SNP (Single Nucleotide Polymorphism) marker influencing fine cashmere goat and application of SNP marker

Abstract

The invention belongs to the technical field of genetic breeding, and particularly relates to an SNP marker influencing a fine cashmere goat and application thereof.The SNP marker comprises a first marker and / or a second marker, and the first marker and / or the second marker influence the fine cashmere size of the cashmere goat; the first marker is located at the 48854986 position on the No.6 chromosome of the down producing goat genome and mutates from G to A, and the second marker is located at the 76025546 position on the No.14 chromosome of the down producing goat genome and mutates from T to C.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a SNP marker affecting fine-wool large cashmere goats and an application thereof. Background Art

[0002] The Inner Mongolia Cashmere Goat is an excellent local livestock breed bred through long-term natural selection and artificial system selection. It was listed in the "National Livestock and Poultry Variety Protection List" in 2000, and in the "National Livestock and Poultry Genetic Resources Protection List" in 2006. In 2008, the conservation area of the Inner Mongolia Cashmere Goat was determined as a national conservation farm and protection area. It is a livestock breed that the state explicitly prohibits from export. The cashmere produced by the Inner Mongolia Cashmere Goat has the advantages of being fine, soft, and shiny, and is deeply loved by consumers at home and abroad. It is the only export livestock product in my country with pricing power, and it has played an important role in economic development. With the changes in feeding methods and environment, the cashmere produced by the Inner Mongolia Cashmere Goat has a tendency to become coarser, which does not meet people's original intention of pursuing cashmere quality. Therefore, reducing the fineness of cashmere has become one of the problems to be solved urgently. The weight trait is equally important for the Inner Mongolia Cashmere Goat, which is a dual-purpose cashmere and meat type. Breeding heavier cashmere goats means that it will bring more economic income to farmers and herdsmen. The existing technology does not consider "fine cashmere" and "large body" at the same time. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a SNP marker affecting fine-wool large cashmere goats and application thereof.

[0004] A SNP marker affecting fine-wool large cashmere goats, the SNP marker comprising marker one and / or marker two;

[0005] The marker 1 is located at position 48854986 on chromosome 6 of the cashmere goat genome, and a mutation from G to A has occurred;

[0006] The marker 2 is located at position 76025546 on chromosome 14 of the cashmere goat genome, and a T to C mutation occurs;

[0007] The marker 1 and / or the marker 2 affect the size of the fine wool of cashmere goats.

[0008] Molecular markers, wherein the molecular markers include the marker one and / or the marker two;

[0009] The nucleotide sequence of the molecular marker containing the Marker 1 is shown in SEQ ID NO.1, specifically: CATTTTCAGAATGATAATTCTATCTTCAATTCTTTTTAAGCACTTTTC TAAATTACTGACTTTTTATTTGGAATATTTTCATGTGTTGTAGAAAAGGTC AG(A)TTGTGGTCAGTCTCCTTAATATGACAGAAACTATGCTCTTTATTTAA TATGATATTTTAAGAAAATAATTTTATAAATAGTGAAACATTTTTTAATTGT C, showing the sequences of 100bp upstream and downstream of the mutation marker, the bold part is the mutation marker, and the content in the brackets is the mutated marker;

[0010] The nucleotide sequence of the molecular marker containing the Marker 2 is shown in SEQ ID NO.2, specifically: TATTCAAATTACCACTTGTATAATTTTCTATTCACTTGAAGAACTGTG TTTATTATTTCTAATAGTTCAATTTGGCTGATTAATTTGATCAGCTTCTTTAT(C)ACTGATATATTTTTTATCTTGCTTCATTTTTTTTAAAATGATTATTTGGCTGGATAGAGAATTATAGTTAATAATTGTTTCTTTGGTTTACATGCTAGTT, showing the sequences of 100bp upstream and downstream of the mutation marker, the bold part is the mutation marker, and the content in the brackets is the mutated marker.

[0011] The application of the SNP marker in identifying the fineness trait and body weight of cashmere goats, wherein the SNP marker includes the Marker 1 and / or the Marker 2.

[0012] Preferably, the method for the SNP marker to identify the fineness trait and body weight of cashmere goats includes the following steps:

[0013] Detect the Marker 1 on chromosome 6 of cashmere goats. The cashmere goats with a G to A mutation in the Marker 1 have fine cashmere;

[0014] Detect the Marker 2 on chromosome 14 of the cashmere goats with fine cashmere. The cashmere goats with a T to C mutation in the Marker 2 have fine cashmere and a large body size.

[0015] The application of the SNP marker in goat genetic breeding, wherein the SNP marker includes the Marker 1 and the Marker 2.

[0016] Preferably, a G-to-A mutation occurs in the first marker and a T-to-C mutation occurs in the second marker for fine-wool and heavy-body cashmere goats.

[0017] Preferably, the cashmere goats include Inner Mongolia cashmere goats.

[0018] A genetic method for fine-wool and heavy-body cashmere goats, by selecting individuals with the AA genotype as parents, to reduce the fineness of the wool in the offspring and increase the body weight of the offspring.

[0019] Preferably, the cashmere goats include Inner Mongolia cashmere goats.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] The present invention provides an SNP marker that simultaneously affects fine-wool and heavy-body cashmere goats. By selecting individuals with the AA genotype as the male parent or female parent, the fineness of the wool in the offspring can be reduced and the body weight of the offspring can be increased. Description of the Drawings

[0022] Figure 1 Shows the population variation characteristics of Inner Mongolia cashmere goats. Among them, (a) shows the genome-wide distribution of detected variations on 29 chromosomes of Inner Mongolia cashmere goats. The X-axis represents 29 autosomes, and the Y-axis represents the number of variations. (b) shows the genome-wide annotation of genetic variations of Inner Mongolia cashmere goats. The X-axis represents various functional regions, and the Y-axis represents the number of genetic variations in different functional regions. (c) shows the statistical results of the variant function annotation in the CDS region. The X-axis represents various functions, and the Y-axis represents the number of genetic variations in various functions;

[0023] Figure 2 Is a principal component analysis plot, with the first three explained variance percentages (PC1, PC2, and PC3) as the X, Y, and Z axes;

[0024] Figure 3 Is a distribution plot of SNPs in 1Mb windows on chromosomes after quality control. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size;

[0025] Figure 4 Manhattan Plots and QQ-plots show the GWAS results of fine wool in Inner Mongolia cashmere goats. Genome-wide significant SNPs are shown in red;

[0026] Figure 5 Manhattan Plots and QQ-plots show the GWAS results of body weight in Inner Mongolia cashmere goats. Genome-wide significant SNPs are shown in red. Detailed Embodiments

[0027] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the protection scope of the present invention is not limited by the specific embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0028] Example 1

[0029] Sources of experimental animals and phenotypes:

[0030] All the experimental sheep in this study were from the Erlangshan Ranch of Inner Mongolia Beiping Textile Co., Ltd. (the national conservation farm for Erlangshan white cashmere goats). The breeds of cashmere goats raised were all Erlangshan white cashmere goats. There were 7 areas in this breeding farm, and each area was responsible for the feeding by the shepherds. The phenotypic records of cashmere diameter (CD) and weight traits in 2022 were measured (Table 1). Ear tissue samples of 404 Erlangshan white cashmere goats were collected. All samples were immediately placed in liquid nitrogen for preservation after collection and stored at -80°C for a long time after being transported to the laboratory.

[0031] Table 1 Description of the traits of Inner Mongolia cashmere goats

[0032]

[0033] Adjustment of fixed effects

[0034] Fixed effects, that is, non-genetic factors, refer to all possible and known grades or levels in breeding and can be observed. The non-genetic factors of Inner Mongolia cashmere goats mainly include nutritional level, measurement year of production performance, season, group, age, birth type, and gender. The nutritional level, measurement year, season, and birth type of the traits involved in this study were the same, so they were not considered. One-way ANOVA was performed on the other three non-genetic factors (gender, age, area) to test the significance of the explanatory variables. Since the Erlangshan white cashmere goats were raised in a grouped mode and the interaction effect between gender and area was 0, in this study, only the two non-genetic factors of area and age were considered, and age was divided into three categories: growing sheep, one-year-old adult sheep, and two-year-old adult sheep.

[0035] Using SPSS (V25) software, through the type III sum of squares of analysis of variance, the two factors of age and area were simultaneously incorporated into a multiple linear model to test their effects on cashmere diameter and weight traits (Table 2).

[0036] Table 2 Effects of age and area on cashmere diameter and weight traits of Inner Mongolia cashmere goats in the multiple linear model

[0037]

[0038] As can be seen from Table 2, age and farm area showed significant effects on fleece fineness and body weight traits (P < 0.05). Therefore, age and farm area were used as fixed effects for fleece fineness and body weight traits in the GWAS model.

[0039] III. Genomic DNA Extraction and Quality Inspection

[0040] The phenol-chloroform method was used to extract DNA from ear tissue samples. A spectrophotometer (NanoDrop2000) was used to detect the DNA concentration, the absorption wavelength ratio of nucleic acid, protein and phenolic substances at the highest absorption peak (260 nm / 280 nm), and the absorption wavelength ratio of carbohydrates at the highest absorption peak (260 nm / 230 nm). The DNA quality was detected and evaluated using 1% agarose gel.

[0041] IV. Library Construction and Sequencing on the Machine

[0042] After the qualified genomic DNA samples were processed, the genomic DNA was randomly fragmented into fragments with a length of 350 bp using a Covaris ultrasonic crusher. The whole library preparation was completed through steps such as end repair, addition of poly(A), addition of sequencing adapters, purification, and PCR amplification. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and qPCR was used to accurately quantify the effective concentration of the library to ensure the library quality. After the library quality was detected and qualified, the BGI MGI-T7 sequencing platform was used for sequencing, and the sequencing mode was PE150 mode.

[0043] V. Identification, Screening and Annotation of Variant Markers

[0044] The Raw reads data was filtered into Clean reads data using the fastp software (V0.20.0). A genomic index was built for the reference genome. The quality-controlled Clean reads data was aligned with the reference genome of goats (ARS1, GCF_001704415.1) using the Burrows-Wheeler Aligner (BWA) software (V0.7.17). The SAMtools software (V1.8-20) was used to convert the aligned sam file into a bam file and sort the bam file. The MarkDuplicates program in the GenomeAnalysis Toolkit (GATK) software (V3.8) was used to remove duplicate data from the sorted bam file to obtain the final bam file. An index was built for the final bam file, and the HaplotypeCaller module in the GATK software was used for SNP variant detection. After obtaining the vcf file, the VariantFiltration module was used for filtering. The ANNOVAR software package was used to perform functional annotation on the detected gene variations. Based on the positions of the variant markers on the reference genome and the gene position information on the reference genome, the regions in the genome where the variant markers occurred (intergenic regions, intronic regions, CDS regions, etc.) and the effects of the variations (synonymous and non-synonymous mutations, etc.) could be obtained.

[0045] Whole-genome resequencing was performed on 404 individuals of Erlangshan white cashmere goats, generating a total of 26835.11 Gb of raw reads. After variant detection and strict quality control, a total of 39,509,854 variants were identified in the Inner Mongolia cashmere goat population, as Figure 1 shown in a. Then, using the gene annotation file downloaded from the Ensembl database to annotate all the detected variants in Inner Mongolia cashmere goats, it was found that the most variants were found in the intergenic region (59.09%) and intronic region (34.34%), as Figure 1 shown in b, and only 0.79% of them were located in the coding region, including 141,732 synonymous mutations and 120,751 non-synonymous mutations, as Figure 1 shown in c. These potential functional variants provide valuable genetic resources for exploring the genetic structure and functional genes of Inner Mongolia cashmere goats.

[0046] VI. Data Quality Control and Population Stratification Correction

[0047] The obtained genotyping data was subjected to quality control using Plink (V1.90) software. Individuals with a genotype call rate < 98%, SNPs with a call rate < 98%, SNPs with a minor allele frequency (MAF) < 5%, and SNPs with a Hardy-Weinberg equilibrium (HWE) test P-value < 10-6 were excluded. The first three principal components were calculated using the "--pca3" parameter of Plink (V1.90) software, and the first 3 principal components were used as covariates to correct for population stratification in Inner Mongolia cashmere goats. PCA plots were drawn using R (V3.6.0), and the results are as Figure 2 shown. There was population stratification in the experimental samples, and the degree of genetic relatedness among individuals was relatively high. It was necessary to use the first 3 principal components as covariates to correct for population stratification in Inner Mongolia cashmere goats.

[0048] A total of 34,248,064 SNPs participated in quality control. 695,497 SNPs with a call rate less than 98% (--geno 0.02) were excluded. After the remaining markers were further filtered by Hardy-Weinberg equilibrium, minor allele frequency, and individual call rate (--maf 0.05, --hwe 1e-6, --mind 0.02), a total of 17,135,082 SNP markers were obtained for subsequent analysis. These markers were evenly distributed on the 29 pairs of autosomes of goats ( Figure 3 ).

[0049] VII. Genome-wide association study

[0050] The fastGWA-mlm model in GCTA (V1.94.0beta) software was used to perform association analysis between SNPs and fineness and body weight traits.

[0051] y = X snp β snp + X c β c + g + e

[0052] where y is an n×1 phenotypic vector; X snp is the genotype vector with an effect of β snp ; X c is the association matrix of fixed covariates (age, farm area, and the first 3 PCAs), and its corresponding coefficient is β c ; g is the vector of the total genetic effect captured by the genetic relationship matrix (GRM) derived from SNPs, π is the vector of the GRM derived from SNPs, where all non-diagonal elements are set to 0; e is the residual vector,

[0053] Since the use of the Bonferroni correction method to determine the significance threshold of GWAS is too strict, in this study, the threshold for genome-wide significant association was adjusted to P = 1×10 -6 . The genomic inflation factor (i.e., λ) of the test statistic was calculated by the slope of the linear regression between the observed and theoretical quantiles in R (V3.6.0). After calculation, the λ value of the fiber fineness trait was 1.023, and the λ value of the body weight trait was 1.032, indicating no genomic expansion. Based on the re-sequencing data of 404 Erlang Mountain white cashmere goats, 35 significant SNP markers related to the fiber fineness trait were detected, and these markers were located on chromosomes 3, 6, 10, 14, and 29 respectively, as shown in Table 3 and Figure 4 ; 44 significant SNP markers related to the body weight trait were detected, and these markers were located on chromosomes 5, 8, 9, 10, 11, 14, 15, and 18 respectively, as shown in Table 4 and Figure 5 .

[0054] Table 3 Significant SNP markers related to the fiber fineness trait

[0055]

[0056] Table 4 Significant SNP markers related to the body weight trait

[0057]

[0058]

[0059] VIII. SNPs Affecting Fiber Fineness and Body Weight Traits

[0060] Further study on the SNPs reaching the genome-wide significance level found that the G→A mutation at position 48854986 on chromosome 6 of the goat genome could significantly affect the fiber fineness trait of cashmere goats.

[0061] The association analysis between the SNP marker at position 48854986 on chromosome 6 of the goat genome and the fiber fineness trait is as follows:

[0062] Table 5 Polymorphism at position 48854986 on chromosome 6 of the goat genome

[0063]

[0064] Note: Different letters indicate significant differences (p < 0.05), and the same letter indicates no significant difference (p > 0.05).

[0065] As can be seen from Table 5, for individuals with the AA genotype, their wool is the finest; for individuals with the GG genotype, their wool is the coarsest.

[0066] In the genome-wide association study using the mixed linear model, the SNP molecular marker at position 48,854,986 on chromosome 6 of the goat genome reached the genome-wide significant level, indicating that this marker was significantly associated with the fineness trait of cashmere goats. When this marker mutated to A, it was beneficial for cashmere goats to have finer wool.

[0067] Table 6 SNP gene frequencies and genotype frequencies at position 48,854,986 on chromosome 6 of the goat genome

[0068]

[0069] As can be seen from Table 6, the gene frequency of A was greater than that of G, indicating that A was the dominant allele; the genotype frequencies of AA and AG were both higher than that of GG, indicating that AA was the dominant genotype.

[0070] Further research on the SNP reaching the genome-wide significance level found that the T→C mutation at position 76,025,546 on chromosome 14 of the goat genome could significantly affect the body weight trait of cashmere goats.

[0071] The association analysis of the SNP marker at position 76,025,546 on chromosome 14 of the goat genome with the body weight trait is as follows:

[0072] Table 7 Polymorphism at position 76,025,546 on chromosome 14 of the goat genome

[0073]

[0074] Note: Different letters indicate significant differences (p < 0.05), and the same letter indicates no significant difference (p > 0.05).

[0075] As can be seen from Table 7, individuals with the CC genotype had a greater body weight compared to those with the TT genotype. In the genome-wide association study using the mixed linear model, the SNP molecular marker at position 76,025,546 on chromosome 14 of the goat genome reached the genome-wide significant level, indicating that this marker was significantly associated with the body weight trait of cashmere goats. When this marker mutated to C, it was beneficial for cashmere goats to have a larger body weight.

[0076] Table 8 SNP gene frequencies and genotype frequencies at position 48,854,986 on chromosome 6 of the goat genome

[0077]

[0078] As can be seen from Table 8, the gene frequency of C was greater than that of T, indicating that C was the dominant allele; the genotype frequencies of CC and CT were both higher than that of TT, indicating that CC was the dominant genotype.

[0079] Therefore, it can be seen that the fine-wool type cashmere goat breed can be selected by the G→A mutation at position 48854986 on chromosome 6 of the goat genome, the large-body type cashmere goat breed can be selected by the T→C mutation at position 76025546 on chromosome 14 of the goat genome, and by selecting individuals with AA and CC genotypes as the male or female parent, the fineness of the wool in the offspring can be reduced and the body weight of the offspring can be increased.

[0080] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range, as well as the two endpoints themselves, can be selected. To avoid repetition, the preferred embodiments of the present invention are described.

[0081] Although the preferred embodiments of the present invention have been described, once those skilled in the art learn the basic creative concept, additional changes and modifications can be made to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0082] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.

Claims

1. A SNP marker affecting fine-wool large Cashmere goats, characterized in that, The SNP markers include Marker 1 and / or Marker 2; Marker 1 is located at position 48854986 on chromosome 6 of the cashmere goat genome, with a G to A mutation; Marker 2 is located at position 76025546 on chromosome 14 of the cashmere goat genome, with a T to C mutation; Marker 1 and / or Marker 2 affect the large fine hair follicles of cashmere goats.

2. A molecular marker, characterized in that, The molecular marker contains Marker 1 and / or Marker 2; The nucleotide sequence of the molecular marker containing Marker 1 is as shown in SEQ ID NO.1; The nucleotide sequence of the molecular marker containing Marker 2 is as shown in SEQ ID NO.

2.

3. Use of the SNP marker described in claim 1 in identifying the fineness trait and body weight of cashmere goats, characterized in that, The SNP markers include Marker 1 and / or Marker 2.

4. The application according to claim 3, characterized in that, The method for identifying the fine cashmere trait and body weight of cashmere goats using the SNP markers includes the following steps: Detect Marker 1 on chromosome 6 of the cashmere goat. Cashmere goats with a G to A mutation in Marker 1 have fine cashmere; Detect Marker 2 on chromosome 14 of cashmere goats with fine cashmere. Cashmere goats with a T to C mutation in Marker 2 have large fine hair follicles.

5. Use of the SNP marker described in claim 1 in goat genetic breeding, characterized in that, The SNP markers include Marker 1 and Marker 2.

6. The application according to claim 5, wherein Cashmere goats with a G to A mutation in Marker 1 and a T to C mutation in Marker 2 have fine cashmere and large body weight.

7. The application according to claim 3 or claim 5, characterized in that The cashmere goats include Inner Mongolia cashmere goats.

8. A genetic method for cashmere goats with large and fine cashmere bodies, characterized in that, By selecting individuals with AA and CC genotypes as parents, the fineness of the villi in the offspring can be reduced and the body weight of the offspring can be increased.

9. The method according to claim 8, wherein The cashmere goats include Inner Mongolia cashmere goats.

Images