Plant lepidoptera pest resistance related gene GSTF2 and application thereof

The Arabidopsis GSTF2 gene regulates plant resistance and promotes the degradation of RPX1 protein, solves the problem of drug resistance of rhodoptera moth, improves the resistance of plants to lepidoptera pests, and is used in crop breeding and pest drug development.

CN120290602APending Publication Date: 2025-07-11ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510444304.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

Diamondworm has extensive resistance to chemical insecticides, traditional pest management methods are ineffective, and its intestinal flora is closely related to drug resistance, and the existing technology is difficult to effectively improve the resistance of plants to Diamondworm.

Method used

Using the Arabidopsis GSTF2 gene, the resistance of plants to Lepidopteran pests is regulated by overexpression or deficiencies, and the degradation of RPX1 protein is promoted to enhance insect resistance.

Benefits of technology

The Arabidopsis GSTF2 gene can significantly improve its resistance to diamondback moth, provide new crop breeding research ideas, provide genetic reference for insect-resistant breeding of crops such as rapeseed, corn, rice, sorghum, and can be used to prepare drugs to prevent and control Lepidoptera pests.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290602A_ABST
    Figure CN120290602A_ABST
Patent Text Reader

Abstract

The invention discloses a plant anti-lepidoptera pest related gene GSTF2 and application thereof, and relates to the technical field of gene engineering, the GSTF2 gene is derived from arabidopsis thaliana, the nucleotide sequence of the GSTF2 gene is as shown in SEQ ID NO.1, and the amino acid sequence of encoded protein is as shown in SEQ ID NO.2. The invention proves that the arabidopsis thaliana GSTF2 gene can mediate RPX1 to resist plutella xylostella for the first time, and participates in pest resistance by promoting degradation of RPX1 protein, so that the gene can be used for resisting lepidoptera pests. As a new insect-resistant gene of a model plant, the arabidopsis thaliana GSTF2 gene has high reference value and significance, and provides a new research idea for insect-resistant breeding of economic crops such as oilseed rape, corn, rice and sorghum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a gene GSTF2 related to plant resistance to Lepidoptera pests and its application. Background Art

[0002] As one of the most destructive migratory Lepidoptera pests in cruciferous vegetables globally, Plutella xylostella poses a serious threat to agricultural production. With its strong migratory ability and environmental adaptability, this pest is widely distributed worldwide and has caused huge economic losses to cruciferous vegetables.

[0003] In recent years, with the widespread use of chemical and new biological insecticides, the problem of insecticide resistance in Plutella xylostella has become increasingly prominent. Due to the migratory characteristics of Plutella xylostella, its insecticide-resistant genes spread rapidly among different regions, resulting in varying degrees of resistance to almost all insecticides. This resistance not only renders traditional pest management methods ineffective but also poses new challenges to agricultural production. In addition to chemical insecticides, the gut microbiota of Plutella xylostella has also been found to be closely related to its insecticide resistance. Studies have shown that the gut microbiota of Plutella xylostella can mediate its resistance to insecticides, further increasing the difficulty of pest management. Moreover, the detoxification of Plutella xylostella has also received extensive attention. Research reports have shown that the uridine diphosphate-glucuronosyltransferase (UGTs) of Plutella xylostella plays a potential function in insecticide resistance, which may be another important mechanism for Plutella xylostella to develop resistance to insecticides.

[0004] Facing the problem of insecticide resistance in Plutella xylostella, traditional pest management methods relying on insecticides can no longer meet the needs of current agricultural production. Therefore, exploring natural plant insect-resistant genes and cultivating crop varieties with insect resistance have become important research directions in the current field of crop breeding. Summary of the Invention

[0005] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide a gene GSTF2 related to plant resistance to Lepidoptera pests and its application.

[0006] The present invention achieves the above purpose through the following technical solutions:

[0007] The present invention provides a gene GSTF2 related to plant resistance to Lepidoptera pests. The GSTF2 gene is derived from Arabidopsis thaliana, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0008] The present invention also provides the encoded protein of the GSTF2 gene as described above. The amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0009] The present invention also provides the application of the GSTF2 gene as described above in regulating plant resistance to Lepidoptera pests.

[0010] As a further optimized solution of the present invention, overexpression of the GSTF2 gene can improve the resistance of plants to Plutella xylostella, and loss of function of the GSTF2 gene can reduce the resistance of plants to Plutella xylostella.

[0011] As a further optimized solution of the present invention, the plants are Arabidopsis thaliana, rape, corn, rice and sorghum.

[0012] The present invention also provides the application of the GSTF2 gene or its encoded protein as described above in the preparation of drugs for controlling Lepidoptera pests.

[0013] As a further optimized solution of the present invention, the Lepidoptera pest is Plutella xylostella.

[0014] The present invention has the following beneficial effects:

[0015] The present invention for the first time proves that the Arabidopsis thaliana GSTF2 gene can mediate RPX1 resistance to Plutella xylostella and is involved in insect resistance by promoting the degradation of RPX1 protein. As a new insect-resistant gene in model plants, the Arabidopsis thaliana GSTF2 gene has high reference value and significance, providing a new research idea for insect-resistant breeding of economic crops such as rape, corn, rice and sorghum. Description of the Drawings

[0016] Figure 1 is the full-length amplification electrophoresis diagram of the GSTF2 gene;

[0017] Figure 2 is the comparison diagram of the expression levels of the GSTF2 gene in wild-type Arabidopsis thaliana Col-0 and the mutant gstf2;

[0018] Figure 3 is the graph of the weight change of Plutella xylostella after forced feeding with wild-type Arabidopsis thaliana Col-0, the mutant gstf2, and overexpressing transgenic lines 35Spro:GSTF2#1 and 35Spro:GSTF2#4 for different times;

[0019] Figure 4 is the comparison diagram of the pupation situation of Plutella xylostella after forced feeding with wild-type Arabidopsis thaliana Col-0, the mutant gstf2, and overexpressing transgenic lines 35Spro:GSTF2#1 and 35Spro:GSTF2#4;

[0020] Figure 5 is the experimental result graph of the RPX1 protein abundance. Detailed Embodiments

[0021] The present application will be further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] Unless otherwise specified, the methods used in this embodiment are conventional methods well-known to those skilled in the art. The reagents and other materials used, unless otherwise specified, are purchased commercially.

[0024] 2. Methods

[0025] 2.1 Cloning of Arabidopsis thaliana GSTF2 gene

[0026] Using Arabidopsis thaliana wild-type Col-0 variety as the material, total RNA was extracted, and the extracted total RNA was reverse-transcribed to synthesize the first strand of cDNA as the template for PCR amplification. Specific primers designed were used for amplification. The nucleotide sequences of the specific primers are as follows:

[0027] SEQ ID NO.3: GSTF2-F: 5'>ATGGCAGGTATCAAAGTTTTCGGA<3';

[0028] SEQ ID NO.4: GSTF2-R: 5'>TCACTGAACCTTCTCGGAAGCTG<3';

[0029] An amplified gene fragment of 639 bp (electrophoresis results are as Figure 1 shown) was ligated to the T-cloning vector PEASY-T3 simple vector to obtain the recombinant plasmid T3-GSTF2, which was then transformed into Escherichia coli. Positive clones were picked and sequenced. The sequencing results were consistent with the predicted results, obtaining the nucleotide sequence of the GSTF2 gene as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein as shown in SEQ ID NO.2, which belongs to the glutathione transferase of the GST phi class.

[0030] 2.2 Functional identification of Arabidopsis thaliana GSTF2 gene

[0031] 2.2.1. According to the nucleotide sequence of the GSTF2 gene, a homozygous mutant SALK_030186C (F181) of the Arabidopsis thaliana GSTF2 gene was ordered through the Arashare website, denoted as the mutant gstf2. The expression levels of the GSTF2 gene in the Arabidopsis thaliana wild type Col-0 and the mutant gstf2 were detected by qRT-PCR. Identification primers were synthesized according to the T-DNA primer identification method provided by the T-DNA Express website:

[0032] SALK_030186(F181):

[0033] SEQ ID NO.5: LP: 5'>TTGGTTTTCATATCGGTGAGC<3';

[0034] SEQ ID NO.6: RP: 5'>ATTTTTCCATCGAATTCCACC<3';

[0035] SEQ ID NO.7: LBb1.3: 5'>ATTTTGCCGATTTCGGAAC<3'.

[0036] Through the analysis of the flanking sequence sequencing results, the insertion of T-DNA into the 5' UTR of the GSTF2 gene led to a decrease in the expression level of the GSTF2 gene; the RT-PCR results showed (as Figure 2 shown) that compared with the Arabidopsis thaliana wild type Col-0, the expression level of the GSTF2 gene was significantly down-regulated in the mutant gstf2.

[0037] 2.2.2. Using genetic engineering methods, the GSTF2 gene was constructed onto the overexpression vector pCAMBIA1300 containing the 35S strong promoter to obtain the GSTF2 overexpression vector. The GSTF2 overexpression vector was transformed into Arabidopsis thaliana through Agrobacterium-mediated transformation to obtain the overexpression transgenic lines 35Spro:GSTF2#1 and 35Spro:GSTF2#4.

[0038] 2.2.3. The wild type Col-0, the gstf2 mutant, and the overexpression transgenic lines 35Spro:GSTF2#1 and 35Spro:GSTF2#4 that had grown under long-day conditions for two weeks were used to force-feed the second-instar larvae of Plutella xylostella. The body weights and pupation conditions of Plutella xylostella were counted. The counting results are as Figures 3 - 4 shown, from Figure 3 and Figure 4From the results of the forced feeding experiment, it can be seen that the body weight and pupation rate of Plutella xylostella fed with the gstf2 mutant were significantly higher than those of the control group Col-0, while the body weight and pupation rate of Plutella xylostella fed with the overexpressed transgenic lines 35Spro:GSTF2#1 and 35Spro:GSTF2#4 were significantly lower than those of the control group Col-0. This indicates that the Arabidopsis GSTF2 gene can significantly inhibit the growth and development of Plutella xylostella. The gstf2 mutant plants showed a sensitive phenotype to Plutella xylostella, while the GSTF2 overexpressed transgenic lines showed a resistant phenotype to Plutella xylostella, suggesting that the GSTF2 gene is a potential functional gene for Arabidopsis resistance to Plutella xylostella.

[0039] 2.3. Experiment on the abundance of RPX1 protein

[0040] Arabidopsis mutants with inactivated RPX1 protein can significantly improve their resistance to Plutella xylostella (Inactivation of RPX1 in Arabidopsis confers resistance to Plutella xylostella through the accumulation of the homoterpene DMNT. Plant Cell Environ. 2023 Mar;46(3):946 - 961.). Feeding and mechanical damage by Plutella xylostella can induce the degradation of RPX1 protein, thus rapidly responding to pest invasion and enhancing Arabidopsis resistance to Lepidoptera pests.

[0041] To study the mechanism of the GSTF2 gene's resistance to Plutella xylostella, in this invention, the RPX1 - GFP and GSTF2 genes were constructed into the pCAMBIA1300 vector containing the 35S strong promoter to obtain the RPX1 - GFP vector and the OE - GSTF2 vector. Using western blot experiments, the RPX1 - GFP vector was co - transformed into the protoplast cells of wild - type Col - 0 with EV (Empty Vector; the empty pCAMBIA1300 vector containing the 35S strong promoter) and the OE - GSTF2 vector respectively, and the protoplast system was used to observe the abundance of the RPX1 - GFP protein. The results showed that the abundance of the RPX1 - GFP protein in the protoplasts co - transformed with RPX1 - GFP and OE - GSTF2 was significantly lower than that in the protoplasts co - transformed with RPX1 - GFP and the empty vector (EV) (as Figure 5 shown), that is, overexpressing the GSTF2 gene can inhibit the abundance of the RPX1 protein, indicating that the function of GSTF2 is to degrade the RPX1 protein after responding to the defense signal triggered by insect feeding, thereby enhancing Arabidopsis resistance to the Lepidoptera pest Plutella xylostella.

[0042] 3. Conclusion

[0043] After the diamondback moth fed on the mutant gstf2 material, its body weight and pupation rate were significantly higher than those of the wild type Col-0. After the diamondback moth fed on the overexpressed transgenic 35Spro:GSTF2#1 and 35Spro:GSTF2#4 materials, its body weight and pupation rate were significantly lower than those of the wild type Col-0. Moreover, the mutant gstf2 material showed a sensitive phenotype to the diamondback moth, indicating that overexpression of the GSTF2 gene could significantly inhibit the growth and development of the lepidopteran pest diamondback moth, and the loss of function of the GSTF2 gene would reduce the resistance of Arabidopsis thaliana to the lepidopteran pest diamondback moth. The present invention also demonstrated through experiments on the abundance of RPX1 protein that the GSTF2 gene of Arabidopsis thaliana could mediate RPX1 to resist the diamondback moth and participate in insect resistance by promoting the degradation of RPX1 protein, and the overexpressed material of the GSTF2 gene had a toxic effect on the diamondback moth.

[0044] The above-described embodiments merely represent several implementation manners of the present invention, and the description thereof is relatively specific and detailed. However, it should not be construed as a limitation to the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A plant Lepidoptera pest resistance-related gene GSTF2, characterized in that, The GSTF2 gene is derived from Arabidopsis thaliana, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The coding protein of the GSTF2 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Use of the GSTF2 gene according to claim 1 in regulating the resistance of plants to Lepidoptera pests.

4. The application according to claim 3, characterized in that, Overexpression of the GSTF2 gene can improve the resistance of plants to Plutella xylostella, and loss of function of the GSTF2 gene can reduce the resistance of plants to Plutella xylostella.

5. The application according to claim 3, wherein The plants are Arabidopsis thaliana, rapeseed, corn, rice and sorghum.

6. Use of the GSTF2 gene according to claim 1 or its encoded protein in the preparation of a drug for controlling Lepidoptera pests.

7. The application according to claim 5, wherein The Lepidoptera pest is Plutella xylostella.