared detection systems were respectively reacted at 37 °C for 30 min in a PCR instrument (BIO-RAD, C1000 Touch TM ) to obtain reaction products. After the reaction ended, the binding pad end of the test strip was inserted into the reaction products in the reaction tube, and the test results were read after the entire interpretation area was wetted.
[0072] The results are as Figure 4As shown, compared with NC (negative result), crRNA-F1, crRNA-F2, and crRNA-F3 can all specifically recognize the wild-type sequence of the CD71 gene (SEQ ID NO.7), that is, the T line of the test strip shows color, presenting a positive result; only the C line of the negative control group shows color, presenting a negative result.
[0073] Example 2. Detection and analysis of monoclonal cell samples in the CRISPR / Cas12a nucleic acid detection system The PCR-Cas12a detection system provided by the present invention was used to screen for CD71 gene biallelic edited cells in monoclonal cells.
[0074] The monoclonal cells in the examples of the present invention are gene-edited cells obtained by performing CRISPR / Cas9 gene editing on porcine ileal epithelial cells (IPI-2I), and the target site of the sgRNA is GTAGCCAATCATAAATCCTA (SEQ ID NO.1).
[0075] 1. Screening of crRNA (1) Amplification of the target sequence of the Cas9 / sgRNA target site The monoclonal cells are 2-1#, 2-10#, 2-12#, and 2-30#; it is known that 2-10# and 2-12# are CD71 gene biallelic edited cells; 2-1# is a wild-type cell; 2-30# is a CD71 gene monoallelic edited cell.
[0076] Using the lysates of each monoclonal cell as a DNA template, PCR amplification was performed with CD71-F and CD71-R. The PCR system and reaction procedure are shown in 1 of Example 1 to obtain the PCR amplification product.
[0077] (2) PCR-CRISPR / Cas12a nucleic acid detection According to the system shown in Table 8 in Example 1, the above PCR amplification product and crRNA were formulated into crRNA-F1, crRNA-F2, and crRNA-F3 detection systems. Four technical replicates were set up for each detection system, and a system without crRNA was set up as a negative control (NC).
[0078] The prepared detection system was reacted at 37°C in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5), and the fluorescence intensity was detected once every 30 s for a total of 120 times.
[0079] The results are as Figure 5As shown, A: Detection results of the crRNA-F1 system; B: Detection results of the crRNA-F2 system; C: Detection results of the crRNA-F3 system; crRNA-F1 can recognize the biallelic edited cell samples of the CD71 gene (2-10# and 2-12#), but it can be seen from the results of the 2-10# monoclonal cell samples that there is still a significant difference in its fluorescence intensity compared with the negative control ( P <0.05), which may be due to its certain non-specific recognition of this mutant sequence. crRNA-F2 can recognize the biallelic edited cell samples of the CD71 gene (2-10# and 2-12#), but it can be seen from the fluorescence curve that its reaction is slower, which may limit its detection efficiency in practical applications. In contrast, the detection effect of crRNA-F3 is very good, and there is no significant difference in the fluorescence intensity of the detected biallelic edited cells compared with the negative control group ( P >0.05), and it can recognize the biallelic edited cell samples of the CD71 gene (2-10# and 2-12#); and it has a fast reaction speed and strong stability, which helps to ensure the detection efficiency and accuracy in practical applications. Therefore, crRNA-F3 was selected for subsequent detection.
[0080] 2. Establishment of the PCR-CRISPR / Cas12a nucleic acid detection system (1) PCR amplification Extract the DNA of the sample to be tested as a template, and perform PCR amplification with the CD71-F and CD71-R primers to obtain the PCR amplification product.
[0081] (2) CRISPR / Cas12a detection 1) CRISPR / Cas12a fluorescence detection Prepare the CRISPR / Cas12a fluorescence detection system by mixing the above PCR amplification product and crRNA-F3 according to the system shown in Table 8 to obtain the CRISPR / Cas12a detection system; Set up four technical replicates for the above detection system, and set up a negative control (NC) without crRNA.
[0082] React the prepared detection system in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5) at 37°C for 60 min.
[0083] Use a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5) to detect the fluorescence intensity of the reaction product of the above fluorescence detection system in real time.
[0084] If the fluorescence intensity of the reaction product of the CRISPR / Cas12a detection system is not significantly higher than that of the reaction product of the negative control system ( P > 0.05), then the sample to be tested is or is a candidate for a CD71 gene biallelic editing sample; if the fluorescence intensity of the reaction product of the CRISPR / Cas12a detection system is significantly higher than that of the reaction product of the negative control system ( P < 0.05), then the sample to be tested is not or is not a candidate for a CD71 gene biallelic editing sample.
[0085] The only difference between the above negative control system and the CRISPR / Cas12a detection system is that no crRNA is added.
[0086] 2) CRISPR / Cas12a strip test Prepare the CRISPR / Cas12a colloidal gold strip detection system with the above PCR amplification product and crRNA-F3 according to the system shown in Table 9 to obtain the CRISPR / Cas12a detection system; Set up four technical replicates for the above detection system and set up a negative control (NC) without crRNA.
[0087] React the prepared detection system in a PCR instrument (BIO-RAD, C1000 Touch TM ) at 37 °C for 30 min to obtain a reaction product.
[0088] Detect the reaction product with the CRISPR / Cas12a colloidal gold strip. If the T line of the reaction product does not show color (negative), then the sample to be tested is or is a candidate for a CD71 gene biallelic editing sample; if the T line of the reaction product shows color or both the T line and the C line show color (positive), then the sample to be tested is not or is not a candidate for a CD71 gene biallelic editing sample.
[0089] The above sample is a cell.
[0090] In the above, for CD71 gene biallelic editing cells, the CD71 genes on two homologous chromosomes in the cells have gene editing in the target region (SEQ ID NO.7) of the third exon compared to the CD71 genes in cells without gene editing.
[0091] Cells that are not CD71 gene biallelic editing cells are CD71 gene monoallelic editing cells or CD71 gene wild-type cells; The above CD71 gene wild-type cells are cells in which the CD71 genes on two homologous chromosomes are not gene edited; The above-mentioned CD71 gene monoallelically edited cells are such that the CD71 gene on one homologous chromosome in the cells has gene editing in the target region (SEQ ID NO.7) of the third exon compared to the CD71 gene in the cells without gene editing, and the CD71 gene on the other homologous chromosome remains unchanged compared to the CD71 gene in the cells without gene editing.
[0092] Example 3. Application of the crRNA-F3 nucleic acid detection system in the detection and analysis of monoclonal cell samples In the examples of the present invention, the monoclonal cells are gene-edited cells obtained by performing CRISPR / Cas9 gene editing on porcine ileal epithelial cells (IPI-2I), and the target of the sgRNA is GTAGCCAATCATAAATCCTA (SEQ ID NO.1).
[0093] 1. CRISPR / Cas12a fluorescence detection Using the PCR product of the monoclonal cell sample as the detection template according to the method of 2 in Example 2, perform CRISPR / Cas12a fluorescence detection by the crRNA-F3 nucleic acid detection method.
[0094] The monoclonal cell samples are 2-7#, 2-25#, 2-26#, 2-28#, 2-29#, 2-31#, 1-28#, 2-13#, 2-17# respectively.
[0095] The results are as Figure 6 shown. Compared with NC, the fluorescence intensity of 2-7#, 2-25#, 2-26#, 2-28#, 2-29#, 2-31# is significantly increased ( P <0.05), and they are not CD71 gene biallelically edited cells; compared with NC, the fluorescence intensity of 1-28#, 2-13#, 2-17# has no significant difference ( P >0.05), so they are CD71 gene biallelically edited cells.
[0096] 2. CRISPR / Cas12a test strip detection Using the PCR product of the monoclonal cell sample as the detection template according to the method of 2 in Example 2, perform CRISPR / Cas12a test strip detection by the crRNA-F3 nucleic acid detection method.
[0097] The results are as Figure 7 shown. The T line of 2-28#, 2-7#, 2-25#, 2-26#, 2-29#, 2-31# shows color (positive), and they are not CD71 gene biallelically edited cells; the T line of 1-28#, 2-17#, 2-13# does not show color (negative), so they are CD71 gene biallelically edited cells.
[0098] The above results indicate that both the crRNA-F3 fluorescence detection system and the colloidal gold test strip detection system can detect nucleic acid samples containing the wild-type sequence of the CD71 gene (SEQ ID NO.7), and can be used to screen monoclonal cells with bi-allelic editing of the CD71 gene induced by CRISPR / Cas9.
[0099] To determine the accuracy and specificity of the method for rapidly detecting bi-allelic editing cells induced by CRISPR / Cas9 provided by the present invention, the PCR products of each of the above-mentioned monoclonal cells were used for TA cloning to confirm the genotypes of the screened bi-allelic editing cells.
[0100] Partial sequencing results are as Figure 8 shown. 1-28# is a bi-allelic editing cell of the CD71 gene, and the sequences at the target sites of its two homologous chromosomes are as Figure 8 shown. It can be seen that compared with the target site (SEQ ID NO.7) in wild-type CD71, the target sites (SEQ ID NO.7) in the two homologous chromosomes of CD71 in 1-28# have both mutated. One homologous chromosome has a 2-bp insertion, and the other homologous chromosome has a 3-bp deletion. Therefore, 1-28# is a bi-allelic editing cell of the CD71 gene, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.
[0101] Sequencing results of other bi-allelic editing cells of the CD71 gene also show that the target sites (SEQ ID NO.7) in their two homologous chromosomes of CD71 have both mutated, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.
[0102] Sequencing results of cells that are not bi-allelic editing cells of the CD71 gene also show that the target sites (SEQ ID NO.7) in their two homologous chromosomes of CD71 have not both mutated, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.
[0103] This result proves that crRNA-F3 can be used for specifically screening bi-allelic editing samples of the CD71 gene with extremely high accuracy.
[0104] Example 4. Sensitivity test of the crRNA-F3 nucleic acid detection system The wild-type standard plasmid pClone-EZ-TOPO-WT of the porcine CD71 gene was serially diluted with nuclease-free ddH2O to 3.71×10 10 、3.71×10 9 、3.71×10 8 、3.71×10 7 、3.71×106 , 3.71×10 5 , 3.71×10 4 , 3.71×10 3 , 3.71×10 2 , 3.71×10 1 , 3.71×10 0 copies / μL concentration.
[0105] Using the pClone-EZ-TOPO-WT plasmid with gradient concentrations as the DNA template, the CRISPR / Cas12a fluorescence detection in Example 2 was performed for detection.
[0106] The detection results are shown in Figure 9 , showing that in the Cas12a system involving crRNA-F3, when the standard plasmid concentration is 3.71×10 1 copies / μL and above, the fluorescence signal intensity is significantly higher or extremely significantly higher than that of the negative control group ( P <0.05, P <0.01), indicating that the standard plasmid with a concentration of 3.71×10 1 copies / μL is the minimum detection sensitivity of the crRNA-F3 detection system.
[0107] This result indicates that this system still has good detection ability and high sensitivity under extremely low concentration conditions.
[0108] Therefore, using the crRNA-F3 nucleic acid detection system provided by the present invention can quickly screen CD71 gene biallelic edited cells that meet the expectations within a short time, which plays an important role in accelerating the development of CD71 gene function analysis.
[0109] The above has detailed the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives special embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including those that deviate from the scope disclosed in this application and are made using conventional techniques known in the art. According to the scope of the following appended claims, some basic features can be applied.
Claims
1. A crRNA, whose nucleotide sequence binding to the target is SEQ ID NO.
6.
2. The crRNA according to claim 1, characterized in that: The crRNA is obtained by in vitro transcription from a transcription template; The transcription template is a product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.10 and the single-stranded DNA molecule shown in SEQ ID NO.
13.
3. The crRNA according to claim 1 or 2, characterized in that: The nucleotide sequence of the crRNA is SEQ ID NO.
16.
4. A product, comprising the crRNA according to any one of claims 1-3.
5. The product according to claim 4, characterized in that: The product further comprises a Cas12a protein.
6. The product according to claim 5, characterized in that: The product further comprises a primer pair for specifically amplifying the target; the primer pair consists of the single-stranded DNA molecule shown in SEQ ID NO.2 and the single-stranded DNA molecule shown in SEQ ID NO.
3.
7. The product according to claim 6, characterized in that: The product further comprises a single-stranded DNA probe, with different groups labeled at both ends of the single-stranded DNA probe; and / or the groups are fluorescent groups, quenching groups and / or biotin.
8. The product according to any one of claims 4-7, characterized in that: The product is a kit, a test strip or a fluorescence detection system.
9. Any one of the following substances: A1) The Cas12a protein and the crRNA according to claim 5, or a complex formed by the two; A2) The primer pair according to claim 6.
10. The application of the crRNA according to any one of claims 1-3 or the product according to any one of claims 4-8 in any of the following: B1) Detecting or assisting in detecting biallelic editing of the CD71 gene; B2) Preparing a product for detecting or assisting in detecting biallelic editing of the CD71 gene; B3) Detecting or assisting in detecting a biallelic editing sample of the CD71 gene; B4) Preparing a product for detecting or assisting in detecting a biallelic editing sample of the CD71 gene; Or, a method for detecting or assisting in detecting a biallelic editing sample of the CD71 gene, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, performing PCR amplification with the primer pair consisting of the single-stranded DNA molecule shown in SEQ ID NO.2 and the single-stranded DNA molecule shown in SEQ ID NO.3 to obtain a PCR product; C2) Preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein according to claim 5, the crRNA according to claim 4 and the single-stranded DNA probe according to claim 7; C3) Reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying whether the sample to be tested is a biallelic editing sample of the CD71 gene.
Citation Information
Patent Citations
Methods and compositions involving crispr class 2, type vi guides
US20230022311A1
Chemically modified crispr-cas13 guide rnas
US20240043840A1
Nucleic acid detection kit and detection method based on crispr / cas12a system
WO2024092904A1
Cited By
Reagent and method for editing pig CD71 gene
CN120290556A
Reagents and methods for editing the pig cd71 gene
CN120290556B