Populus tomentosa salt-tolerant RHB1A gene and application thereof

Abstract

The invention provides a populus tomentosa salt-tolerant RHB1A gene and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the populus tomentosa salt-tolerant gene RHB1A provided by the invention is as shown in SEQ ID NO.1, and the amino acid sequence coded by the populus tomentosa salt-tolerant gene RHB1A is as shown in SEQ ID NO.2. According to the invention, the E3 ubiquitin ligase RHB1A is screened, the full-length CDS sequence of the E3 ubiquitin ligase RHB1A is cloned, the salt tolerance of the plant is obviously improved by overexpressing the RHB1A gene in the populus tomentosa plant, and a theoretical support is provided for cultivating and vigorously popularizing salt-tolerant forest varieties.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a Populus tomentosa RHB1A gene and its application. Background Art

[0002] Forestry is an important industry of the national economy, and forests are major strategic resources for the sustainable use of the country. Poplar is an important timber forest and shelter forest tree species in China, and is also an important tree species for afforestation and greening. During its growth process, it will be subjected to various abiotic stresses, such as cold stress, drought stress, salt stress, etc. These stresses will seriously affect the growth and development of woody plants. Effectively utilizing saline-alkali land for afforestation can not only maximize the utilization rate of land resources, but also be of great significance for achieving the goals of carbon peak and carbon neutrality.

[0003] Ubiquitination modification not only affects the stress resistance of plants and is related to plant response to abiotic stresses, but also affects the disease resistance of plants and plays an important role in participating in biotic stress regulation. In recent years, research has shown that E3 ubiquitin ligase plays a crucial role in plant salt stress tolerance.

[0004] Therefore, how to clone the key genes encoding salt response and verify their related functions to improve the salt stress tolerance of poplar is an important problem that needs to be solved urgently by those skilled in the art. Summary of the Invention

[0005] The purpose of the present invention is to provide a Populus tomentosa salt response gene for improving the tolerance of poplar under salt stress.

[0006] In order to achieve the above invention purpose, the present invention provides the following technical solutions: The present invention provides a Populus tomentosa RHB1A gene, and the nucleotide sequence of the RHB1A gene is shown in SEQ ID NO.1.

[0007] The present invention also provides an E3 ubiquitin ligase encoded by the Populus tomentosa RHB1A gene, and the amino acid sequence of the E3 ubiquitin ligase is shown in SEQ ID NO.2.

[0008] The present invention also provides an expression vector, including the Populus tomentosa RHB1A gene.

[0009] Preferably, the expression vector is an overexpression vector.

[0010] The present invention also provides a recombinant bacterium, including the RHB1A gene or the expression vector.

[0011] The present invention also provides the Populus tomentosa as described above. RHB1A Application of the gene, the E3 ubiquitin ligase, the expression vector or the recombinant bacterium as described above in regulating the salt tolerance of Populus tomentosa.

[0012] Preferably, the method for regulating the salt tolerance of Populus tomentosa is overexpressing the RHB1A gene in Populus tomentosa plants.

[0013] Preferably, the salt tolerance characteristics are promoting Na + efflux, upregulating the relative water content of leaves, reducing the malondialdehyde content, and downregulating the conductivity.

[0014] The present invention first discovers an E3 ubiquitin ligase gene responsive to salt stress RHB1A , and clones its full-length CDS sequence. Using the overexpression vector of the RHB1A gene constructed, the RHB1A gene is overexpressed in Populus tomentosa, endowing Populus tomentosa plants with stronger salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is RHB1A the transgenic identification result; Figure 2 is the phenotypic result after the control group and the experimental group are treated with NaCl; Figure 3 is the measurement result of physiological indexes of Na + content (A), conductivity (B), relative water content (C), and malondialdehyde content (D) in the leaves of the control group and the experimental group. DETAILED DESCRIPTION OF THE INVENTION

[0016] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0017] Example 1

[0018] Obtain the CDS sequence of the Populus tomentosa RHB1A gene The nucleotide sequence is shown in SEQ ID NO.1: ATGGGAGGTTGCTGTTGTTCTTCAAGGAAACCTCATTTACACGGAACGCCCGTGTATTACTATTGTCCACCAGCTTTGGAAGAGCATGGATCCTTAACGTCTCACAACGGCGCGGCCTCTGCATTCACTGCAGGTCTCCTGGTCGAATTGCATTTGAATACATCAACGCCTGATACTTTCCGCCCCCCTCCTGCACCTCTGCCATATGATGTGATTTTGGGATGTCCACAGTCACCGTATTCTGAATCTGTTCAAGAAACAATTAGTCGCAGTAGTTTTGGAACGTTGGCAATGAGTGAAGATCTTGATGAATTGGACTGCAAAACTCAAGCCAGTTCATTGCTTGTCTCTCCAAGGAAGTCAGAAGTGACAAAATTACATGAACCTGTTGCGTCCGCAACAGAAGAGGAAGATGCTTGTCCCATTTGCCTTGAAGAATATGACTTGGAGAATCCAAAACACATAACAAACTGCGAACATCATTTTCACCTCTCCTGCATTCTAGAGTGGATGGAAAGGAGTGACACCTGCCCCATATGTGACCAGGAAGTAATATTGACCACAACTTCATTTAGTTGTTGTTAA。

[0019] The amino acid sequence is shown in SEQ ID NO.2 MGGCCCSSRKPHLHGTPVYYYCPPALEEHGSLTSHNGAASAFTAGLLVELHLNTSTPDTFRPPPAPLPYDVILGCPQSPYSESVQETISRSSFGTLAMSEDLDELDCKTQASSLLVSPRKSEVTKLHEPVASATEEEDACPICLEEYDLENPKHITNCEHHFHLSCILEWMERSDTCPICDQEVILTTTSFSCC*。

[0020] Take healthy Populus tomentosa plants, extract Populus tomentosa RNA using the BIOFIT kit, and then reverse transcribe the RNA to obtain cDNA using the reverse transcription kit of Yeasen Biotech Co., Ltd. Using the cDNA as a template, perform PCR amplification with overexpression primers (procedure: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 15 s; annealing at 55°C for 5 s; extension at 72°C for 20 s; 34 cycles; 72°C for 1 min).

[0021] Populus tomentosa RHB1A Gene overexpression primer + vector ligation primer F (SEQ ID NO.3): ACTCGAGGGGGATCCCCAATACTTGTATGGATGGGAGGTTGCTGTTGTT (add Xcm I restriction site and recombinant homologous fragment on the vector based on the overexpression primer). Populus tomentosa RHB1A gene overexpression primer + vector ligation primer R (SEQ ID NO.4): TTCGCTAGTGGATCCCCAATACTTGTATGGTTAACAACAACTAAATGAAGTTGT (add Xcm I restriction site and recombinant homologous fragment on the vector based on the overexpression primer).

[0022] Perform PCR amplification using cDNA as a template and recover the product.

[0023] In this experiment, use the pCXSN vector, digest it with XcmI restriction endonuclease, and recover the vector backbone. Ligate it with the PCR-recovered product, transfer it into DH5α Escherichia coli, and screen it on a resistant medium (LB solid medium containing 50 mg / L kanamycin) to construct an overexpression vector containing RHB1A the full-length CDS.

[0024] Pick positive Escherichia coli colonies, extract plasmids, and verify the correct sequence.

[0025] Transform the plasmid into Agrobacterium tumefaciens GV3101 strain and screen it on a resistant medium (LB solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin). Pick positive strains for enlarged culture and preservation.

[0026] Dispense the enlarged culture of Agrobacterium strain into 50 mL sterile centrifuge tubes, centrifuge at 5000 rpm for 10 min in a centrifuge, discard the liquid in the tubes, retain the bacterial cells, and add 20 mL of pre-prepared WPM solution to the centrifuge tubes to obtain a resuspended bacterial solution for standby.

[0027] Take young and tender leaves of Populus tomentosa at about 1 month old for infection to obtain overexpression lines.

[0028] The infection process is as follows: 1. Select the young leaves on the top of the sterile seedlings and cut them into 0.5×0.5 cm squares on a clean bench. 2 Put the small pieces of bacteria into the resuspended bacterial solution and infect for 15 min, shaking the bacterial solution every 3 min.

[0029] 2. Carefully pick up the infected material with tweezers and place it on a plate containing sterile filter paper to absorb the bacterial solution. Spread the leaves with the back facing down on WPM co-cultivation medium and culture in the dark in a 28°C incubator for 2 days.

[0030] 3. After 2 days, transfer the transformed explants to WPM selection medium and culture in a dark incubator at 25°C for 15 days.

[0031] 4. When loose white callus tissue appears around the leaves, move it to WPM budding medium and induce budding in a light incubator at 25°C and 10,000 Lux for about 4 to 5 weeks, and replace the medium every 15 days.

[0032] 5. When the adventitious buds grow to 3-4 cm, cut them off and transfer them to WPM rooting medium. After the seedlings take root, take leaves to identify positive plants, transfer the positive seedlings to soil for culture, and then process them.

[0033] Example 2

[0034] The normal control group (WT) and transgenic lines (RHB1A-OE-1, RHB1A-OE-11) were selected for RNA extraction and reverse transcription into cDNA, and qPCR detection was performed using Populus tomentosa UBQ as the internal reference primer. RHB1A The expression level of the gene.

[0035] qPCR primers, all primer sequences below are in the 5'-3' direction: Table 1 qPCR primers Q-PtoRHB1A-F CGGAACGCCCGTGTATTACT SEQ ID NO.5 Q-PtoRHB1A-R TGCAATTCGACCAGGAGACC SEQ ID NO.6 Q-PtoUBQ-F CCAAGCCCAAGAAGATCAAGC SEQ ID NO.7 Q-PtoUBQ-R GCACCGCACTCAGCATTAGG SEQ ID NO.8 The results are as follows Figure 1 As shown. Figure 1 As can be seen from the figure, compared with the normal control group, the overexpression transgenic lines RHB1A The gene expression level was significantly higher than that of the normal control group, indicating that the overexpression transgenic strain was successfully constructed.

[0036] Example 3

[0037] The wild-type (WT) and overexpression (RHB1A-OE-1) lines with the same growth after rooting were moved to the greenhouse for one month and then treated with salt after the growth stabilized. Phenotypic observation after salt treatment showed that the leaf wilting degree of the overexpression plants was low ( Figure 2 ), and the tolerance to salt stress was stronger than that of WT plants.

[0038] The salt treatment method is as follows: Add 300 mM NaCl solution to the tray to submerge the small pots containing the plants. After the plants show wilting phenotypes, observe and take pictures.

[0039] Determine the relevant physiological indexes of the two. The results show that compared with WT plants, the Na + content in the overexpression lines decreases by 30% ( Figure 3 A), the conductivity decreases by 85% ( Figure 3 B), the relative water content of the leaves increases by 10% ( Figure 3 C), and the malondialdehyde (MDA) content decreases by 60% ( Figure 3 D). The above results confirm that RHB1A the gene is a key gene responding to salt stress.

[0040] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A Populus tomentosa RHB1A gene, characterized in that The said RHB1A The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The E3 ubiquitin ligase encoded by the Populus tomentosa RHB1A gene according to claim 1 ， Characterized in that the amino acid sequence of the E3 ubiquitin ligase is as shown in SEQ ID NO.

2.

3. An expression vector, characterized in that ， including the Populus tomentosa described in claim 1 RHB1A gene 4. The expression vector according to claim 3, characterized in that The expression vector is an overexpression vector.

5. A recombinant bacterium, characterized in that, Comprising the gene according to claim 1 or the expression vector according to claim 3 or 4. RHB1A ​ 6. Use of the Populus tomentosa RHB1A gene according to claim 1, the E3 ubiquitin ligase according to claim 2, the expression vector according to claim 3 or 4, or the recombinant bacterium according to claim 5 in regulating the salt tolerance of Populus tomentosa.

7. The application according to claim 6, characterized in that, The method for regulating the salt tolerance of Populus tomentosa is to overexpress the RHB1A gene in Populus tomentosa plants.

8. The application according to claim 7, characterized in that The salt tolerance characteristics are to promote Na + efflux, up-regulate the relative water content of leaves, reduce the malondialdehyde content, and down-regulate the electrical conductivity.

Images