Annexin A2 gene knockout PK-15 cell line and construction method thereof
The construction of the ANXA2 gene knockout PK-15 cell line through CRISPR/Cas9 technology solves the problem of difficulty in precisely controlling knockdown levels and expression instability in the prior art, and achieves the reduction of ANXA2 protein expression and cell activity maintenance, providing an important tool for virological research.
Patent Information
- Application Number
- CN202510382664.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art has limitations that it is difficult to accurately control knockdown levels and expression instability when constructing ANXA2 gene knockout cell lines, which affects the accuracy and repeatability of virological research.
CRISPR/Cas9 technology was used to design sgRNA targeting exons 5 and 6 of the ANXA2 gene, and PK-15 cells were transfected through recombinant plasmids, and positive cells were obtained using puromycin screening, and monoclonal cells were screened and amplified to verify the gene knockout effect.
The PK-15 cell line with ANXA2 knockout was successfully constructed. Western blot and gene sequencing confirmed that the expression of ANXA2 protein was significantly reduced and the cell activity remained above 80%, providing a stable research tool.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of molecular biology and virology, and particularly to a PK-15 cell line with knockout of annexin A2 (ANXA2) gene constructed by using CRISPR / Cas9 technology and a method for constructing the same. Background Art
[0002] Annexin (Anx) is a class of Ca 2+ -dependent phospholipid-binding proteins that can reversibly bind to phospholipid membranes in the presence of Ca 2+ Annexin family is a large protein family, and its members are widely distributed in various tissues and cells of animals and plants. Among them, 12 most common annexins in vertebrates are named as subclass A. ANXA2 is one of the important members of the annexin family, which is widely distributed in various cells. It can exist in the cytoplasm, cell membrane, and intracellular vesicles, and can also appear in the nucleus. ANXA2 (36 kDa) usually binds to S100A10 (11 kDa) and exists in the form of a heterotetrameric complex (A2t), which is composed of two ANXA2 monomers and two p11 subunits in the form of homodimers. The four annexin repeats of ANXA2 are the membrane-binding sites of the protein, as well as the binding sites of actin, phospholipids, heparin, and Ca 2+ It can link different intracellular organelle membranes together in the form of binding and / or connection, thereby regulating the exchange of substances and signal transduction inside and outside the cell, and thus has a variety of biological functions and can participate in various biological processes such as signal transduction, apoptosis, and tumorigenesis and development.
[0003] In the process of studying the interaction between pathogenic microorganisms and host proteins, researchers found that ANXA2 can also participate in biological processes such as the invasion, replication, and release of a variety of viruses. In recent years, more and more studies have shown that ANXA2 participates in multiple links in the process of multiple virus infections and ultimately affects virus replication. For example, human papillomavirus, respiratory syncytial virus, and cytomegalovirus can utilize ANXA2 during cell attachment and penetration; in porcine reproductive and respiratory syndrome virus and porcine circovirus type 2, ANXA2 interacts with the B domain of Vimentin to promote virus replication; ANXA2 can also interact with Nsp9 of PRRSV, NS1 of avian influenza virus, and E2 glycoprotein of classical swine fever virus, thereby promoting virus replication in host cells; ANXA2 is also involved in the assembly and maturation process of measles virus; in addition, ANXA2 can bind to the capsid protein VP1 of enterovirus 71 and enhance virus infectivity, and can also interact with the non-structural protein 3D of enterovirus 71 to form a replication complex to promote virus replication.
[0004] The role of ANXA2 in virus infection has received increasing attention. Therefore, constructing an ANXA2 knockout cell line is of great significance for further exploring the interaction between the virus and the host ANXA2 protein. There are certain limitations in knocking down specific genes by siRNA in virological research, such as the difficulty in precisely controlling the knockdown level of specific genes, which affects the accuracy and repeatability of experimental results. Traditional gene knockout methods also have limitations such as a relatively random integration process and unstable expression levels. The recently emerging CRISPR / Cas9 technology is a currently efficient, convenient and precise gene editing technology. Cas9 with endonuclease activity specifically recognizes and binds to the target DNA under the guidance of sgRNA and cuts it. Then, through the cell's own repair mechanism, addition, deletion or replacement of specific genes can be achieved.
[0005] The PK-15 cell line selected in this invention is derived from porcine kidney tissue and is a commonly used mammalian cell model, which is widely used in the fields of virology, cell biology and molecular biology. Due to its good culture characteristics and high sensitivity to various viruses, PK-15 cells have become one of the important platforms for studying the interaction between viruses and host cells. Therefore, constructing an ANXA2 knockout PK-15 cell line has important scientific significance and application prospects and can be used as an important tool for studying the virus invasion mechanism. By comparing the differences between wild-type and knockout cell lines during virus infection, the specific mechanism of ANXA2 in virus invasion and replication can be more deeply understood, providing new theoretical and technical support for virological research, and having important scientific value and application prospects. Future research will further explore more applications of this cell line in the field of virology, providing more theoretical basis and technical support for virus prevention and treatment. Summary of the Invention
[0006] The purpose of this invention is to provide a method for constructing an ANXA2 gene knockout PK-15 cell line based on CRISPR / Cas9 technology and to verify its application value in virological research.
[0007] The method for constructing an ANXA2 gene knockout PK-15 cell line based on CRISPR / Cas9 technology in this invention is achieved through the following steps: (1) sgRNA design and synthesis: Obtain the porcine ANXA2 gene sequence from the NCBI database, use an online CRISPR design tool to design three sgRNA sequences targeting exons 5 and 6 of the ANXA2 gene, and synthesize oligonucleotide chains; The sgRNA sequences are as follows: ANXA2-sgF1: CACCGATCTCGCTCAGCATCAAAGT (SEQ ID NO.1); ANXA2-sgR1: AAACACTTTGATGCTGAGCGAGATC (SEQ ID NO.2); ANXA2-sgF2: CACCGTTGGTCAAAATGTTGACGA (SEQ ID NO.3); ANXA2-sgR2: AAACTCGTCAACATTTTGACCAAC (SEQ ID NO.4); ANXA2-sgF3: CACCGGTCCTTCTTTGGTAGGCAA (SEQ ID NO.5); ANXA2-sgR3: AAACTTGCCTACCAAAGAAGGACC (SEQ ID NO.6).
[0008] (2) Preparation of sgRNA oligonucleotide inserts: The sgRNA oligonucleotides were phosphorylated and annealed, and then cloned into the plasmid pSpCas9(BB)-2A-Puro(PX459)V2.0 to construct the recombinant plasmids pSpCas9(BB)-ANXA2 sg1, sg2, and sg3.
[0009] (3) Cell transfection: The recombinant plasmids were transfected into PK-15 cells, and positive cells were obtained by puromycin screening. The optimal concentration for puromycin screening was 10 μmol / L.
[0010] (4) Screening and amplification of monoclonal cells: Monoclonal cells were screened by the limiting dilution method, and the ANXA2 gene knockout effect was verified by Western blot, PCR, and gene sequencing. The Western blot results showed that the expression of ANXA2 protein in the knockout cells was significantly reduced. The gene sequencing results showed that base addition, deletion, or substitution occurred in the ANXA2 gene sequence of the knockout cells.
[0011] (5) Cell viability analysis: The viability of the knockout cells was detected by the CCK-8 method to ensure their normal growth and passage. The CCK-8 experiment showed that the viability of the knockout cells was above 80%.
[0012] Advantages of the present invention: 1. Gene knockout effect: Using the CRISPR / Cas9 gene editing technology, a PK-15 cell line with ANXA2 gene knockout was successfully constructed. The Western blot results showed that the expression of ANXA2 protein in the knockout cells was significantly reduced, and gene sequencing confirmed that base addition, deletion, or substitution occurred in the ANXA2 gene sequence.
[0013] 2. Cell viability: The CCK-8 assay showed that the viability of the knocked-out cells was above 80%, indicating that their growth state was not affected.
[0014] 3. Application value: This cell line can be used to study the mechanism of action of ANXA2 in virus invasion and replication, providing an important tool for virological research. Brief description of the drawings
[0015] Figure 1 : Schematic diagram of the design of sgRNA targeting the ANXA2 gene.
[0016] Figure 2 : Results of sequencing identification of vector construction.
[0017] Figure 3 : Sequencing peak maps of the original PK-15 cells and transfected cells.
[0018] Figure 4 : Results of screening for the optimal concentration of puromycin.
[0019] Figure 5 : Results of identifying the expression of ANXA2 protein in C5 group cells by immunoblotting.
[0020] Figure 6 : Results of identifying the expression of ANXA2 protein in 8 groups of cells by immunoblotting.
[0021] Figure 7 : Results of PCR nucleic acid electrophoresis verification.
[0022] Figure 8 : Results of gene sequencing identification.
[0023] Figure 9 : Results of CCK-8 cell viability identification. Detailed implementation manners
[0024] The present invention is further described below by way of specific implementation manners.
[0025] The materials and reagents used in the present invention are as follows: 1. Materials and reagents Viruses, cell lines and plasmids: Porcine Kidney-15 (PK-15) cells were purchased and stored by our laboratory; 2. Main reagents The CCK-8 kit was purchased from Nanjing Enjing Biotechnology Co., Ltd.; the endotoxin-free plasmid miniprep kit and DNA extraction kit were purchased from Tiangen Biochemical Technology Co., Ltd.; 2×Rapid Taq Master Mix and liposome transfection reagent (Lipomaster 2000 Transfection Reagent) were purchased from Novoprotein Scientific Inc.; DMEM medium, fetal bovine serum, and trypsin were purchased from Gibco; puromycin, 4% paraformaldehyde, and RIPA lysis buffer were purchased from Shanghai Beyotime Biotechnology Co., Ltd.; Alexa Fluor 594 Affinipure Goat Anti-Rabbit IgG and Alexa Fluor 488 Affinipure Goat Anti-Mouse IgG were purchased from Bioss Co., Ltd.; HRP-labeled goat anti-mouse IgG and goat anti-rabbit IgG were purchased from Kangwei Reagent Co., Ltd.; rabbit-derived ANXA2 antibody and mouse-derived GAPDH antibody were purchased from Proteintech; ECL chemiluminescence solution was purchased from Bioworld Co., Ltd.; Triton X-100 was purchased from Beijing Solarbio Science & Technology Co., Ltd.; DAPI was purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0026] Example 1 Primer Design and Synthesis 1. Design of sgRNA and Plasmid Vector Search for the porcine ANXA2 gene sequence (GeneID: 406192) information from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and use the CRISPR online design tool (http: / / tools.genome-engineering.org) to construct sgRNA, analyze the target modification efficiency, and evaluate potential off-target sites. After comprehensive consideration, determine the sgRNA sequence of the ANXA2 gene, and send the selected sgRNA sequence to Beijing Tsingke Biotechnology Co., Ltd. for synthesis (as shown in Table 1).
[0027] Note: The underlined part is the linker sequence.
[0028] Based on the exon 5 and 6 gene sequences of the ANXA2 gene on the sgRNA design system, design three sgRNAs according to the appropriate cleavage sites ( Figure 1 ), and send them to Beijing Tsingke Biotechnology Co., Ltd. for oligonucleotide chain synthesis.
[0029] 2. Preparation of sgRNA oligonucleotide inserts Dissolve sgRNA in RNase-free water to a final concentration of 100 µM respectively. Prepare the sgRNA oligonucleotide phosphorylation and annealing system as shown in Table 2: Complete phosphorylation and annealing in a PCR instrument according to the following procedure: 37°C for 30 min, 95°C for 5 min, 90°C for 1 min, 85°C for 1 min, 80°C for 1 min, 75°C for 1 min, 70°C for 1 min, 65°C for 1 min, 60°C for 1 min, 55°C for 1 min, 50°C for 1 min, 45°C for 1 min, 40°C for 1 min, 35°C for 1 min, 30°C for 1 min, 25°C for 1 min. After the reaction, dilute the phosphorylated and annealed oligonucleotides 200-fold with ddH2O.
[0030] 3. Clone the sgRNA oligomer into plasmid pSpCas9(BB)-2A-Puro (PX459)V2.0 Prepare the ligation system according to the ratio shown in Table 3 and clone the sgRNA oligomer into plasmid pSpCas9(BB)-2A-Puro (PX459)V2.0. The ligation procedure is: 37°C for 5 min, 21°C for 5 min, 6 cycles, with a total duration of 1 h. After the ligation reaction is completed, treat with plasmid exonuclease to digest the remaining other linear RNAs. Finally, obtain the recombinant plasmids pSpCas9(BB)-ANXA2 sg1, pSpCas9(BB)-ANXA2 sg2, and pSpCas9(BB)-ANXA2 sg3 containing the sgRNA fragment.
[0031] After the vector construction is completed, send it to Sangon Biotech in Shanghai for sequencing. The results show that the sequences of ANXA2-sg1, ANXA2-sg2, and ANXA2-sg3 are correctly inserted into pSpCas9(BB)-2A-Puro (PX459)V2.0, as Figure 2 , and the positions and orders of the inserted sequences are consistent with the expectations, indicating that the construction of the pSpCas9(BB)-sgRNA expression vector is successful.
[0032] 4. Transformation and large-scale culture of the recombinant plasmid Transfer 10 µL of recombinant plasmids (pSpCas9(BB)-ANXA2 sg1, pSpCas9(BB)-ANXA2 sg2, and pSpCas9(BB)-ANXA2 sg3) into Stbl3 competent cells respectively, culture them on LB solid medium containing 100 µg / mL ampicillin, and pick a single colony from each petri dish for expanded culture. Extract plasmid DNA using the Tiangen Mini Plasmid Midiprep Kit according to the instructions, and sequence the plasmids using the U6-Fwd primer to verify the sequences of each monoclonal colony. The U6-Fwd sequence is 5'-GAGGGCCTATTTCCCATGATTCC-3'.
[0033] Example 2. Construction of ANXA2 knockout cell line 1. Cell transfection Take PK-15 cells in good growth state, inoculate them onto a 12-well cell culture plate at a density of 2×10 5 cells per well, and perform transfection when the cell density reaches about 80%. Add 50 µL of Opti-MEM serum-free medium to a 1.5 mL sterile centrifuge tube, and add 4.5 µL of Lipomaster 2000 Transfection Reagent, gently invert and mix well. Then add 50 µL of Opti-MEM to another 1.5 mL sterile centrifuge tube, and add 1.5 µg of the target plasmid DNA, gently invert and mix well. Then drip the DNA / Opti-MEM into the Lipomaster 2000 Transfection Reagent / Opti-MEM, gently mix with a pipette and let stand for five minutes, and then slowly and evenly drip 100 µL of the above transfection mixture into the cell wells containing 900 µL of DMEM per well. Culture the transfected cells in a cell incubator (37 °C, 5% CO2).
[0034] After plasmid amplification, transfect PK-15 cells, collect the cells to extract genomic DNA 48 h later, and sequence and identify the sequences near the 5th and 6th exons of ANXA2. The results show that compared with the original PK-15 cells, a composite peak appears at the starting position of the 5th exon, that is, the sgRNA pairing position, in the transfection group, indicating a sequence variation at this position ( Figure 3 )
[0035] 2. Screening of the optimal concentration of puromycin Inoculate PK-15 cells into 24-well plates. After culturing for 24 h, add puromycin at final concentrations of 0, 1, 2, 5, 10, and 20 μmol / L and continue culturing. Set 3 replicates for each concentration. Observe the cell number every day, and select the minimum concentration that can kill all cells at 72 h as the optimal concentration for cell screening. The results show that the minimum mass concentration to kill cells at 72 h is 10 μmol / L ( Figure 4 ).
[0036] 3. Screening of transfected cells with puromycin 48 h after plasmid transfection, change the culture medium to the medium containing the optimal concentration of puromycin and continue culturing. Observe and screen for positive cells. After screening for 3 d, collect some cells for immunoblotting to detect the expression of the target gene, and continue culturing some cells for subsequent screening of monoclonal cell lines that can stably express.
[0037] 4. Screening and amplification of monoclonal cells Transfer the screened transfected cells to 96-well plates by the limiting dilution method for culture. The cell density is approximately 1 - 2 cells per well. After culturing for 1 week, pick monoclonal cells and screen the monoclonal cells. The single cells after screening are further amplified and cultured until they form clusters.
[0038] Example 3 Verification of ANXA2 gene knockout effect 1. Western blot detection Collect protein samples from wild-type PK-15 cells and the selected monoclonal cells respectively, and separate them by SDS-PAGE electrophoresis (80 V, 30 min; 120 V, 1 h). After electrophoresis, transfer the proteins on the gel to a PVDF membrane (200 mA, 2 h), and block it with 5% skim milk / TBST [tris-buffer saline, containing 0.1% (V / V) Tween-20] at room temperature for 2 h. Incubate it overnight at 4℃ in the prepared primary antibody solution, wash it, and then incubate it in the HRP-labeled secondary antibody solution for 1 h. After washing, develop the image with ECL luminescent solution and expose it with an exposure instrument.
[0039] Take a part of the positive cells obtained after screening and collect protein samples. Using wild-type PK-15 cells as a control, detect the expression of ANXA2 protein by Western blot. The results show that ANXA2 can be normally expressed in wild-type PK-15 cells, while in the cells transfected with the knockout plasmid, the expression level of ANXA2 in group C5 cells is significantly decreased ( Figure 5 ). Passage the C5 cells to culture monoclonal cells again, and further purify to obtain six monoclonal cell clusters, which are named B8, B11, G4, G8, F6, and F11 respectively and amplified and cultured respectively.
[0040] Subsequently, protein samples of wild-type PK-15 cells, C5 cells, and six groups of purified monoclonal cells were collected for detection. The Western blot results showed that in the monoclonal cell clusters further purified from C5, the expression of ANXA2 protein could not be observed in the six groups of B8, B11, G4, G8, F6, and F11 (as Figure 6 ).
[0041] 2. Monoclonal genome PCR detection The selected monoclonal cells were expanded in culture, and genomic DNA was extracted using the Tiangen genomic DNA extraction kit according to the instructions. Primers designed by Blast were used to amplify the gene fragment containing exons 5 and 6 of ANXA2. The primer sequences are as follows: sgF1: 5'-GAGACAGGCAGACAGGCTCTTACATT-3'; sgR1: 5'-ATCGGACCTCCTGGCTCTCAGTTAA-3'; sgF2: 5'-GGCTGTATATGTTGGGCGGAGAG-3'; sgR2: 5'-ACTCAATGGAGGCTAATGTCCTAAGAT-3'.
[0042] Amplification was carried out according to the PCR reaction system (Table 4) and reaction program (Table 5).
[0043] After amplification, 5 μL of the PCR product was subjected to agarose gel electrophoresis to detect specific bands.
[0044] PCR nucleic acid electrophoresis verification: Genomic DNA of wild-type PK-15 cells, C5 cells, and the above six groups of monoclonal cells was extracted respectively, and the ANXA2 gene fragment containing exons 5 and 6 was amplified by PCR. The gel electrophoresis results showed that all clones could amplify clear bands of the same size as wild-type PK-15 cells, indicating that there was no large fragment deletion mutation in this genomic region ( Figure 7 ).
[0045] Gene sequencing identification: The genomic DNA of wild-type PK-15 cells, C5 cells, and six groups of monoclonal cells further purified was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results showed that except for wild-type PK-15 cells, base additions, deletions, and substitutions occurred in varying degrees in the ANXA2 gene sequences of the remaining seven groups of cells ( Figure 8 ).
[0046] 3. Cell activity analysis After amplifying and culturing the finally obtained monoclonal cells, inoculate them into a 96-well plate (about 1×10 4 cells / well), add 10 µL of CCK8 reagent to each well, incubate in the incubator in the dark for 2 h, measure the absorbance value with an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm, and draw a column chart of cell viability. Set up 1 original PK cell group, 7 experimental groups, and 1 blank control group with only medium and CCK-8 reagent, and set 5 replicates for each group.
[0047] Analysis of the cell viability of these 7 groups of monoclonal cells by the CCK-8 method showed that ( Figure 9 ), the viability of the knockout cells was above 80%, indicating that several groups of monoclonal cells could grow and be passaged normally.
[0048] In summary, in this study, the CRISPR / Cas9 gene editing technology was used to successfully construct a PK-15 cell line with ANXA2 gene knockout, and its viability was verified. The results of genome sequencing and Western blot showed that the ANXA2 gene was successfully knocked out, maintaining stable genotype and phenotypic characteristics during multiple passages, and the cell viability was not affected after detection, providing a stable and reliable experimental basis for subsequent related research.
Claims
1. A method for constructing a PK-15 cell line with annexin A2 gene knockout, characterized in that, It includes the following steps: a. Design and synthesize sgRNA sequences targeting exons 5 and 6 of the porcine ANXA2 gene; b. Phosphorylate and anneal the sgRNA oligonucleotides, and clone them into the plasmid pSpCas9(BB)-2A-Puro(PX459)V2.0 to construct a recombinant plasmid; c. Transfect the recombinant plasmid into PK-15 cells, and obtain positive cells through puromycin screening; d. Screen monoclonal cells by the limiting dilution method and culture them. Verify the ANXA2 gene knockout effect by Western blot, PCR and gene sequencing to obtain an ANXA2 knockout cell line.
2. The method according to claim 1, wherein The sgRNA sequences are as follows: ANXA2-sgF1: CACCGATCTCGCTCAGCATCAAAGT; ANXA2-sgR1: AAACACTTTGATGCTGAGCGAGATC; ANXA2-sgF2: CACCGTTGGTCAAAATGTTGACGA; ANXA2-sgR2: AAACTCGTCAACATTTTGACCAAC; ANXA2-sgF3: CACCGGTCCTTCTTTGGTAGGCAA; ANXA2-sgR3: AAACTTGCCTACCAAAGAAGGACC.
3. The method according to claim 1, wherein The optimal concentration for puromycin screening is 10 μmol / L.
4. The method according to claim 1, wherein The results of Western blot detection show that the expression of ANXA2 protein in the knockout cells is significantly reduced.
5. The method according to claim 1, wherein The results of gene sequencing show that base addition, deletion or substitution occurs in the ANXA2 gene sequence of the knockout cells.
6. The method according to claim 1, wherein Detect the activity of the knockout cells by the CCK-8 method to ensure their normal growth and passage. The CCK-8 experiment shows that the activity of the knockout cells is above 80%.
7. A PK-15 cell line with annexin A2 gene knockout, characterized in that, Constructed by the method according to any one of claims 1-6.
8. The PK-15 cell line according to claim 7, characterized in that, The cell line is used to study the mechanism of action of annexin A2 in virus invasion and replication.