Novel biological flocculant and application thereof in lactic acid fermentation chassis cell recovery

By using the fungal flocculant treated with the YL108 fermentation supernatant of the tree tongue Ganoderma lucidum YL108, combined with cationic etherified starch and combined with eggshell powder as a filter aid, the problem of cell recovery in the lactic acid fermentation broth was solved, and efficient solid-liquid separation and product quality improvement were achieved.

CN120290642APending Publication Date: 2025-07-11JIANGNAN UNIV
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510284650.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

There is a lack of low-cost and food-safe methods in the prior art to recover cells in lactic acid fermentation broth, especially in the high salt concentrations of bacterial cells, and common filter aids such as celite and perlite affect product quality.

Method used

The fungal flocculant treated with YL108 fermentation supernatant of the tree tongue Ganoderma lucidum was combined with cationic etherified starch, and combined with eggshell powder as a filter aid, flocculation of the lactic acid fermentation broth and filtration of the plate and frame.

Benefits of technology

The flocculation effect of bacteria in the lactic acid fermentation broth is improved, and the residue obtained does not contain harmful filter aids, which improves the feed or edible value of the product and achieves efficient solid-liquid separation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005306769220000111
    Figure BDA0005306769220000111
  • Figure BDA0005306769220000121
    Figure BDA0005306769220000121
  • Figure BDA0005306769220000141
    Figure BDA0005306769220000141
Patent Text Reader

Abstract

The invention discloses a novel biological flocculant and application thereof in lactic acid fermentation chassis cell recovery, and belongs to the field of fermentation engineering, chemical separation or new chemical materials. The invention discloses a flocculating agent GapWZ derived from fungus fermentation liquor. The main component of the flocculating agent is obtained by specially treating supernate obtained by selenium-enriched fermentation of ganoderma applanatum YL108. The preparation method comprises the following steps: adding cationic etherified starch into lactic acid fermentation liquor of bacillus coagulans and recombinant escherichia coli, stirring and mixing, and adding the fungal flocculant GappWZ. After the lactic acid fermentation liquor is treated, a small amount of eggshell powder is used as a filter aid to realize solid-liquid separation and recover cells by using a plate and frame filtration method, special filter aids such as diatomite and perlite are not used, and the feeding or edible value of the lactic acid fermentation liquor residues can be greatly improved while the solid-liquid separation is performed by using the plate and frame filtration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a novel bioflocculant and its application in the recovery of chassis cells for lactic acid fermentation, belonging to the technical fields of fermentation engineering, chemical separation or new chemical materials. Background Art

[0002] Lactic acid bacteria are the main strains for lactic acid fermentation production. At the same time, their cells themselves are often intestinal probiotics and are widely used in the production of food and feed. Therefore, the method for recovering high-quality cells in the lactic acid fermentation industry is of great significance. Bacillus coagulans is the main strain for industrial production of food-grade and polymer-grade L-lactic acid at present and is also an important probiotic. The centrifugation method is the most commonly used method for collecting bacterial cells, but its disadvantages are that it requires a large amount of power consumption and also has a large equipment investment. Plate and frame filtration is one of the lowest-cost solid-liquid separation methods in the fermentation industry. In lactic acid fermentation with Bacillus coagulans as the strain, the accumulation of lactic acid causes the pH of the fermentation broth to drop, and a large amount of alkali is required for neutralization. Therefore, the final fermentation broth is a solution with a very high salt concentration, and the flocculation of its cells is somewhat difficult. Therefore, it is technically difficult to use the plate and frame filtration method for solid-liquid separation of lactic acid fermentation broth with bacteria as the strain. Generally, a large amount of chemical flocculants such as polyacrylamide are used, and a large amount of filter aids such as diatomaceous earth or perlite are used for filtration assistance. Although diatomaceous earth and perlite have good filtration assistance effects, they are not normal components of food or feed themselves and cannot be digested and absorbed. In food or feed production, diatomaceous earth and perlite are more suitable for solid-liquid separation operations with the filtrate as the target product. If the target product is in the filter cake, these filter aid components often ultimately enter the product, seriously affecting the product quality, especially affecting the feeding or edible value of the residue. Raw starch is a commonly used food-grade filter aid. However, when performing solid-liquid separation of lactic acid fermentation broth, in order to prevent the precipitation of its main product calcium lactate, a relatively high temperature needs to be maintained, while raw starch needs to be used at a low temperature. When the temperature rises, partial gelatinization will occur, and the starch itself instead becomes the main cause of filter pore blockage. Eggshell powder is a by-product of the food industry production with poultry eggs as raw materials, rich in calcium, protein and various vitamins, and is itself a high-quality feed raw material. Under appropriate production processes, eggshell powder can also be used as a food additive and is a high-quality calcium supplement in high-calcium foods. Eggshell powder itself is a porous granular material and is sometimes used as a filter aid. It is one of the few special materials that are both food nutritional components and can play a filtration assistance function. As a filter aid, the disadvantage of eggshell powder is that its filtration assistance effect is not as good as that of special filter aids such as diatomaceous earth. Generally, it is only used in the filtration of fermentation broth of easily filtered bacteria such as fungi. Bacterial cells are tiny, and the concentration of various salts in lactic acid fermentation broth is very high. Therefore, during filtration, the filter pores are often blocked, resulting in the inability to perform plate and frame filtration.

[0003] In the prior art, there is a lack of a method for using food safety materials to assist in the low-cost cell recovery of lactic acid fermentation broth. Summary of the Invention

[0004] To address the above problems, in the preliminary work of this patent, various microbial and fungal fermentation broths were screened. It was found that the components of the fermentation supernatant of Ganoderma applanatum LL108, after appropriate treatment and combined treatment with cationic etherified starch for the fermentation broth of Bacillus coagulans, could significantly improve the flocculation effect. The obtained fermentation broth could be subjected to plate and frame filtration using eggshell powder as a filter aid to achieve cell recovery. The obtained residue did not contain special filter aids such as diatomaceous earth and perlite, greatly improving the feeding or edible value of the residue of lactic acid fermentation broth. This method is also applicable to the flocculation and filtration of lactic acid fermentation broth using recombinant Escherichia coli as the strain. This patent discloses the preparation of the above fungal flocculant and the method for cell recovery of lactic acid fermentation broth.

[0005] The technical solution of the present invention is that a highly selenium-tolerant and selenium-enriched Ganoderma applanatum variant strain YL108 has been deposited in the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China. It is classified and named as Ganoderma applanatum YL108, and the deposit number is CCTCC NO: M 20221347, and the deposit date is August 29, 2022. Relevant contents such as the acquisition of the strain and fermentation characteristics have been disclosed in the previous patent of this research group (Patent CN116769609A).

[0006] The present invention provides a fungal flocculant, which is obtained by treating the fermentation supernatant of Ganoderma applanatum YL108.

[0007] In one embodiment, the preparation method of the fungal flocculant is to ferment Ganoderma applanatum YL108, collect the fermentation supernatant, and obtain it by alcohol precipitation after protease enzymolysis; the deposit number of Ganoderma applanatum YL108 is CCTCC NO: M20221347.

[0008] In one embodiment, glucose is added to a final concentration of 25 - 30 g / L 4 - 5 h before the end of fermentation.

[0009] In one embodiment, after fermentation, the fermentation supernatant is collected, heated to 45 - 47 °C and stirred and mixed for 12 - 16 h, then the pH is adjusted to 7.0 - 8.0, protease is added to a final concentration of 10 - 50 U / L, and after the reaction ends, heating and stirring are carried out.

[0010] In one embodiment, the protease includes but is not limited to low-temperature alkaline protease.

[0011] In one embodiment, for the alcohol precipitation, 2 - 2.5 times the volume of absolute ethanol is added, stirred for 15 - 60 min, and the precipitate is collected.

[0012] In one embodiment, the precipitate is used directly or after drying.

[0013] The present invention provides a method for solid - liquid separation of a lactic acid fermentation broth. Cationic etherified starch, the fungal flocculant GappWZ, and eggshell powder are sequentially added to the lactic acid fermentation broth for reaction, and then filtration is carried out.

[0014] In one embodiment, the filtration includes, but is not limited to, plate - frame filtration.

[0015] In one embodiment, it includes the following steps:

[0016] (1) Adjust the pH of the fermentation broth to 7 - 8;

[0017] (2) Add cationic etherified starch with a final concentration of 0.02 - 0.03 g / L to the fermentation broth treated in step (1), and stir at 50 - 60 °C for 20 - 60 min;

[0018] (3) Add the fungal flocculant GppWZ to the fermentation broth treated in step (2) to a final concentration of not less than 0.03 g / L, and stir for 60 - 120 min to obtain a flocculated fermentation broth;

[0019] (4) Add not less than 50 g / L of eggshell powder to the flocculated fermentation broth in step (3), and stir for 10 - 30 min;

[0020] (5) Carry out solid - liquid separation of the fermentation broth by plate - frame filtration of the fermentation broth treated in step (4).

[0021] In one embodiment, the system temperature is maintained at 50 - 60 °C in steps (1) - (3); the system temperature is maintained at 55 - 60 °C in steps (4) - (5).

[0022] The present invention also provides the application of the fungal flocculant GappWZ in flocculating a fermentation broth. The fermentation broth is reacted with cationic etherified starch and the fungal flocculant GappWZ in sequence for a period of time.

[0023] In one embodiment, the fermentation broth includes, but is not limited to, a lactic acid fermentation broth.

[0024] In one embodiment, the lactic acid fermentation broth includes, but is not limited to, a lactic acid fermentation broth of Bacillus coagulans or an Escherichia coli lactic acid fermentation broth.

[0025] The present invention also provides the application of the fungal flocculant GappWZ or the method in the food field.

[0026] Beneficial effects:

[0027] The present invention provides a fungal flocculant GappWZ. After treating the fermentation supernatant of Ganoderma applanatum YL108, it is used as a flocculant for lactic acid fermentation broth. When used in combination with cationic etherified starch, it can synergistically promote the efficient flocculation of bacteria in the lactic acid fermentation broth, which is beneficial to the subsequent solid-liquid separation operation.

[0028] The present invention provides a method for solid-liquid separation of lactic acid fermentation broth. After using the fungal flocculant GappWZ described in the present invention and cationic etherified starch in combination to flocculate the lactic acid fermentation broth, adding eggshell powder can achieve plate-and-frame filtration of the lactic acid fermentation broth. Specific embodiments

[0029] The present invention is further illustrated by examples, which will not limit the scope of the present invention in any way.

[0030] Experimental materials:

[0031] Corn steep liquor dry powder is a product of Beijing Hongrun Baoshun Technology Co., Ltd., product number: Y042. Wort powder is a product of Shandong Tianjiu Biotechnology Co., Ltd. Cationic etherified starch is a product of Anhui Cool Chemical Co., product number: CQ651844-500g. Alkaline protease is a product of Xiasheng Group Co., product number APL4000. Food-grade eggshell powder is a product of Henan Zhongchen Biotechnology Co., Ltd. Glucose is a product of Xiwang Pharmaceutical Co., Ltd., which is food-grade anhydrous glucose. The rest of the reagents are domestic analytical pure reagents, which are products of Sinopharm Chemical Reagent Co., Ltd. Unless otherwise specified, the reagents used for Ganoderma applanatum fermentation, detection, etc. are the same as those in the literature [Shanyi Lan, Lin Zhao, Wei Shen, Menglian Yang, Xianzhong Chen, Haiquan Yang, Yuanyuan Xia. A highly selenium-tolerant and selenium-rich Ganoderma applanatum mutant strain and its application. Chinese invention patent, CN2023104574930.].

[0032] Molecular biology reagents are all purchased from Shanghai Sangon Biotech Co., Ltd. The one-step cloning kit is the one-step cloning kit C112 of Nanjing Novozymes Co., Ltd. The construction of recombinant plasmids and recombinant Escherichia coli is carried out according to the general methods of molecular biology.

[0033] Materials and methods:

[0034] 1. The basic PDA medium for Ganoderma applanatum cultivation is equivalent to the literature [Shanyi Lan, Lin Zhao, Wei Shen, Menglian Yang, Xianzhong Chen, Haiquan Yang, Yuanyuan Xia. A highly selenium-tolerant and selenium-enriched Ganoderma applanatum mutant strain and its application. Chinese invention patent, CN2023104574930.], specifically see the materials and methods section of the literature. According to the results of Example 3 in the literature, the optimal addition amount of sodium selenite in the fermentation medium formula during selenium-enriched cultivation is a selenium concentration of 90 mg / mL. Therefore, in the experiments of this patent, a selenium addition amount of about 90 mg / mL is generally used for the experiments. The methods for seed cultivation, fermentation cultivation, cell collection, protein extraction, selenium content detection, etc. of Ganoderma applanatum YL108 have been published in the above literature. The addition and concentration control of selenium in the fermentation broth are carried out according to the methods described in the above literature.

[0035] 2. Seed cultivation of Ganoderma applanatum YL108. Formula of Ganoderma applanatum seed medium: Add 800 mL of water to a 1 L beaker, and sequentially add: 40 g of glucose, 0.1 g of potassium dihydrogen phosphate, 0.05 g of anhydrous calcium chloride, 0.02 g of anhydrous magnesium chloride, 6 g of malt extract powder, 6 g of corn steep liquor dry powder, 10 g of yeast powder, 10 g of peptone, stir and dissolve, and then make up the volume to 1 L with water. After the medium is prepared, it is generally dispensed into 500 mL conical flasks, the liquid loading volume is generally 100 mL, sealed with gauze, and sterilized at 110 °C for 15 min for later use. The method of seed cultivation is as follows: Take the glycerol tube preservation of Ganoderma applanatum strain YL108, inoculate it on a PDA plate, and cultivate for about 14 days to obtain a mycelium culture. Further inoculate it on the PDA solid slant of an eggplant bottle, and after a large amount of mycelium is formed, dig out the mycelium and inoculate it into the basic PDA liquid medium, shake-flask culture at 30 °C for 7 days, then transfer it to a new basic PDA liquid medium at an inoculation amount of 10%, shake-flask culture at 30 °C for 5 days, and then inoculate the Ganoderma applanatum seed medium at a volume inoculation amount of 10%, shake-flask culture at 30 °C for 7 days. Generally, 15 bottles of seed medium need to be prepared, about 1.2 L. After the seed cultivation is completed, the above seed culture broth is concentrated into a sterilized 2 L conical flask according to the volume of the fermentation tank medium, and the volume of the seed liquid is generally 1.2 L.

[0036] 3. Fermentation medium for Ganoderma applanatum YL108 in a 15L fermenter: glucose 70g / L, potassium dihydrogen phosphate 0.2g / L, anhydrous calcium chloride 0.1g / L, anhydrous magnesium chloride 0.05g / L, malt extract powder 3g / L, corn steep liquor dry powder 10g / L, ammonium sulfate 10g / L. In a 15L fermenter, generally add water in advance to about 8L. Calculated according to the standard volume of 12L, add the above components to the fermenter, mix and dissolve to obtain the initial medium. After preparation, sterilize at 110°C for 15 minutes and prepare sterile water at the same time. When the sterilized medium cools below 30°C, add sodium selenite solution to the above sterilized fermentation broth. Set the controlled ventilation volume to 20L / min and the rotation speed to 350r / min. Generally, calibrate the dissolved oxygen electrode after 10 minutes, and calibrate the dissolved oxygen DO to 100%. Appropriately supplement ammonia water or sulfuric acid solution to control the pH of the fermentation broth at about 5.5. Transfer the seed liquid to the fermenter at an inoculation amount of 10% (generally 1.2L), and further add water to the predetermined volume (when using a 15L fermenter, generally control the volume at 12L). During the fermentation process, control the pH between 5.0 - 6.0 with 25% ammonia water, and add water according to the evaporation of water to control the volume of the fermentation broth between 11 - 12 liters. When finally discharging the tank, first add water to control the volume to 12L (deducting the sampling volume). Control the temperature at 30°C during the entire fermentation process in the fermenter, maintain the ventilation volume at 1v / v.min, and the stirring speed is about 250r·min -1 , generally correlate the rotation speed with the dissolved oxygen to control the dissolved oxygen DO at 25 - 35%. Generally, the fermentation lasts for 7 days. Generally, end the fermentation and discharge the tank on the 7th day (168hr). The basis for discharging the tank is generally that the pH of the fermentation broth no longer decreases, lasting for about 5 - 6 hours.

[0037] 4. Preparation method of Gapp series fungal flocculants: The fermentation broth is directly pressed into a plate and frame filter press by a centrifugal pump. The equipment used for plate and frame filtration is a 150-type plate and frame filter press (equipped with a centrifugal pump), which is a product of Jiaxing Youchuang Machinery Equipment Co., Ltd. The filter cloth is a 510-type (filtration accuracy 5-10 microns) polypropylene filter cloth, which is a product of Zhejiang Huarui Mesh Co., Ltd. The filter cake obtained by filtration is used as a raw material for selenium protein extraction [Shanyi Lan, Lin Zhao, Wei Shen, Menglian Yang, Xianzhong Chen, Haiquan Yang, Yuanyuan Xia. A highly selenium-tolerant and selenium-rich Ganoderma applanatum mutant strain and its application. Chinese invention patent, CN2023104574930.]. The filtrate obtained by filtration is cooled to room temperature, 2-2.5 times the volume of absolute ethanol is added, and it is stirred for 15-60 min. After cooling to room temperature, it is centrifuged to obtain the precipitate, and the fungal flocculant Gapp is obtained after drying. The precipitate is generally dried in an oven at 65-85 °C. The flocculants prepared from the supernatant part of the fermentation broth with the final selenium concentration added to 60-90 mg / L during the fermentation of Ganoderma applanatum are collectively called Gapp69; the flocculant prepared from the supernatant part of the fermentation broth with the final selenium concentration added to 60 mg / L during the fermentation of Ganoderma applanatum is called Gapp60, and the flocculants prepared at other concentrations are named with reference to the same method.

[0038] 5. Preparation method of GappWZ series fungal flocculants: The above steps 1-3 are the fermentation methods for preparing Ganoderma applanatum selenium protein. To prepare the fungal flocculant, it is necessary to detect the reducing sugar content of the fermentation broth 4-5 hours before discharging the fermentation tank. Generally, the reducing sugar content of the fermentation broth at this stage is below 5 g / L. According to the amount of residual reducing sugar, glucose is added to the fermentation broth to 25-30 g / L and fermentation continues. In actual operation, generally after 144 hours of fermentation, closely monitor the change of the pH of the fermentation broth. If the pH no longer drops, it is generally necessary to discharge the tank after 5-6 hours. Based on this, predict the discharging time and select an appropriate time to sample and detect the reducing sugar content of the fermentation broth, and then add glucose accordingly and continue fermentation for 4-5 hours (that is, add glucose 1-2 hours after the pH of the fermentation broth no longer changes). 30 minutes before the end of fermentation, detect the reducing sugar content of the fermentation broth again. At this time, the reducing sugar content should generally be between 10-20 g / L. The solid-liquid separation method of the fermentation broth is the same as in step 4. The filtrate obtained by filtration is treated as follows: Heat to 45-47 °C and continuously stir and mix for 12-16 hours, generally in the original 15 L fermentation tank (the fermentation tank needs to be cleaned and sterilized empty), and the stirring speed is about 100 r / min to achieve the purpose of liquid mixing. After the reaction is completed, adjust the pH to 7.0-8.0, generally using 10% NaOH solution to adjust the pH of the fermentation broth. Add low-temperature alkaline protease to a final concentration of 10-50 U / L according to the nominal activity of the product, and stir at room temperature for 20-30 minutes. After the reaction is completed, heat to above 70 °C and continuously stir for 1-2 hours. Add 2-2.5 times the volume of anhydrous ethanol, stir for 15-60 minutes, cool to room temperature and then centrifuge to collect the precipitate, and dry it to obtain the fungal flocculant GappWZ. The precipitate is generally dried in an oven at 65-85 °C.

[0039] During the production of GappWZ, if sodium selenite is added to the fermentation broth to a selenium content of 60 mg / L to 90 mg / L, the flocculant prepared by the above method is called GappWZ69; during the production of GappWZ, if sodium selenite is added to the fermentation broth to a selenium content of 60 mg / L, the flocculants prepared by the above method are collectively called GappWZ60, and the flocculants prepared at other concentrations are named with reference to the same method. The application performance and production yield of GappWZ69 are exactly the same as those of GappWZ. High-quality selenium-containing protein by-products can be obtained during the production of GappWZ69.

[0040] 6. Lactic acid fermentation of Bacillus coagulans

[0041] Seed medium for Bacillus coagulans: Glucose 20 g / L, yeast powder 15 g / L, peptone 10 g / L, magnesium sulfate 0.1 g / L, corn steep liquor dry powder 0.5 g / L, light calcium carbonate 20 g / L.

[0042] Initial fermentation medium for Bacillus coagulans in a 15L tank: glucose 80g / L, yeast powder 10g / L, peptone 5g / L, anhydrous magnesium sulfate 0.1g / L, anhydrous calcium chloride 0.05g / L, dry corn steep liquor 0.5g / L, ammonium sulfate 3g / L.

[0043] Feeding medium for Bacillus coagulans: glucose 600g / L, yeast powder 5g / L, peptone 2g / L, anhydrous magnesium sulfate 0.2g / L, anhydrous calcium chloride 0.1g / L, dry corn steep liquor 0.5g / L.

[0044] pH adjustment during fermentation: Since Bacillus coagulans produces acid continuously during fermentation, a calcium hydroxide emulsion with a content of 300g / L is generally used to adjust the acidity.

[0045] Lactic acid fermentation of Bacillus coagulans in a 15L fermenter: Inoculate the Bacillus coagulans strain from the glycerol tube, and culture it by streak plate (using standard MRS medium) at 45°C for 24h. Inoculate a single colony into a 250mL conical flask containing 50mL of LB liquid medium, and culture it at 45°C with a shaking speed of 200r / min for 12h, then inoculate the Bacillus coagulans seed medium at an inoculation amount of 10%. The Bacillus coagulans seed medium generally uses a 500mL Erlenmeyer flask containing 100mL of seed medium. After inoculation, culture it at 50°C with a shaking speed of 200r / min for 6h for inoculating the fermentation medium. Generally, 15 bottles of seed culture solution need to be prepared. After the seed culture is completed, concentrate the culture solution in a 2L conical flask, generally 1L. The seed culture adopts shaking flask ventilation fermentation.

[0046] Inoculation and fermentation in the fermenter: Prepare the initial fermentation medium in a 15L fermenter. Initially, generally add 7L of water, and prepare the medium in the fermenter according to the standard volume of 9L. After preparation, sterilize it at 110°C for 10min. After the fermentation medium is sterilized, inoculate 1L of the above-mentioned seed liquid into the fermenter containing the fermentation medium. After inoculation, the initial volume of the fermentation broth is generally 8.5L - 9L, and make up the volume to 9L with pre-prepared sterile water. After starting fermentation, keep the stirring speed at 250r / min, 50°C, and control the pH at 6.6. Open the inlet and outlet vents at the beginning of fermentation, and aerate for 3h, generally at 2vvm. After 3hr, close the outlet valve, and maintain the tank pressure at about 0.1mPa with the inlet valve. Since the outlet valve is closed, it is actually anaerobic fermentation. Due to sugar and alkali supplementation during the fermentation process, the volume of the fermentation broth at the end of fermentation is generally about 11 - 12L.

[0047] 7. Lactic acid fermentation of recombinant Escherichia coli

[0048] The fermentation medium for E. coli in a 15L tank is the modified M9 medium: 1.0 g / L of NH4Cl, 15.11 g / L of Na2HPO4·12H2O, 0.5 g / L of NaCl, 3.0 g / L of KH2PO4, and 5.0 g / L of (NH4)SO4. After sterilization, 1 ml of 1 mol / L MgSO4 and 1 ml of trace element solution (trace element composition: 0.495 g / L of MnCl2·4H2O, 0.15 g / L of CuCl2·2H2O, 2.4 g / L of FeCl3·6H2O, 0.3 g / L of CoCl2·6H2O, 0.3 g / L of ZnCl2, 0.3 g / L of Na2MO4·2H2O, 0.075 g / L of H3BO3) are added to each liter of the medium.

[0049] The above MgSO4 solution and trace element solution are filtered and sterilized using a 0.22 μm bacterial filter and then added to the sterilized fermentation broth. Antibiotics are generally not added to the modified M9 medium and feeding medium for seed culture and fermentation culture.

[0050] The fermentation method of recombinant E. coli is carried out on a 15L fermenter using the aerobic-oxygen-limited method introduced in the reference [Zhou Li. Construction of E. coli metabolic engineering bacteria for high-yield and high-purity D-lactic acid. Doctoral dissertation, Jiangnan University, 2012]. The specific operation process is as follows.

[0051] Seed culture stage:

[0052] (1) Streak and isolate the recombinant E. coli strain on an LB solid plate with ampicillin resistance and culture it in an incubator at 37°C for 14 - 16 h.

[0053] (2) Inoculate the single colony obtained from streaking into a 250 ml Erlenmeyer flask containing 50 ml of sugar-free LB liquid medium and culture it on a shaker at 37°C for 9 - 13 h.

[0054] (3) Transfer the bacterial liquid into a sterilized 50 ml centrifuge tube, centrifuge at 6000 r / min for 5 min, and collect the bacterial cells.

[0055] (4) Resuspend the bacterial cells using sterilized modified M9 liquid medium, take the bacterial liquid to measure its OD 600 . Inoculate it into a 500 ml Erlenmeyer flask containing 150 ml of modified M9 liquid medium with 5 g / L glucose. Generally, 10 flasks need to be inoculated. When inoculating, control the bacterial concentration OD 600 between 0.35 and 0.4. The above bacterial liquid is cultured in a shaker flask at 37°C. Sampling is carried out in a timely manner to measure the bacterial cell concentration. Generally, when the bacterial cell concentration OD 600 reaches 4 - 5 after 6 - 7 h of culture, it can be used to inoculate the fermenter medium.

[0056] The first stage of fermentation in the fermenter (aerobic stage):

[0057] (5) Take the seed liquid and measure its OD 600 , inoculate it into the modified M9 medium in a 15L fermenter. The initial volume of the fermentation broth is generally about 8L. After inoculation, control the cell concentration OD 600 between 0.15 and 0.2. The glucose concentration in the initial M9 medium is generally controlled at 25 - 35g / L.

[0058] (6) In the initial stage, set the air flux to 3L / min, the stirring paddle speed to 200r / min. The dissolved oxygen concentration is generally 100% initially, and the temperature is 33°C. As the strain grows, gradually increase the air flux from 3L / min to 7L / min. Keep the stirring paddle speed associated with the dissolved oxygen value and maintain the dissolved oxygen concentration at a level greater than 30%. Generally, adjust the pH with ordinary ammonia water with a concentration of about 25 - 30%. The pH in the first stage is maintained at 6 - 7. Prepare a sulfuric acid solution of about 5% (v / v) for use when the pH is too high, but it is generally not used in actual operation. Generally, sample and detect OD every about 6 hours 600 OD 600 reaching 12 indicates that the fermentation can enter the next stage.

[0059] The second stage of fermentation in the fermenter (oxygen-limited stage):

[0060] (7) The oxygen-limited condition is the stage for lactic acid production. Close the inlet valve, set the air flux to 0L / min, and keep the stirring paddle speed at 200r / min. Sample every 6h, centrifuge to remove the supernatant and detect the residual sugar concentration of the sample. If the residual sugar concentration is below 10g / L, promptly add glucose (generally a high-concentration sugar solution of 600g / L), generally need to add it 2 - 4 times, and control the final glucose concentration at 40 - 50g / L after each sugar addition. When lactic acid generally no longer increases when Ca(OH)2 is no longer consumed during the fermentation process, stop adding glucose, and generally end the fermentation when the glucose is exhausted.

[0061] (8) After entering the second stage, set the temperature of the fermenter to 42°C.

[0062] (9) In the second stage, adjust the pH with an emulsion of 250g / L Ca(OH)2. The emulsion generally uses magnetic stirring to keep Ca(OH)2 in a suspended state. The pH of the whole-process fermentation broth is maintained at 6.5 - 7.5.

[0063] The following steps 8 and 9 are the application methods of fungal flocculant in the cell recovery process of Bacillus coagulans and Escherichia coli lactic acid fermentation broth.

[0064] 8. Flocculation and plate-frame filtration methods for Bacillus coagulans lactic acid fermentation broth.

[0065] After the fermentation of Bacillus coagulans is completed, the fermentation broth is generally pressed into a flocculation tank by air pressure.

[0066] (1) In the flocculation tank, adjust the pH of the fermentation broth to about 7.5, generally using a 20% NaOH solution for adjustment.

[0067] (2) Subsequently, add cationic etherified starch to a final concentration of 0.02 - 0.03 g / L, and stir for 20 - 60 min.

[0068] (3) Add fungal flocculant GappWZ69 pre - dissolved in water to a final concentration of not less than 0.03 g / L, and stir for 60 min - 120 min.

[0069] The above is the cell flocculation process. In the whole process, steps 1 - 3 are maintained at a temperature of 50 - 55 °C.

[0070] (4) After flocculation, heat the fermentation broth to 55 - 60 °C (generally limited by the highest temperature that viable Bacillus coagulans cells can withstand), and add eggshell powder. Generally, add eggshell powder in an amount of not less than 50 g per liter of the volume of the flocculated fermentation broth. The stirring speed is generally controlled at about 80 r / min to ensure that the eggshell powder is dispersed and suspended, and maintain stirring for about 20 min.

[0071] (5) Use a centrifugal pump or the air pressure of the flocculation tank to press the fermentation broth added with eggshell powder into a plate - and - frame filter press. The equipment used for plate - and - frame filtration is a 150 - type plate - and - frame filter press (equipped with a centrifugal pump), and the filter cloth is a 750A - type (filtration accuracy 1 - 5 microns) polypropylene filter cloth, which is a product of Zhejiang Huarui Mesh Cloth Co., Ltd. To prevent the temperature from dropping during the filtration process, first pass 55 °C hot water through the plate - and - frame to ensure that the plate - and - frame has a relatively high temperature. The initial filtrate of plate - and - frame filtration is a turbid liquid, which needs to be sent back to the flocculation tank for re - filtration through the plate - and - frame. After the filter cake is formed and the turbidity of the filtrate is significantly reduced, the filtrate can be collected. After all the filtrate is collected, mix the filtrate evenly for detecting the turbidity of the filtrate. Turbidity detection generally uses a Hangzhou Qiwei 200AS turbidity meter.

[0072] 9. Flocculation and plate - and - frame filtration of Escherichia coli lactic acid fermentation broth

[0073] The lactic acid fermentation broth of recombinant Escherichia coli can also be flocculated and filtered by the above method. Considering that Escherichia coli cells have a relatively weak tolerance to high temperatures, the temperature should be strictly controlled and the time appropriately shortened during the flocculation process, and attention should be paid to preventing the precipitation of calcium lactate due to local low temperature. The flocculation process is as follows. In the flocculation tank, adjust the pH of the fermentation broth to about 7.5, generally using 20% NaOH solution for adjustment. Subsequently, add cationic etherified starch to a final concentration of 0.02 - 0.03 g / L and stir for 20 - 25 min. Add fungal flocculant GappWZ pre-dissolved in water to a final concentration of not less than 0.03 g / L and stir for 30 - 40 min. The above is the cell flocculation process, and the temperature is maintained at 50 - 52 °C throughout the process. After flocculation, heat the fermentation broth to 52 °C (generally limited by the highest temperature that the used Escherichia coli strain can withstand), add eggshell powder, generally adding eggshell powder in an amount of not less than 50 g per liter of the volume of the flocculated fermentation broth. The stirring speed is generally controlled at about 80 r / min to ensure the dispersion and suspension of the eggshell powder, and maintain stirring for about 10 min. To prevent the temperature from dropping during the filtration process, first pass 55 °C hot water through the plate and frame to ensure a relatively high temperature of the plate and frame. Subsequently, press the above fermentation broth added with eggshell powder into the plate and frame filter. The equipment and filter cloth used are the same as those for the plate and frame filtration of Bacillus coagulans, and the operation method is also the same.

[0074] The strain information for the application performance test of the flocculant is as follows:

[0075] The Bacillus coagulans strains CICIM B0599 and CICIM B1821 were purchased from the China National Information Platform of Industrial Microorganisms Resources at Jiangnan University. The Bacillus coagulans ATCC7050 was purchased from Beijing Baocang Biotechnology Co., Ltd. The Bacillus coagulans CICC24628 and CICC10353 were purchased from the China National Center for Industrial Culture Collection of the China National Research Institute of Food and Fermentation Industries Co., Ltd. Escherichia coli Nissle 1917 was purchased from Tianjin Wuyuan Biotechnology Co., Ltd., with the product number YT1085. Nissle 1917 is an Escherichia coli strain with probiotic function developed in 1917 [Chen Xiang'e, Ling Peixue. Research progress of Escherichia coli Nissle 1917. Chinese Journal of Biochemical Pharmaceutics, 2011, (6): 493-495.], and it is one of the few Escherichia coli strains recognized as food-safe. The above-mentioned Escherichia coli Nissle 1917 is abbreviated as EcN, and the re-preservation has been entrusted to the China National Information Platform of Industrial Microorganisms Resources at Jiangnan University and Wuxi Xianqin Biotechnology Co., Ltd., with the preservation numbers CICIM B7501 and XQ05502 respectively. The Escherichia coli host strains YEC166 and YEC104 were screened by our research group in the early stage. Among them, YEC166 is the starting strain for constructing the patented strain YC166. The relevant content of the screening of YEC166 and YEC104 has been disclosed in the patent [Liang Yichen, Zhang Jinwen, Shen Wei, Chen Xianzhong, Yang Haiquan, Xia Yuanyuan, Chen Lei. A recombinant Escherichia coli producing tyrosol with a shortened fermentation cycle and its application. Chinese Invention Patent, ZL202110598376.7]. When applying for the above patent, the Escherichia coli YEC166 had been preserved, and the relevant information can be found in the above patent. YEC104 has been entrusted to the China National Information Platform of Industrial Microorganisms Resources at Jiangnan University and Wuxi Xianqin Biotechnology Co., Ltd. for re-preservation, with the preservation numbers CICIM B7502 and XQ 05505 respectively.

[0076] Plasmid pPL451 is a temperature-controlled expression vector [Love CA, Lilley PE and Dixon NE. Stable high-copy-number bacteriophage lambda promoter vectors for overproduction of proteins in Escherichia coli. Gene, 1996, 176(1-2):49-53]. Its complete sequence is publicly available in the nucleotide sequence database of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov), and the sequence accession number is: AB248919.1. In the previous work of our research group, according to the above sequence, GenScript Biotech Corporation was commissioned to chemically synthesize plasmid pPL451. The transformant Escherichia coli JM109 / pPL451 of the above plasmid has been entrusted to Wuxi Xianqin Biotechnology Co., Ltd. and the China National Information Platform for Industrial Microbial Resources of Jiangnan University for preservation, and the preservation numbers are: XQ05410 and CICIM B7503, respectively.

[0077] Example 1 Preparation method of GappWZ series fungal flocculants

[0078] Take the glycerol tube preservation of Ganoderma applanatum strain YL108, inoculate it on a PDA plate, and cultivate for about 14 days to obtain a mycelial culture. Further inoculate it on a solid slant of an eggplant bottle PDA. After a large amount of mycelia are formed, dig out the mycelia and inoculate them into a basic PDA liquid medium. After shaking flask culture at 30 °C for 7 days, transfer to a new basic PDA liquid medium at an inoculation amount of 10%. After shaking flask culture at 30 °C for 5 days, inoculate different fermentation media at a volume of 10%. Generally, after 7 days of fermentation, both the cell mass and the extracellular polysaccharide yield reach the maximum. The basic formula of the fermentation medium in the fermenter is the same as that in the material method of this patent. The addition of selenium is carried out as described in the literature, and the final contents are 0, 60 mg / L, 90 mg / L, and 100 mg / L, respectively.

[0079] In the final stage of fermentation, that is, 4 - 5 hours before the end, glucose is added to the fermentation broth. For the specific method, refer to "5. Preparation Method of GappWZ Series Fungal Flocculants" in the material method part of this patent, and continue fermentation until discharging the fermenter. After discharging the fermenter, directly press the fermentation broth into a plate and frame filter for filtration to obtain mycelium (filter cake) and filtrate (fermentation supernatant) respectively. Among them, the filter cake, that is, the mycelium part, is used for the extraction and detection of Ganoderma applanatum selenium - containing protein according to the literature method. The results show that the dry weight of the bacterial cells obtained by the fermentation tank fermentation method of this patent is about 2 times that of the shake - flask method described in the literature, generally ranging from 21 - 23 g / L. The selenium presence in the selenium - containing protein of Ganoderma applanatum mycelium obtained by the fermentation method of this patent is shown in Table 1. As can be seen from Table 1, when the selenium addition amount is 60 mg / L and 90 mg / L, the key quality indexes of selenium - containing protein in the mycelium: the content of selenium in the form of amino acids in protein selenium is 60% and 56% respectively. This data is basically consistent with the indexes of the fermentation mycelium obtained when the selenium addition amounts are 60 mg / L and 90 mg / L described in Example 3 of the literature [Shanyi Lan, Lin Zhao, Wei Shen, Menglian Yang, Xianzhong Chen, Haiquan Yang, Yuanyuan Xia. A highly selenium - tolerant and selenium - rich Ganoderma applanatum mutant strain and its application. Chinese invention patent, CN2023104574930.]. It can be seen that the method described in this patent is feasible for producing fungi with high protein - bound selenium content. When the selenium addition amount is 100 mg / L, there is a slight red selenium phenomenon in the mycelium, and the protein - bound selenium content in the bacterial cell protein is 43%, which is significantly lower than the case when the selenium addition amount is 90 mg / L, and it is no longer suitable for producing high - quality selenium - containing protein. There is a close relationship between the selenium content in the culture medium and the finally obtained protein - bound selenium content in the mycelium. As can be seen from Table 1, in the mycelium cultured from the fermentation broth with a selenium addition amount of 60 mg / L, the selenium content in the protein is significantly lower than that in the mycelium protein obtained by culturing with a culture medium with a selenium addition amount of 90 mg / L. Experiments show that further reducing the selenium content in the culture medium will further reduce the selenium content in the bacterial cell protein, which is obviously uneconomical. This patent takes the selenium addition amount in the culture medium of 60 mg / L - 90 mg / L as a reasonable range, which is suitable for the combined production of flocculants and bacterial cell selenium - containing protein.

[0080] Table 1 Selenium presence in the mycelium obtained by YL108 in fermentation media with different selenium contents

[0081] Selenium content in the fermentation medium 60mg / L 90mg / L 100mg / L Fermentation time 7d 7d 7d Cell mass (g / L) 21.7 22.1 23.2 Cell characteristics White White Light pink Selenium content in cell protein (mg / kg) 604 987 1056 Total content of selenium in amino acid form (mg / kg) 365 554 451 Proportion of selenium in amino acid form in total protein-bound selenium 60% 56% 43%

[0082] Note: Selenium in the form of amino acids refers to the total selenium in selenomethionine, selenocysteine, and methylselenocysteine detected.

[0083] The protein content in the filtrate of plate-and-frame filtration, which is the fermentation supernatant, is very low and is generally treated as waste. Since the fermentation supernatant of Ganoderma applanatum contains a large amount of polysaccharides and no clear application value has been found for these polysaccharides so far, it is generally treated as waste liquid. The four fermentation supernatants (filtrates of plate-and-frame filtration) obtained from fermentation with selenium addition amounts of 0, 60 mg / L, 90 mg / L, and 100 mg / L were collected and treated according to the steps of Material Method 5, which are specifically described as follows:

[0084] The filtrate obtained by filtration was further treated according to the method of "5. Preparation method of GappWZ series fungal flocculants" in the material method part of this patent. The basic steps are as follows: Heat to 45 - 47 °C and continuously stir and mix for 12 - 16 hr. After the reaction ends, adjust the pH to 7.0 - 8.0, add low-temperature alkaline protease to a final concentration of 10 - 50 U / L according to the nominal activity of the product, and stir at room temperature for 20 - 30 min. After the reaction ends, heat to above 70 °C and continuously stir for 1 - 2 hr. Add 2 - 2.5 times the volume of absolute ethanol, stir for 15 - 60 min, cool to room temperature, then centrifuge to obtain the precipitate, and dry it to obtain the fungal flocculant GappWZ. It is named according to the different selenium addition amounts in the fermentation medium during the fermentation stage: GappWZ0, GappWZ60, GappWZ90, GappWZ100. The fermentation broth with different selenium addition amounts has no obvious effect on the yield of the flocculant. Generally, the amount of GappWZ flocculant that can be prepared per liter of fermentation broth is 2 - 2.5 g / L.

[0085] Example 2 Preparation method of fungal flocculant Gapp

[0086] The fungal flocculant Gapp was obtained by directly precipitating the filtrate with alcohol and then drying it after fermenting Ganoderma applanatum YL108 according to the steps of Material Method 1 - 4 of this patent. It is named Gapp0, Gapp60, Gapp90, Gapp100 according to the different selenium addition amounts in the fermentation broth. The fermentation broth with different selenium addition amounts has no obvious effect on the yield of the flocculant. Generally, the amount of Gapp series flocculants that can be prepared per liter of fermentation broth is 2 - 2.5 g / L.

[0087] There are slight differences in the fermentation process for the preparation of the fungal flocculant Gapp and GappWZ. When preparing GappWZ, glucose needs to be added to the culture solution 4 - 5 hr before the end of fermentation, while this step is not included in the fermentation process for the preparation of Gapp. This step has a significant impact on the application effect of the flocculant (see Example 3), but no obvious effect is found on the fungal cell mass and the quality indexes of the selenoprotein in the cells. The protein quality indexes of the cells obtained during the preparation process of the Gapp series flocculants are exactly the same as those of the cells obtained by preparing GappWZ in Table 1, so they are not listed here.

[0088] Example 3 Application effect of fungal flocculant GappWZ

[0089] The five strains of Bacillus coagulans described in the materials and methods were subjected to lactic acid fermentation in a 15-L fermenter. The results showed that when the fermentation reached 24 h, the reducing sugar content in the fermentation broth was below 1%, and the lactic acid content no longer increased significantly. Among them, the lactic acid yield of ATCC7050 was the highest at 105 g / L, and the lactic acid yields of the other strains were all between 95 and 100 g / L, with little difference in the overall yield. At the end of fermentation, the cell density OD600 of CICIM B1821 was 13.4, and the OD 600 of the other strains was between 12.0 and 12.5.

[0090] The above fermentation broth was flocculated by the method of this patent. Referring to the method in step 8 of the materials and methods section, different groups were set up:

[0091] A: The group using cationic etherified starch alone (omitting step (3) in step 8);

[0092] B: The group using fungal flocculant GappWZ alone (omitting step (2) in step 8);

[0093] C: The group using cationic etherified starch and fungal flocculant GappWZ in combination (the same as step 8).

[0094] The results showed that normal plate-and-frame filtration could not be carried out after treating the fermentation broth with cationic etherified starch alone (group A) or the fungal flocculant GappWZ obtained by this patent (group B). When the fermentation broth was treated by the method described in "Materials and Methods 8" of this patent (group C), that is, first treated with cationic starch and then with the fungal flocculant GappWZ of this patent, filtration could be carried out. This indicates that cationic etherified starch and the fungal flocculant GappWZ obtained by this patent play a synergistic promoting role in the process of flocculating the lactic acid fermentation broth. The results are shown in Table 2.

[0095] Table 2 Filtration effect of Bacillus coagulans fermentation broth

[0096]

[0097]

[0098] Note: The Bacillus coagulans fermentation broth was first treated with cationic etherified starch and then with the fungal flocculant in the table.

[0099] As can be seen from Table 2, when the GappWZ series of fungal flocculants obtained by the patented method and cationic etherified starch are used to jointly treat the lactic acid fermentation broth of Bacillus coagulans CICIMB0599 and ATCC7050, high-efficiency flocculation of the bacteria can be achieved, and plate-and-frame filtration can be successfully realized. From the perspective of the filtration effect, the obtained filtrate has a high transparency, and the turbidity is below 5 NTU. The filter cake in the plate-and-frame can form a semi-dry cake-like body, meeting the customary requirements for solid-liquid separation in the fermentation industry. Similar results were also obtained when the fermentation broth fermented by several other strains of Bacillus coagulans was used for the test.

[0100] Comparative Example 1: Changing the addition amount of eggshell powder

[0101] The specific implementation method refers to Example 2, with the difference that in step 8 of the material method, the addition amount of eggshell powder in (4) is changed. The amount of eggshell powder used as a filter aid is generally 50 - 55 g per liter of fermentation broth. When the eggshell powder is less than 50 g / L, the filtration effect significantly decreases, and the turbidity of the filtrate is generally above 10 NTU, and the filtration process cannot be completed. Increasing the amount of eggshell powder has no obvious effect on the filtration effect but will increase the filtration cost.

[0102] Comparative Example 2: Changing the type of flocculant

[0103] The specific implementation method refers to Example 2, with the difference that the fermentation broth of Bacillus coagulans is treated with the Gapp0, Gapp60, Gapp90, and Gapp100 series of flocculants instead of the above-mentioned GappWZ. The results show that the Gapp flocculants also have a certain flocculation effect, but when the fermentation broth treated with cationic etherified starch and Gapp is passed through the plate-and-frame, only the first stage can proceed smoothly, and the plate-and-frame becomes blocked after about half of the filtrate has passed, and the entire filtration process cannot be completed smoothly.

[0104] Comparative Example 3: Changing the preparation method of the flocculant

[0105] There are three key steps in the preparation process of the GappWZ series of flocculants in this patent: 1) Add glucose to the fermentation broth 4 - 5 hours before the end of fermentation to ensure that the reducing sugar content at the end of fermentation should generally be between 10 - 20 g / L, and this step cannot be replaced by adding glucose after the end of fermentation; 2) Continuously stir and mix the filtrate after solid-liquid separation of the fermentation broth at 45 - 47 °C; 3) Treat with low-temperature alkaline protease. The use effect of the flocculant obtained by missing any one step is similar to that of the Gapp series of flocculants, that is, the fermentation broth flocculated by the obtained flocculant in combination with cationic etherified starch cannot completely pass through the plate-and-frame filtration.

[0106] In step 1) among the above three steps, namely adding glucose 4 to 5 hours before the end of fermentation, is the key step to ensure the quality of the flocculant. If it is later than this time, such as adding glucose 3 hours before the end of fermentation, the use effect of the obtained flocculant is basically the same as that of Gapp, and the due flocculation effect cannot be achieved. If glucose is added earlier than this time, although a qualified flocculant can be obtained, due to the long subsequent fermentation time, the glucose will be utilized by the bacteria, it is difficult to accurately control the content of reducing sugar in the fermentation broth at the end of fermentation, and at the same time, the situation of the bacteria growing again will occur. When the selenium addition amount in the fermentation broth is relatively high (such as when preparing the fermentation broth according to the amount of 90 mg / L), the phenomenon of red selenium will occur, resulting in the failure of the production of selenium-containing protein by the bacteria. Therefore, adding glucose 4 to 5 hours before the end of fermentation is the most reasonable operation method.

[0107] Considering that the price of low-temperature alkaline protease is relatively high, we conducted experiments with other proteases. The results showed that protease 2709 had a certain effect, but the turbidity of the final filtrate obtained after using the flocculant prepared therefrom for the flocculation of Bacillus coagulans was still above 10, and the filter cake contained a large amount of water, resulting in the phenomenon of rotten filter frames. Obviously, it is unlikely to be used in large-scale production. Other proteases such as papain and 1398 neutral protease were basically ineffective. Therefore, this patent selects low-temperature alkaline protease as the material that must be used for the preparation of GappWZ series flocculants.

[0108] Comparative Example 4 changes the selenium addition amount in the fermentation broth

[0109] During the production process of the fungal flocculant, the selenium addition amount in the fermentation broth has no obvious influence on the flocculation effect. Considering that the main product of the fermentation of Ganoderma applanatum mycelium is selenium-containing protein with a high amino acid selenium content, and the flocculant is only a by-product, it is a more reasonable choice to add 60 to 90 mg / L in actual production. Otherwise, if the bacterial protein itself loses its commercial value, the production of the flocculant will also face the problem of too high cost. For the convenience of narration, this patent names the flocculant obtained by directly precipitating and drying the supernatant of the fermentation broth obtained by fermenting with a selenium addition amount of 60 to 90 mg / L with alcohol as Gapp69, and the flocculant obtained by further treating with the low-temperature protease and other methods provided by this patent as GappWZ69. Obviously, the production process of the flocculant GappWZ69 is a process that can co-produce Ganoderma applanatum protein with a high selenium-containing amino acid content. No obvious influence on the quality and yield of the flocculant was found regarding the selenium addition situation. To avoid misunderstanding, this patent names the flocculant obtained by using the low-temperature protease and other methods provided by this patent as GappWZ. Among them, if the selenium addition amount in the fermentation medium is 60 to 90 mg / L, the obtained flocculant is called GappWZ69. Obviously, it can be considered that GappWZ69 is included in the GappWZ flocculant, and the two have equivalent quality, but only the production process of GappWZ69 can obtain a by-product, namely high-quality selenium protein.

[0110] Construction of Recombinant Escherichia coli for Producing Lactic Acid in Example 4

[0111] Recombinant Escherichia coli is also an important strain for lactic acid fermentation. To verify the role of fungal flocculant GappWZ in cell recovery from Escherichia coli lactic acid fermentation broth, our research group constructed recombinant lactic acid-producing bacteria using different Escherichia coli as chassis cells. First, a recombinant plasmid pPL451-BcLdh that controls the expression of the key enzyme gene for lactic acid synthesis was constructed, transformed into different Escherichia coli, and lactic acid fermentation broth was obtained by fermentation. Further, the application effect of fungal flocculant GappWZ69 was tested.

[0112] First, a recombinant plasmid pPL451-BcLdh expressing the key enzyme gene for lactic acid synthesis, lactate dehydrogenase gene, was constructed. The construction process is as follows:

[0113] Based on the genome sequence of Bacillus coagulans (NCBI accession number: CP009709, National Center for Biotechnology Information, USA), primers for amplifying lactate dehydrogenase Ldh (gene number: BF29_3038, L-lactate dehydrogenase) were designed as follows:

[0114] PL01: CGTCTGCAGAAGCTTCTAGTTAAGGAGGATTCTTATGAAAAAAGTCAATCGTAT;

[0115] PL02: GGTACCCGGGAGCTCGAATTTTACAATATCGGTGCCATT.

[0116] Using the chromosomal DNA of Bacillus coagulans ATCC7050 as a template, PCR was performed with the above PL01 and PL02 as primers to obtain the lactate dehydrogenase gene ldh of Bacillus coagulans. After the PCR product was recovered by gel extraction, it was mixed with the vector pPL451 digested with EcoRI and ligated using a one-step cloning kit. The ligation product was transformed into Escherichia coli JM109, and the transformants were used to extract plasmids and identified by enzyme digestion. There are recognition sites for BamHI and SmaI upstream and downstream of the EcoRI recognition site of the vector pPL451. The plasmid extracted from the transformants was digested with BamHI and SmaI to obtain fragments of approximately 4.2 kb and 1.0 kb, which were consistent with the vector pPL451 and the coding region of the ldh gene, respectively. It was proved that the obtained plasmid was a recombinant plasmid obtained by recombination of pPL451 and the gene ldh. This plasmid was named pPL451-BcLdh. In the recombinant plasmid, the lactate dehydrogenase gene was placed downstream of the PR-PL promoter of λ-phage, and its expression was controlled by temperature.

[0117] The recombinant plasmid pPL451 - BcLdh was separately transformed into Escherichia coli Nissle 1917, YEC166 and YEC104, and the recombinant Escherichia coli Nissle 1917 / pPL451 - BcLdh, YEC166 / pPL451 - BcLdh and YEC104 / pPL451 - BcLdh were obtained respectively. For the convenience of narration, the above - mentioned Escherichia coli were named EcN - Ldh, YEC166 - Ldh and YEC104 - Ldh respectively. The above - mentioned recombinant bacteria were fermented in a fermenter by the aerobic - low oxygen supply method described in the literature [Zhou Li], and the specific method can be seen in the material method part of this patent.

[0118] Judging from the fermentation results, the time of the first stage (aerobic stage, i.e., the cell growth stage) of the 15L tank fermentation of YEC166 - Ldh was 18 hr, and the acid - producing stage was 36 hr. The final cell density OD 600 was 20 - 22, and the final concentration of lactic acid in the fermentation broth was 85 - 90 g / L. The time of the first stage (aerobic stage, i.e., the cell growth stage) of the 15L tank fermentation of the other strains was 24 hr, and the acid - producing stage was 36 hr. The final cell density OD600 was 19 - 21, and the final concentration of lactic acid in the fermentation broth was about 80 - 85 g / L. The overall differences among the strains were not significant.

[0119] Example 5 Application of fungal flocculant GappWZ in cell recovery of Escherichia coli lactic acid fermentation broth

[0120] For the fermentation results of the above three strains of Escherichia coli, the lactic acid content was between 80 - 90 g / L, and the difference was not obvious. The above - mentioned fermentation broth was flocculated by the flocculation method of material method 9 in this patent and then assisted by eggshell powder for plate - and - frame filtration. The test results of YEC166 - Ldh are shown in Table 2. As can be seen from Table 2, the lactic acid fermentation broth of Escherichia coli YEC166 - Ldh was flocculated by the method of this patent, that is, first treated with cationic etherified starch and then flocculated with GappWZ series flocculants, and then 50 g of eggshell powder per liter of fermentation broth was used as a filter aid. Finally, the plate - and - frame filtration process could be completed. Compared with Bacillus coagulans, the turbidity of the filtrate obtained from Escherichia coli was slightly higher, and the filtration time was prolonged, but the filtration process could be completed. The obtained filter cake was a formed semi - dry filter cake, meeting the habitual requirements of plate - and - frame filtration in fermentation industry. The result was similar to that of the application to Bacillus coagulans. The fermentation broth treated with the fungal flocculant Gapp and cationic etherified starch as a control could not smoothly complete the whole filtration process. The filtration process could not be completed by using the fungal filter aid or cationic etherified starch alone. The same test was carried out on the recombinant Escherichia coli EcN - Ldh and YEC104 - Ldh, and the obtained results were the same.

[0121] Table 3 Flocculation effects of different flocculants on Escherichia coli YEC - Ldh

[0122]

[0123]

[0124] This patent conducted flocculation tests on the lactic acid fermentation broth of multiple strains of Bacillus coagulans and recombinant bacteria constructed with different Escherichia coli chassis cells. The results showed that GappWZ could generally achieve the flocculation of cells in the fermentation broth and successfully achieve plate-and-frame filtration with eggshell powder as a filter aid. From the experimental results, GappWZ has a certain universality in the cell flocculation effect of lactic acid fermentation broth using different Bacillus coagulans and different Escherichia coli as chassis cells.

[0125] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A fungal flocculant GappWZ, characterized in that, The preparation method of the fungal flocculant GappWZ is as follows: (1) Ferment Ganoderma applanatum YL108 and collect the fermentation supernatant; (2) Perform protease enzymolysis on the fermentation supernatant obtained in step (1), heat it to above 70 °C after enzymolysis, and stir for at least 1 h; (3) Perform alcohol precipitation to obtain the fungal flocculant GappWZ; The preservation number of Ganoderma applanatum YL108 is CCTCC NO: M 20221347.

2. The fungal flocculant GappWZ according to claim 1, wherein In step (1), glucose is supplemented to a final concentration of 25 - 30 g / L 4 - 5 h before the end of fermentation.

3. The fungal flocculant GappWZ according to claim 2, wherein The enzymolysis in step (2) is to heat the fermentation supernatant to 45 - 47 °C, stir and mix for 12 - 16 h, then adjust the pH to 7.0 - 8.0, and add protease to a final concentration of 10 - 50 U / L for reaction.

4. The fungal flocculant GappWZ according to claim 3, wherein The protease includes but is not limited to low-temperature alkaline protease.

5. The fungal flocculant GappWZ according to any one of claims 1 to 4, characterized in that, The alcohol precipitation is to add 2 - 2.5 times the volume of ethanol and react for more than 60 min, and collect the precipitate; the precipitate can be used directly or after drying.

6. A method for solid-liquid separation of lactic acid fermentation broth, characterized in that, Add cationic etherified starch, the fungal flocculant GappWZ according to any one of claims 1 - 5, and eggshell powder to the lactic acid fermentation broth in sequence for reaction, and then perform filtration.

7. The method according to claim 6, wherein The filtration includes but is not limited to plate and frame filtration.

8. The method according to claim 7, wherein It includes the following steps: (1) Adjust the pH of the lactic acid fermentation broth to 7 - 8; (2) Add cationic etherified starch with a final concentration of 0.02 - 0.03 g / L to the fermentation broth treated in step (1), and stir for 20 - 60 min; (3) Add the fungal flocculant GppWZ according to claim 1 to the fermentation broth treated in step (2) to a final concentration of not less than 0.03 g / L, and stir for 60 - 120 min to obtain a flocculated fermentation broth; (4) Add not less than 50 g / L of eggshell powder to the flocculated fermentation broth described in step (3), and stir for 10 - 30 min; (5) Perform solid-liquid separation of the fermentation broth by plate and frame filtration on the fermentation broth treated in step (4); The temperature of the system is maintained at 50 - 60 °C in steps (1) - (3); the temperature of the system is maintained at 55 - 60 °C in steps (4) - (5).

9. Use of the fungal flocculant GappWZ according to any one of claims 1 to 5 in flocculating a fermentation broth, characterized in that, React the fermentation broth with cationic etherified starch and the fungal flocculant GappWZ according to any one of claims 1 - 5 for a period of time; the fermentation broth includes but is not limited to lactic acid fermentation broth.

10. Application of the fungal flocculant GappWZ according to any one of claims 1 - 5 or the method according to any one of claims 6 - 9 in the food field.

Citation Information

Patent Citations

  • Tyrosol-producing recombinant escherichia coli capable of shortening fermentation period and application thereof

    CN113493758A

  • Method for preparing lucid ganoderma mycelium liquid from slag water generated in production of starch

    CN102369837A

  • Traditional Chinese medicine preparation for treating insomnia, amnesia and neurasthenia and preparation method thereof

    CN111588756A

  • Preparation method and application of malt syrup

    CN113881735A

  • High-selenium-resistance selenium-rich ganoderma applanatum mutant strain and application thereof

    CN116769609A