Preparation method of nematodidae fish type-III antifreeze protein based on escherichia coli strain

Abstract

The invention discloses a preparation method of a nematodidae fish type-III antifreeze protein based on an escherichia coli strain, and belongs to the technical field of biology. The nucleotide sequence for coding the type-III antifreeze protein of the nematodes fish is shown as SEQ ID NO. 2. The preparation method of the three-type antifreeze protein of the nematodes fish comprises the following steps: (1) constructing the nucleotide sequence into an expression vector pET-28a to obtain a recombinant plasmid; and (2) transforming the recombinant plasmid into an escherichia coli BL21 (DE3) strain, and carrying out liquid culture, inducible expression, bacterial liquid collection, extraction and purification to obtain the type-III antifreeze protein of the nematodes fish. According to the antifreeze protein expressed and purified on the basis of the escherichia coli BL21 (DE3) strain, according to gene design after multi-sequence alignment, a prokaryotic expression vector escherichia coli is used, and large-scale expression and purification of the three-type antifreeze protein of the nematodes fish are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for preparing type III antifreeze protein of Stichaeidae fish based on Escherichia coli strains. Background Art

[0002] Lumpenus fabricii belongs to the genus Lumpenus of the family Stichaeidae in the order Perciformes, and is a cold-water fish distributed in the Arctic region. Fishes of the family Stichaeidae are mainly distributed in the cold-temperate waters of the Northern Hemisphere, concentrated in the continental shelves and adjacent deep-sea areas of the North Atlantic and the North Pacific. In the North Atlantic, its distribution covers the cold-water environments of the Barents Sea, the Norwegian Sea to the Labrador Sea, and the habitat depth extends from the intertidal zone to the continental slope more than 500 meters, and the bottom substrate is mostly a mixed area of sand, mud or gravel, and the water temperature is often lower than 10°C. In the North Pacific, its distribution is centered on the Bering Sea and the Sea of Okhotsk, and is common in the shallow continental shelves to the deep-sea plains covered by seasonal sea ice. Some populations are adapted to the intertidal seaweed beds or cold-water coral reef ecosystems. Specialized populations also exist in isolated seas such as the eastern coast of Greenland and the Chukchi Sea within the Arctic Circle, relying on low temperatures (-1.8 to 5°C) and high salinity (30 to 35‰) environments for survival. Lumpenus fabricii has a wide range of habitats, including the eastern part of the Barents Sea to the western part of Greenland, the southeastern part of Alaska in the Pacific Ocean and the northern part of the Sea of Okhotsk, and the coastal areas of Nova Scotia, Canada in the western Atlantic. To adapt to the polar environment with year-round low temperatures, Lumpenus fabricii has formed antifreeze proteins (AFPs) during the process of evolution. These proteins can significantly reduce the damage of ice crystals to organisms through mechanisms such as regulating ice crystal morphology and inhibiting recrystallization.

[0003] Antifreeze proteins in fish can be divided into five categories: type I, type II, type III, type IV and antifreeze glycoproteins (AFGPs). Since the discovery of antifreeze proteins, they have not only played an important role in the physiological research of fish adapting to cold environments, but also shown broad application prospects in many fields such as industrial antifreeze agents and cryopreservation due to their unique antifreeze mechanisms. Research shows that the antifreeze proteins produced by organisms play an important role in the field of low-temperature applications. Because of their non-toxicity, biodegradability and low production cost, they are receiving increasing attention. At present, industrially synthesized antifreeze agents are still the mainstream choice for low-temperature applications, but they have a greater impact on the environment and there are potential ecological safety problems. In contrast, achieving the efficient and low-cost production of antifreeze proteins through microbial technology can not only promote their wide application in biomedical, industrial antifreeze and other low-temperature application fields, but also reduce the impact on the environment and provide a better solution for sustainable development.

[0004] The E. coli and pET-28a plasmid expression system has the advantages of high efficiency, stability, and low cost. The system relies on T7 promoter drive and IPTG induction to achieve high-level protein expression in a short time. The pET-28a vector comes with a His-tag for easy purification, and the lac repressor controls expression to reduce background leakage, making it suitable for the preparation of soluble proteins and inclusion body proteins. At the same time, kanamycin resistance screening improves plasmid stability, and the BL21 (DE3) host strain optimizes expression efficiency, making it widely used in basic research, protein engineering, and biomedicine, providing an important foundation for efficient and low-cost protein production. Summary of the invention

[0005] In view of the above problems, the present invention provides a method for preparing type III antifreeze protein of Pleuronectinidae fish based on Escherichia coli BL21 (DE3) strain, so as to achieve the expression and purification of type III antifreeze protein of Pleuronectinidae fish.

[0006] The present invention is achieved through the following technical solutions:

[0007] A gene encoding a type III antifreeze protein of a fish of the family Pseudocercidae, wherein the nucleotide sequence of the gene is shown as SEQ ID NO.2.

[0008] Furthermore, the fish of the family Blenniidae is the spotted-fin blenny.

[0009] A recombinant expression vector is obtained by recombining the above-mentioned nucleotide sequence and the expression vector.

[0010] Furthermore, the expression vector is pET-28a.

[0011] A method for preparing type III antifreeze protein of breccia fish comprises the following steps:

[0012] (1) constructing the above-mentioned nucleotide sequence into the expression vector pET-28a to obtain a recombinant plasmid;

[0013] (2) The recombinant plasmid was transformed into the Escherichia coli BL21 (DE3) strain, cultured in liquid, induced to express, the bacterial liquid was collected, extracted and purified, and the type III antifreeze protein of the family Pseudocercidae was obtained.

[0014] Furthermore, in step (2), the conditions for inducing expression are: 600 When the absorbance is 0.6-0.8, add 0.5-1.0 mol / L IPTG and induce for 8-12 hours at a temperature of 32-37°C and a rotation speed of 150-200 rpm / min.

[0015] Furthermore, in step (2), the purification is performed using a nickel ion exchange column.

[0016] Application of a type III antifreeze protein of a Pholidae fish as described above in aspects such as an antifreeze agent and cryopreservation at low temperature.

[0017] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:

[0018] 1. The antifreeze protein expressed and purified based on the Escherichia coli BL21(DE3) strain in the present invention, according to the gene design after multiple sequence alignments, realizes the large-scale expression and purification of the type III antifreeze protein of Pholidae fish by using the prokaryotic expression vector Escherichia coli. The method of the present invention is simple and intuitive, the preparation conditions are simple, the expression effect is good, and it is easy to scale up production.

[0019] 2. The antifreeze protein obtained in the present invention has high purity. By purifying the expressed protein using a nickel ion exchange column, an antifreeze protein with a recrystallization inhibition effect can be effectively purified, providing a basis for purifying an antifreeze protein with a recrystallization inhibition effect in the future.

[0020] 3. It can be seen from the ice crystal structure experiment that the antifreeze protein purified in the present invention shows good antifreeze effects in inhibiting ice crystal growth. Applying this antifreeze protein to fields such as industrial antifreeze agents and cryopreservation at low temperature has good practical application value. Description of the Drawings

[0021] Figure 1 It is a phylogenetic tree diagram of the antifreeze protein gene in Example 1.

[0022] Figure 2 It is a plasmid map of pET-28a constructed in Example 1.

[0023] Figure 3 It is a gel diagram of verifying the plasmid with the universal primer in Example 1.

[0024] Figure 4 It is a sequence alignment diagram of verifying the plasmid with the universal primer in Example 1.

[0025] Figure 5 It is a purification result diagram of the antifreeze protein of Lumpenus fabricii in Example 1.

[0026] Figure 6 It is an ice crystal structure diagram of the experimental group and the control group in Example 2. Detailed Embodiments

[0027] The present invention will be further described in detail below through examples. These examples are only used to illustrate the present invention and do not limit the protection scope of the present invention.

[0028] Determination of type III antifreeze protein

[0029] Through the phylogenetic tree analysis of the antifreeze protein gene (as Figure 1As shown in [figure], the antifreeze protein prepared in the present invention is more closely related to other verified type III antifreeze proteins, indicating that this antifreeze protein should be a type III antifreeze protein. Figure 1 In [figure], type I is type I antifreeze protein, type II is type II, type III is type III, type IV is type IV, AFGP is antifreeze glycoprotein (AFGPs), insert type is the antifreeze protein gene found in insects, and the antifreeze protein gene used in the present invention is numbered Lfa08G001200.

[0030] Example 1 Expression and purification of type III antifreeze protein from Lumpenus sagittaformis with recrystallization inhibition in Escherichia coli

[0031] The strains, main instruments and reagents involved in the following experiments include:

[0032] Experimental strain: Escherichia coli BL21(DE3)

[0033] Main instruments: constant temperature incubator, constant temperature shaker, high-speed floor centrifuge, high-pressure cell disruptor, electrophoresis apparatus, shaker, spectrophotometer, PCR instrument

[0034] Main reagents: 1 mol / L isopropyl-β-D-thiogalactoside (IPTG), 1 mol / L kanamycin solution, New Saimi 15% ExpressCast PAGE Color Gel Fast Kit, protease inhibitor, Ni-TED 6FF (His-Tag) protein agarose purification resin (nickel ion exchange column), imidazole elution buffer with different concentrations, Coomassie Brilliant Blue staining solution, Coomassie Brilliant Blue indicator.

[0035] The nucleotide sequence (SEQ ID NO.1) of the type III antifreeze protein gene of Lumpenus sagittaformis in the present invention is as follows:

[0036] ATGAGTACAATGAAAGACGTGGTGGCCACCCAGCTGATCCCCATAAATACTGCCCTGACTCCGATAATGATGAAGGCGGAGAAGGGCGACCCAAAGGGCATCCCCGCCGAGGACATGTCCAAAATAGTGGGAAAGCTAGTGAACAGGGCAGTGGCGAAGGACGCAACCCTCATGCCAGAGATGGTGAATGGCTACCCGTAGTTCTAA

[0037] The present invention uses genetic engineering means to optimize the codons of the gene according to the expression preference of Escherichia coli without changing the amino acid sequence of the type III antifreeze protein of Lumpenus sagitta, and obtains a nucleotide sequence. The type III antifreeze protein gene of Lumpenus sagitta is artificially synthesized, and the nucleotide sequence of this gene (SEQ ID NO.2) is as follows:

[0038] ATGAGCACCATGAAAGGTGTTGTTGCAAATCAGCTGATTCCGATTAATACCGCACTGACCCTGGTTATGATGCGTGTTGGTGATGTTATTCTGACCGGTATTCCGGAAAAAGATATTCCGCGTCTGGTTGGTATGCAGGTTAATCGTGAAGTTCTG ATGAATACCACCCTGATGCCGGATATGGTTAAAGGTTATAAAAAA

[0039] The synthesized antifreeze protein gene is cloned into the Escherichia coli expression vector pET-28a to obtain a recombinant plasmid (the constructed pET-28a plasmid map is shown in Figure 2 ). The recombinant plasmid is transformed into Escherichia coli BL21(DE3) strain, cultured in liquid, induced to express, the bacterial liquid is collected, extracted and purified to obtain the type III antifreeze protein of Lumpenus sagitta.

[0040] Figure 2 The recombinant expression vector pET-28a(+) of the antifreeze protein gene contains a T7 strong promoter (T7 promoter), the antifreeze protein gene 1200, a Lac lactose operon (for inducing protein expression using isopropyl thiogalactoside IPTG), a kanamycin resistance gene (KanR, for screening Escherichia coli BL21(DE3) with successfully transformed recombinant plasmids), and a hexahistidine tag (6×His tag, for subsequent purification of the protein).

[0041] The preparation of the type III antifreeze protein of Lumpenus sagitta specifically includes the following steps:

[0042] (1) Use the pET-28a plasmid between the NotI and BamHI restriction enzyme sites of the synthesized antifreeze protein gene, transform it into Escherichia coli BL21(DE3) strain, and streak on a TSA plate with kanamycin resistance to obtain single colonies of the strain.

[0043] (2) Use PCR to detect the transformed colonies. Use universal primers to perform PCR amplification on the single colonies cultured after transformation. The required primer sequences are as follows:

[0044] T7-F: CTAAGTAACATAAGGAGAAGGAGAA;

[0045] T7-R: CTAAGGAAAAAAGAAAAACTGA.

[0046] (3) The PCR reaction amplification system of the above primer pair is as follows:

[0047]

[0048] (4) The above PCR amplification reaction procedure is as follows:

[0049]

[0050] (5) Perform agarose gel electrophoresis on the above PCR amplified fragment

[0051] The specific steps are as follows:

[0052] ① Gel preparation (2%): Heat the Erlenmeyer flask containing 25 mL of 1×TAE buffer and 0.25 g of agarose in a microwave oven until boiling, and shake well until there are no particles.

[0053] ② Pour the gel: First place the gel plate, insert the comb, and then pour the gel. After the gel cools to about 60 °C (not hot to the touch), add the dye (60 mL of gel and 6 μL of GelRed) and slowly pour it into the electrophoresis tank. After the gel solidifies, remove the comb.

[0054] ③ Loading: 10 μL of the PCR sample (place the sample well at the negative electrode end, i.e., black to black, red to red).

[0055] ④ Electrophoresis: Electrophorese at 100 V under constant voltage conditions and stop electrophoresis when the bromophenol blue moves to near 2 / 3 of the gel (about 30 min).

[0056] (6) Observe the results: Observe on an ultraviolet analyzer. If there is a target band at 500 bp ( Figure 3 ) then the single colony used is successfully transformed with the pET-28a(+) plasmid carrying the gene. Send the remaining PCR product for sequencing, and compare the returned amino acid sequence with the amino acid sequence translated from the original nucleotide sequence ( Figure 4 ) If the comparison results are consistent, it indicates that the product during the expression of the transformed plasmid is the required protein amino acid sequence.

[0057] Figure 3 The agarose gel electrophoresis diagram after PCR using Escherichia coli with successfully transformed recombinant plasmid as the gene amplification template. Among them, the 1200 band is the PCR band of Escherichia coli BL21(DE3) with successfully transformed plasmid, indicating that the plasmid transformed into this Escherichia coli BL21(DE3) carries the correct antifreeze protein gene.

[0058] Figure 4The sequencing results returned by the sequencing company were translated into amino acid sequences, which were compared with the amino acid sequences translated from the original antifreeze protein sequences. The comparison results were consistent, indicating that the plasmid carried the correct antifreeze protein gene.

[0059] (7) The induction expression system of the above colonies:

[0060] 1.5 mL of 1 mol / L IPTG

[0061] 1.5 L of TSB liquid colony medium with kanamycin resistance.

[0062] (8) The induction expression steps of the above colonies:

[0063] ① Pre-induction culture: Transfer the single colony to the TSB liquid medium with kanamycin resistance, and the culture conditions are as follows: 37 °C, 200 rpm / min;

[0064] ② Induction: Use a spectrophotometer to measure the bacterial liquid cultured in ① until OD 600 = 0.6 - 0.8, and add 1 mol / L IPTG at a ratio of 1:1000. The culture conditions are as follows: 37 °C, 200 rpm / min, 12 h.

[0065] (9) The separation and purification steps of the above protein:

[0066] ① Disruption: Add protease inhibitor, and use a high-pressure cell disruptor (cool to below 10 °C before use) to disrupt for 2 - 3 min

[0067] ② Centrifugation: Centrifuge at 8000 rpm / min for 10 min, and retain the supernatant;

[0068] ③ Incubation: Add the supernatant retained in step ② to an elution column with Ni-TED 6FF (His-Tag) protein agarose purification resin, incubate at 4 °C by inverting for 1 h, wait for the supernatant to drip naturally, and let all of it flow out of the elution column. Elute once, collect the supernatant flow-through, incubate again by inverting for 15 min, and wait for the supernatant to drip naturally;

[0069] ④ Elution: Use elution buffers containing different concentrations of imidazole (imidazole concentrations are 20 / 40 / 60 / 80 / 100 / 300 / 500 mmol / L) for elution in turn. Add 2 mL of elution buffer each time, incubate for 3 min, let the elution buffer drip naturally, collect the elution buffer and pipette 90 μL of the elution buffer, add 10 μL of Coomassie Brilliant Blue indicator. If it turns blue after mixing, continue to elute with the corresponding concentration of imidazole elution buffer until the color of the elution buffer does not change after adding the Coomassie Brilliant Blue indicator;

[0070] The preparation of eluents with different concentrations is as follows: Weigh 12.114 g of tris (hydroxymethyl) aminomethane (Tris), 17.55 g of sodium chloride, and 1.36 / 2.72 / 4.08 / 5.44 / 6.8 / 20.4 / 34 g of imidazole per liter of eluent. After complete dissolution, adjust the pH value to 8.0 using concentrated sodium hydroxide solution and concentrated hydrochloric acid solution.

[0071] (10) Perform sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) electrophoresis on the above protein purification results. The steps are as follows:

[0072] ① Gel preparation (New Cell 15% ExpressCast PAGE Color Gel Rapid Kit): Prepare 15% ExpressCast PAGE color gel according to the instructions.

[0073] ② Pouring the gel: After preparing the lower layer gel for 15 minutes, prepare the upper layer gel, insert the comb, and wait for the gel to solidify after 15 minutes. Then remove the comb.

[0074] ③ Loading samples: 10 μL of the purified protein sample (i.e., black to black, red to red).

[0075] ④ Electrophoresis: Electrophorese at a constant voltage of 90 V and stop electrophoresis (60 minutes) when the indicator moves close to the bottom of the glass gel plate.

[0076] ⑤ Observation of results: Stain with Coomassie Brilliant Blue. There is a clear band near 10 kDa indicated by the protein marker and the content of protein bands of other sizes is relatively low (see Figure 5 ), indicating that the purity of the antifreeze protein in the obtained protein solution is relatively high, that is, the required antifreeze protein is successfully purified.

[0077] Figure 5 The thicker band in the figure is the antifreeze protein band. It can be seen that the antifreeze protein band (near 10 kDa, the red frame in the figure) is extremely obvious after purification, the content of other impurity proteins is less, and the purity of the purified antifreeze protein is relatively high.

[0078] Example 2 Detection of the antifreeze effect of antifreeze protein

[0079] Perform an ice crystal structure test on the antifreeze protein obtained in the experiment of Example 1 to detect the antifreeze effect of the antifreeze protein. The ice crystal structure experiment is divided into a control group: eluent; and an experimental group: 1 mg / mL antifreeze protein (the solvent is the eluent).

[0080] The eluent is prepared by weighing 12.114 g of tris (hydroxymethyl) aminomethane (Tris) and 17.55 g of sodium chloride per liter of eluent. After complete dissolution, adjust the pH value to 8.0 using concentrated sodium hydroxide solution and concentrated hydrochloric acid solution.

[0081] Add 10 μL of the control group and experimental group solutions onto the glass slide, place a coverslip, and place dry ice near the slide to slowly freeze the solution between the two clean slides. Observe the ice crystal morphology of each solution under a biological microscope and take pictures.

[0082] Experimental results of ice crystal structure( Figure 6 ) show that compared with the experimental group, the ice crystal structure of the control group is sharper and larger in volume, so it is more likely to cause damage to organisms. In addition, within the same time, the ice crystal formation rate of the experimental group is significantly slower than that of the control group, further indicating that the purified antifreeze protein exhibits good antifreeze effects in inhibiting ice crystal growth. It is expected to apply this antifreeze protein to fields such as industrial antifreeze agents and cryopreservation at low temperatures.

[0083] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A gene encoding a type III antifreeze protein of the family Stichaeidae, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The gene encoding the type III antifreeze protein of the family Stichaeidae according to claim 1, characterized in that, The fish of the family Stichaeidae is Lumpenus lampretaeformis.

3. A recombinant expression vector, characterized in that, The recombinant expression vector is obtained by recombination of the nucleotide sequence described in claim 1 and an expression vector.

4. The recombinant expression vector according to claim 3, characterized in that, The expression vector is pET-28a.

5. A preparation method of a type III antifreeze protein of a fish of the family Stichaeidae, characterized in that, It includes the following steps: (1) The nucleotide sequence described in claim 1 is constructed and introduced into the expression vector pET-28a to obtain a recombinant plasmid. (2) The recombinant plasmid is transformed into Escherichia coli BL21(DE3) strain, cultured in liquid, induced for expression, the bacterial liquid is collected, extracted and purified to obtain the type III antifreeze protein of the fish of the family Stichaeidae.

6. The preparation method of the type III antifreeze protein of the family Stichaeidae fish according to claim 5, wherein In step (2), the conditions for induced expression are: when the OD of the bacterial solution 600 absorbance is 0.6 - 0.8, add 0.5 - 1.0 mol / L IPTG, and induce for 8 - 12 h under the conditions of a temperature of 32 - 37 °C and a rotation speed of 150 - 200 rpm / min.

7. The preparation method of the type III antifreeze protein of Pholidae fish according to claim 5, characterized in that, In step (2), the purification is carried out by using a nickel ion exchange column.

8. Use of the type III antifreeze protein of the fish of the family Stichaeidae as described in claim 1 as an antifreeze agent and for cryopreservation at low temperature.

Images