SNP (Single Nucleotide Polymorphism) molecular marker related to chicken intestinal tract hexanoic acid concentration and application thereof

Abstract

The invention relates to the technical field of molecular markers, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to chicken intestinal tract hexanoic acid concentration and application of the SNP molecular marker. The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to the concentration of chicken intestinal hexanoic acid, which can well distinguish the concentration of chicken intestinal hexanoic acid under a complex genetic background condition, and can efficiently and quickly distinguish individuals with high concentration of chicken intestinal hexanoic acid. The technical blank that poultry breed individuals with high intestinal hexanoic acid concentration through SNP molecular markers and genetic typing so as to improve the disease resistance is filled, and the disease-resistant breeding process of the poultry can be greatly promoted; the method is of great significance to reveal the correlation between the concentration of hexanoic acid in poultry intestinal tracts and disease resistance and explore the action mechanism of hexanoic acid in poultry disease resistance, provides a new genetic marker for poultry disease resistance breeding, and has important application value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly to SNP molecular markers related to the hexanoic acid concentration in chicken intestines and their applications. Background Art

[0002] Poultry such as white - feather broilers and fast - growing yellow - feather broilers, due to the high - intensity selection for growth performance, have their body metabolism in an overloaded state. The internal environmental stability and physiological balance of the body are affected, resulting in a decrease in immune performance and disease resistance, causing significant economic losses to the poultry farming industry. The core goal of disease - resistant breeding is to improve the resistance of individual poultry to various diseases. This process not only relies on traditional phenotypic selection but also incorporates modern breeding techniques such as genomic selection, immunological breeding, and gene editing. Genomic selection conducts more precise breeding selection by analyzing molecular markers related to disease resistance (such as SNPs and genotype data). In recent years, with the application of genome - wide association study (GWAS) technology, key genes related to disease resistance can be discovered more quickly, and efficient selection can be carried out based on genomic information. Currently, the ratio of heterophils to lymphocytes (heterophil / lymphocyte, H / L) is a known indicator highly related to poultry stress resistance and disease resistance, and genetic variation loci related to H / L have been screened through GWAS, and the related loci have been applied to marker - assisted selection and genomic selection. However, the H / L value of poultry is easily affected by the external environment. For example, stress, allergy, etc. can all cause fluctuations in the H / L value.

[0003] Hexanoic acid is a short - chain fatty acid widely present in various animals and plants. Studies have found that hexanoic acid plays an important physiological role in poultry, especially in regulating the intestinal microecology, improving immune function, and disease resistance.

[0004] In poultry farming, intestinal health is crucial for production performance and immunity. Short - chain fatty acids (SCFAs) in the intestine, especially hexanoic acid (C6), as the products of intestinal microbial metabolism, play an important role in the intestinal environment and the health of poultry. Hexanoic acid not only helps maintain intestinal barrier function, promotes the growth of beneficial bacteria, but also inhibits the growth of harmful pathogens by regulating the immune system, thereby improving the disease resistance of poultry.

[0005] Hexanoic acid is mainly produced by the fermentation of dietary fiber and carbohydrates by gut microbiota. Studies have found that there are significant differences in the concentration of hexanoic acid among different poultry individuals, with a strong selection pressure and being genetically regulated. The concentration of hexanoic acid in the poultry intestine is closely related to its disease resistance, and the hexanoic acid concentration is positively correlated with the intestinal health of poultry. Existing studies have shown that hexanoic acid can inhibit the growth of harmful pathogens by reducing the intestinal pH value, and can also enhance the barrier function of intestinal epithelial cells, reducing the invasion of pathogenic microorganisms. In addition, hexanoic acid can improve intestinal health by changing the structure of the gut microbiota, and improve the disease resistance of the body by activating the immune response of intestinal epithelial cells; for example, hexanoic acid can inhibit the invasion of pathogenic microorganisms and enhance the resistance of poultry to common pathogens by promoting the differentiation and proliferation of intestinal epithelial cells and enhancing the intestinal barrier function.

[0006] In recent years, with the development of genomics technology, genome-wide association study (GWAS) has become an important means to study the genetic basis of complex traits. Through GWAS, genetic variations related to the concentration of short-chain fatty acids (especially hexanoic acid) in the poultry intestine can be revealed, providing new ideas for improving poultry intestinal health and production performance.

[0007] Although existing studies have explored the functions and roles of hexanoic acid in the intestine, there is currently no research report on molecular markers related to the concentration of hexanoic acid in the poultry intestine. Therefore, developing molecular markers related to the concentration of hexanoic acid in the poultry intestine is of great significance for deeply understanding the genetic mechanism of intestinal hexanoic acid concentration, identifying gene loci related to intestinal hexanoic acid concentration and providing molecular markers for poultry breeding, and further helping to select individuals with better intestinal health and immune function. Summary of the Invention

[0008] The present invention provides SNP molecular markers related to the hexanoic acid concentration in chicken intestine and their applications.

[0009] Currently, the SNP molecular markers for the concentration of hexanoic acid in the poultry intestine are still vacant, which is one of the key bottlenecks in poultry disease-resistant breeding. Based on genome-wide association analysis, the present invention screens SNP molecular markers related to the hexanoic acid concentration in chicken intestine, screens SNP molecular markers from the whole-genome SNP markers of chickens, obtains 54 SNP molecular markers significantly related to the intestinal hexanoic acid concentration, and identifies 2 causal variant sites highly related to the hexanoic acid concentration in chicken intestine through fine mapping analysis. These sites can well distinguish the high and low levels of the hexanoic acid concentration in chicken intestine under complex genetic background conditions, and can be used to efficiently and quickly distinguish individuals with high hexanoic acid concentration in chicken intestine, and then select individuals with stronger disease resistance.

[0010] Specifically, the present invention provides the following technical solutions.

[0011] In a first aspect, the present invention provides SNP molecular markers related to the caproic acid concentration in chicken intestines, and the SNP molecular markers include one or both of the following (1)-(2): (1) A nucleotide sequence with a polymorphism of G / T at the 51st position of the sequence shown in SEQ ID NO:1; (2) A nucleotide sequence with a polymorphism of C / T at the 51st position of the sequence shown in SEQ ID NO:2.

[0012] SEQ ID NO:1: TACCTGAATAAATGTAAAAGGCATAGGGAAAGATGAAGTCTTCACTGCATKCTGTCCAATATTGCTATGGGACATAGCAATATATAACTTGGCCAGCAGTT.

[0013] SEQ ID NO:2: GCATCGAGGATGCTTTTTCCTTTTTTTCCTTTTTTTTTTTTTTTCCTCATYGTGTTTTTTGCAATTGGAGAAATCCAAAGAAAAGAAATTGCTTTTGGCAC.

[0014] In the present invention, in the sequence shown in SEQ ID NO:1, K represents G / T; in the sequence shown in SEQ ID NO:2, Y represents C / T.

[0015] The polymorphic site of the SNP molecular marker described in the above (1) is located at position 15238328 on chromosome 7 of the chicken seventh edition genome data GRCg7b, and the polymorphism is G / T.

[0016] The polymorphic site of the SNP molecular marker described in the above (2) is located at position 15315697 on chromosome 7 of the chicken seventh edition genome data GRCg7b, and the polymorphism is C / T.

[0017] The SNP molecular markers described in the above (1) and (2) are both significantly related to the high or low caproic acid concentration in chicken intestines, and belong to causal variation sites highly related to the caproic acid concentration in chicken intestines, and can well distinguish the high or low caproic acid concentration in chicken intestines. Therefore, these two SNP molecular markers can be used separately or in combination to predict or identify the high or low caproic acid concentration in chicken intestines.

[0018] In some embodiments of the present invention, the SNP molecular marker includes the SNP molecular marker described in the above (1), or includes the SNP molecular marker described in the above (2).

[0019] In some embodiments of the present invention, the SNP molecular markers include a combination of the SNP molecular markers described in the above (1) and (2).

[0020] For the convenience of detection, the present invention has developed primers for amplifying the SNP molecular markers based on the polymorphic sites located on chromosome 7 of the chicken seventh edition genomic data GRCg7b and their upstream and downstream sequences. Combining the upstream and downstream sequences of the above polymorphic sites, the present invention has obtained the sequences shown in SEQ ID NO:1 and SEQ ID NO:2. Those skilled in the art can understand that different length sequence fragments can be developed based on the above polymorphic sites and their upstream and downstream sequences as SNP molecular markers for the amplification and detection of the polymorphic sites. Therefore, the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 do not constitute a limitation to the SNP molecular markers of the present invention. As long as the sequence fragments located at positions 15238328 and 15315697 on chromosome 7 of the chicken seventh edition genomic data GRCg7b are included, they are within the protection scope of the SNP molecular markers of the present invention.

[0021] In some embodiments of the present invention, in the above (1), the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:1, the polymorphic site is located at the 51st position of the sequence shown in SEQ ID NO:1, and the polymorphism is G / T. In the above (2), the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:2, the polymorphic site is located at the 51st position of the sequence shown in SEQ ID NO:2, and the polymorphism is C / T.

[0022] In the above (1), the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotype is GT or TT, corresponding to a low caproic acid concentration.

[0023] In the above (2), the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotype is CT or TT, corresponding to a low caproic acid concentration.

[0024] In the second aspect, the present invention provides primers for amplifying the above-described SNP molecular markers related to the caproic acid concentration in chicken intestines.

[0025] Based on the position of the polymorphic site of the SNP molecular marker provided above in the genome and its upstream and downstream sequences, those skilled in the art can develop various types of primers for amplifying the SNP molecular marker.

[0026] The above-described primers can be any primers capable of detecting the genotype of the SNP molecular marker, including but not limited to ordinary PCR primers, ARMS PCR primers, KASP primers, etc.

[0027] In a third aspect, the present invention provides a detection reagent, which comprises the primers described above.

[0028] The detection reagent described above can be a set of detection reagents or a kit. In addition to the above-mentioned primers, it can also contain other reagents for PCR amplification or SNP genotyping, including but not limited to DNA polymerase, PCR reaction buffer, dNTP, Mg 2+ , water, etc.

[0029] In a fourth aspect, the present invention provides any one of the following (1)-(8) applications of the above-mentioned SNP molecular marker, primer or detection reagent: (1) Predicting the caproic acid concentration or disease resistance traits of chicken intestines; (2) Screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; (3) Breeding chickens with high intestinal caproic acid concentration or high disease resistance; (4) Breeding the caproic acid concentration or disease resistance traits of chicken intestines; (5) Molecular marker-assisted breeding related to the caproic acid concentration or disease resistance traits of chicken intestines; (6) Variety improvement related to the caproic acid concentration or disease resistance traits of chicken intestines; (7) Preparing a reagent for predicting the caproic acid concentration or disease resistance traits of chicken intestines; (8) Preparing a reagent for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance.

[0030] In a fifth aspect, the present invention provides any one of the following (1)-(8) applications of the SNP molecular marker or the detection reagent of the SNP molecular marker: (1) Predicting the caproic acid concentration or disease resistance traits of chicken intestines; (2) Screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; (3) Breeding chickens with high intestinal caproic acid concentration or high disease resistance; (4) Breeding the caproic acid concentration or disease resistance traits of chicken intestines; (5) Molecular marker-assisted breeding related to the caproic acid concentration or disease resistance traits of chicken intestines; (6) Variety improvement related to the caproic acid concentration or disease resistance traits of chicken intestines; (7) Preparing a reagent for predicting the caproic acid concentration or disease resistance traits of chicken intestines; (8) Preparing a reagent for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; Wherein, the SNP molecular marker includes one or both of the following (1)-(2): (1) The polymorphic site of the SNP molecular marker is located at position 15238328 on chromosome 7 of the seventh version of the chicken genome data GRCg7b, and the polymorphism is G / T; (2) The polymorphic site of the SNP molecular marker is located at position 15315697 on chromosome 7 of the seventh version of the chicken genome data GRCg7b, and the polymorphism is C / T.

[0031] In the present invention, the chicken is preferably Guangming No. 2 white - feather broiler. The intestinal caproic acid concentration is preferably the cecal caproic acid concentration.

[0032] In the above (1), the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotypes are GT or TT, corresponding to a low caproic acid concentration.

[0033] In the above (2), the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotypes are CT or TT, corresponding to a low caproic acid concentration.

[0034] In some embodiments of the present invention, the SNP molecular marker in the above (1) is a nucleotide sequence with a polymorphism of G / T at position 51 containing the sequence shown in SEQ ID NO:1. The SNP molecular marker in the above (2) is a nucleotide sequence with a polymorphism of C / T at position 51 containing the sequence shown in SEQ ID NO:2.

[0035] In some embodiments of the present invention, in the above (1), the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:1, the polymorphic site is located at position 51 of the sequence shown in SEQ ID NO:1, and the polymorphism is G / T. In the above (2), the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:2, the polymorphic site is located at position 51 of the sequence shown in SEQ ID NO:2, and the polymorphism is C / T.

[0036] Preferably, the detection reagent for the SNP molecular marker includes the detection primers for the SNP molecular marker.

[0037] In the sixth aspect, the present invention provides a method for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance, the method comprising: detecting the SNP molecular marker related to the chicken intestinal caproic acid concentration in the chickens to be screened, and determining the chickens with high intestinal caproic acid concentration or high disease resistance according to the genotype of the SNP molecular marker; wherein, the SNP molecular marker is one or both of the following (1) - (2): (1) The polymorphic site of the SNP molecular marker is located at position 15238328 on chromosome 7 of the chicken seventh edition genomic data GRCg7b, and the polymorphism is G / T; (2) The polymorphic site of the SNP molecular marker is located at position 15315697 on chromosome 7 of the chicken seventh edition genomic data GRCg7b, and the polymorphism is C / T.

[0038] In the above (1), the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotype is GT or TT, corresponding to a low caproic acid concentration.

[0039] In the above (2), the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotype is CT or TT, corresponding to a low caproic acid concentration.

[0040] The beneficial effects of the present invention at least include: The present invention provides SNP molecular markers related to the caproic acid concentration in chicken intestines, which can well distinguish the high and low caproic acid concentrations in chicken intestines under complex genetic background conditions, and can efficiently and quickly distinguish individuals with high caproic acid concentration in chicken intestines, filling the technical gap in breeding individuals with high caproic acid concentration in poultry intestines through SNP molecular markers and gene typing to improve disease resistance, and can greatly promote the poultry disease resistance breeding process; it is of great significance for revealing the correlation between the caproic acid concentration in poultry intestines and disease resistance and exploring its mechanism of action in poultry disease resistance, providing new genetic markers for poultry disease resistance breeding, and having important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0042] Figure 1 It is the normal distribution diagram of the caproic acid concentration in the intestines of Guangming No. 2 white - feather broilers in Example 1 of the present invention.

[0043] Figure 2 It is the SNP distribution diagram and PCA population structure diagram of the sample genome in Example 1 of the present invention.

[0044] Figure 3 It is the GWAS Manhattan diagram of the caproic acid concentration in the intestines and the LD heat map of significant loci in Example 1 of the present invention.

[0045] Figure 4 It is the fine - mapping analysis of the candidate region of the GWAS result in Example 1 of the present invention.

[0046] Figure 5 This is the phenotypic difference of different genotypes in the trait of caproic acid concentration in Example 1 of the present invention.

[0047] Figure 6 This is the result of dual-luciferase verification of the causal variation site of caproic acid concentration in chicken intestine in Example 1 of the present invention.

[0048] Figure 7 This is the result of correlation analysis between intestinal caproic acid concentration and the expression level of IFT70A gene in cecal tonsils in Example 1 of the present invention. Detailed implementation manners

[0049] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below with reference to the accompanying drawings in the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without making creative efforts shall fall within the protection scope of the present invention.

[0050] Example 1 Screening and verification of SNP molecular markers significantly correlated with chicken intestinal caproic acid concentration I. Experimental methods 1. Test materials The test materials are the B line of "Guangming No. 2" white - feather broilers.

[0051] Test age: 187 chicks were transferred to the isolation warehouse of Beijing Academy of Agriculture and Forestry Sciences for feeding at 1 - day - old, and jugular vein blood sampling and sample collection were carried out at 9 - day - old.

[0052] 2. Genomic DNA extraction and detection Fresh blood samples were collected from each chicken, and genomic DNA was extracted with reference to the phenol / chloroform method in "Molecular Cloning Experiment Guide IV", that is, genomic DNA in blood was extracted by the conventional phenol / chloroform method. After being qualified by spectrophotometer detection and agarose gel electrophoresis detection, it was sent to Beijing Novogene Bioinformatics Technology Co., Ltd., and entrusted to perform 20× genome sequencing on the DNA. After passing the quality inspection, it was used for re - sequencing library construction. The library construction and sequencing work were completed by Beijing Novogene Bioinformatics Technology Co., Ltd., and the sequencing strategy was Illumina PE150.

[0053] 3. Determination of short - chain fatty acid caproic acid concentration in intestine Collect 0.1 g of cecal contents from each chick into a centrifuge tube, add 9 times the volume (mL) of PBS solution, mix well, centrifuge at 12,000 r / min for 10 min, take 500 μL of the supernatant, add 100 μL of 25% (mass / volume ratio) crotonic acid metaphosphate mixture, vortex and mix well, and store overnight at -20 °C for 24 h. Before loading onto the machine, centrifuge at 12,000 r / min for 10 min, take the supernatant and filter it through a 0.22 μm filter membrane, take 150 μL and place it in an injection vial, and determine the caproic acid concentration using a gas chromatograph. The chromatographic conditions are as follows: the column temperature is 70 °C; use FID1 detector; the detection temperature is 250 °C; the carrier gas is nitrogen; the pressure is 37.5 kPa; the oxygen pressure is 50 kPa, the hydrogen pressure is 50 kPa, and the sensitivity is 10 -1 , attenuation 3.0.

[0054] 4. Sequencing data quality control Perform quality control on the raw data obtained by sequencing. The filtering criteria include: ① Remove reads containing adapter sequences; ② Remove reads with a proportion of N exceeding 10%; ③ Remove reads with a proportion of low-quality bases (quality ≤ 5) exceeding 50%. Conduct relevant data statistics on the obtained clean data, including the amount of sequencing data, Q20 ratio, Q30 ratio, GC content, etc.

[0055] 5. Genome alignment Download the chicken seventh edition genome data GRCg7b (https: / / useast.ensembl.org / Gallus_gallus / Info / Index) from the ENSEMBL database, use the BWA software for alignment (bwa mem -M -t40) to obtain the sam file. Use the SAMtools software to convert the sam file to a bam file and sort it through the sort function, and then use the MarkDuplicates module of the GATK software to mark the duplicates in the alignment results.

[0056] 6. Mutation detection and quality control According to the optimal variation detection process recommended by GATK, the deduplicated bam file was subjected to base quality correction (ApplyBQSR), gvcf file conversion (Hapotype Caller), and finally SNPs were merged and variation detected through the GenotypeGVCFs module. The SNPs obtained from the preliminary detection will be further subjected to strict quality control to ensure the accuracy of variation information detection. Subsequently, the VariantFiltration module was used to filter SNPs, and the filtering criteria included QualByDepth<2.0, Quality>30, mapping quality<40.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, SOR>3.0 and Fisher Strand>60.0.

[0057] PLINK1.9 was used to convert the VCF file into the BED format of PLINK and further quality control was performed. The selected parameters were mind0.1 (indicating that if the missing rate of genotype data of an individual exceeded 10%, the individual would be excluded from the analysis), maf0.05 (indicating that if the MAF of a variant was less than 5%, the variant would be excluded from the analysis), and geno 0.1 (indicating that if the missing rate of a variant in all individuals exceeded 10%, the variant would be excluded from the analysis). The indep-pairwise 25 5 0.2 parameter of PLINLK1.9 was used for dropout analysis. The number of variants before quality control was 12328262, the number of variants after quality control was 9309359, and the number of variants after dropout was 599315, which were used for subsequent analysis.

[0058] 7. Genome-wide association analysis GEMMA0.98.4 software was used to conduct association analysis based on the LMM model combined with caproic acid concentration and genomic SNP information, and SNPs related to intestinal caproic acid in Guangming No. 2 white-feather broiler chickens were mined. The LMM model was Y=Wα+xβ+u+e; u~MVN n (0,λτ -1 K), ε~MVN n (0, τ -1 I n ), where Y is the phenotype vector; W is the fixed effect indicator matrix, α is the fixed effect coefficient vector; x is the genotype vector, β is the SNPs effect; u is the random effect vector, ε is the residual vector; in the model, MVN n represents the n-dimensional multivariate normal distribution, λ is the ratio of the two variance components, τ -1 is the residual variance, K is the kinship matrix calculated based on SNPs, and I nis the identity matrix. The CMplot package in R.4.0.4 was used to draw Q-Q plots and Manhattan plots, and the genome-wide significance threshold was defined as 0.05 / N, where N is the number of SNPs.

[0059] 8. Fine mapping of GWAS The finemap_v1.4.2 software was used to calculate Bayes factors (BF) by the Shotgun Stochastic Search method using GWAS summary statistics results (genome build, SNP ID and position, alleles, effect size and associated standard error, P-value, minor allele frequency, and sample size, etc.) and local LD matrix information, and then calculate the posterior probability of independent association of causal SNPs in each region to obtain causal SNP loci. The ggplot2 package in R.4.0.4 was used for plotting.

[0060] 9. Gene annotation of significant SNP loci Based on gene annotation of significant SNPs, after obtaining the significant SNP loci of genome-wide association analysis, the bedtools software was used to annotate candidate genes in the range of 100 kb upstream and downstream of significant SNPs and extract the base sequences.

[0061] 10. Dual-luciferase verification of causal variant sites Experiments were carried out using the 293T cell line, and the cells were in good condition and had a uniform morphology. The instruments and equipment required for the experiment included a clean bench (model SW-CJ-2FD) from Sujing Antai, an inverted microscope (model XD-101) from JNOEC, a fluorescence inverted microscope (model 1X71) from OLYMPUS, a centrifuge (model TDL-40B) from Anting, and a carbon dioxide incubator (model MCO-15AC) from Sanyo. The main reagents and consumables included DMEM medium (Gibico), Lipofectamine 2000 Reagent (life, 11668-019), Dual-Luciferase Reporter Assay System (Promega, E1910), an endotoxin-free plasmid extraction kit (Omega, D6915), and culture flasks and plates of different specifications (Corning).

[0062] The experimental steps are as follows: First, resuscitate 293T cells and passage them 2-3 times, and use them for transfection after the cells are in good condition. Before transfection, preheat the medium to 37 °C, gently pipette the cells to detach them from the bottom wall of the culture dish, centrifuge and resuspend the cells and count them, and seed them at 1×10 4Cells were seeded into 96-well plates at a density of cells / well. Transfection was divided into a control group and an experimental group. Control group: transfected with the pGL4.18 empty vector plasmid (no promoter or SNP sequence inserted); Experimental group: transfected with the pGL4.18-Pro recombinant plasmid (carrying the IF70A promoter) and the following four SNP plasmids respectively: Chr_15238328(GG): constructed based on the pGL4.18 vector, introducing a T→G mutation at the chr7:15238328 locus; Chr_15315697(CC): constructed based on the pGL4.18 vector, introducing a T→C mutation at the Chr7:15315697 locus; Chr_15238328(TT): constructed based on the pGL4.18 vector, retaining the wild-type TT at the Chr7:15238328 locus; Chr_15315697(TT): constructed based on the pGL4.18 vector, retaining the wild-type TT at the Chr7:15315697 locus; The above SNP sequences are shown in Table 1. All groups were co-transfected with the TK plasmid (pRL-TK, expressing Renilla luciferase) to standardize the luciferase activity detection results. Fresh medium was replaced before transfection, DNA-Lipo3000 complexes were prepared, and after standing at room temperature for 5 - 10 minutes, they were added to the cell wells. After 6 hours, normal medium was replaced and the cells were continued to be cultured.

[0063] Forty-eight hours after transfection, luciferase analysis was performed: The medium was discarded, the cells were washed with PBS, and 1×PLB lysis buffer was added to lyse the cells for 15 minutes. The lysate can be directly used for analysis or stored at -80 °C. The lysate was added to a white opaque 96-well microplate, LAR II and Stop&Glo Reagent were added successively, the luciferase activities of hluc and hRluc were measured respectively, and finally data analysis was carried out. Graphpad Pism9.5 was used to visualize the data results, and Student’s t-test was used for statistical analysis. P<0.05 was considered a significant difference.

[0064] 11. Verification experiment on the expression level of IFT70A gene and the concentration of caproic acid in the cecal tonsil RNA was analyzed using the parameterized transcriptome sequencing technology. First, total RNA was extracted using TRIzol reagent, and the purity, quantification, and integrity of the RNA were evaluated using a NanoDrop 2000 spectrophotometer and an Agilent 2100 Bioanalyzer, respectively. Subsequently, a transcriptome library was constructed using the VAHTS Universal V6 RNA-seq Library Prep kit, and sequencing was completed by Shanghai OE Biotech Co., Ltd. The sequencing platform was Illumina Novaseq 6000, generating 150 bp paired-end reads, and approximately 46.5M raw reads were obtained for each sample. After removing low-quality reads using the fastp software, clean reads were obtained, aligned to the reference genome using HISAT2, and gene expression levels (FPKM) were calculated using HTSeq-count.

[0065] II. Experimental Results 1. Detection Results of Caproic Acid Concentration in Guangming No. 2 White-Feathered Broilers To screen for genetic variant sites affecting the intestinal caproic acid concentration in Guangming No. 2 white-feathered broilers, targeted metabolomics was used to measure the intestinal caproic acid concentration in 187 Guangming No. 2 white-feathered broilers. The measurement results are as follows: the average value was 3.17 ± 1.11 ng / mg, the maximum value was 9.04 ng / mg, the minimum value was 1.68 ng / mg, and the coefficient of variation was 35.01%. The caproic acid concentrations of the 187 individuals basically conformed to a normal distribution (see the normal distribution graph in Figure 1 ), meeting the phenotypic requirements for genome-wide association analysis.

[0066] 2. Genome-Based Principal Component Analysis of Guangming No. 2 White-Feathered Broilers After quality control of the genotype data, a total of 187 samples and 9,309,359 SNPs were retained for subsequent analysis ( Figure 2 A). Principal component analysis of the Guangming No. 2 white-feathered broiler population found that the sample population was relatively dispersed. According to the first and second principal components, stratification was observed in the collected Guangming No. 2 white-feathered broiler population ( Figure 2 B). This indicates that this result needs to be considered in the next genome-wide association study. Therefore, the first 3 principal component results were used as covariates for subsequent genome-wide association analysis, along with gender, to correct the population structure.

[0067] 3. Genome-Wide Association Analysis of Intestinal Caproic Acid Concentration in Guangming No. 2 White-Feathered Broilers Intestinal caproic acid concentration is one of the important indicators for evaluating the intestinal health of individual poultry. A higher caproic acid concentration means higher disease resistance. The significant results of genome-wide association analysis were corrected using Bonferroni, and two significance levels were considered: genome-wide significance P = 8.34×10 -8 (0.05 / 599315), potential significance P = 1.67×10 -6 (1 / 599315). In the results of genome-wide association analysis of intestinal caproic acid concentration in Guangming No. 2 white - feather broilers, 54 SNP effect sites were found to reach the genome-wide significant level ( Figure 3 A, B). The LDBlockshow plot showed that there was a strong linkage relationship between these significant sites and nearby SNPs sites ( Figure 3 C). The information of significant SNPs is shown in Table 1.

[0068] Table 1 Information of 54 SNP molecular markers significantly associated with intestinal caproic acid concentration in Guangming No. 2 white - feather broilers 4. Detection of causal variant sites for intestinal caproic acid concentration in Guangming No. 2 white - feather broilers To further detect potential SNPs within the GWAS candidate regions, FINEMAP was used to perform fine - mapping analysis on 54 candidate SNP sites, and the posterior probability of causal SNPs in the candidate regions was calculated ( Figure 4 ). The results showed that the posterior probabilities of Chr_15238328 and Chr_15315697 (Table 1) were relatively high. The probability of Chr_15238328 as a causal single - nucleotide polymorphism (SNP) was 63%, and the probability of both Chr_15238328 and Chr_15315697 as causal SNPs was 36%. The bedtools software was used to annotate candidate genes within a range of 100 kb upstream and downstream of these two significant SNPs. Chr_15238328 was annotated to the genes PDE11A, RBM45, IFT70A, OSBPL6, ENSGALG00010023848, and Chr_15315697 was annotated to the genes IFT70A, AGPS, PDE11A.

[0069] 5. Genotypes of causal variant sites for intestinal caproic acid concentration in Guangming No. 2 white - feather broilers Extract the genotype information of Chr_15238328 and Chr_15315697 using PLINK, use the "ggpubr" R package to plot the phenotypic differences of different genotypes in the caproic acid concentration trait, and perform the Kruskai-Wallis test. P <0.05 indicates a significant difference between the genotype and the phenotype. The results show that among the 187 Guangming No. 2 white - feather broilers, the caproic acid concentration of the GG genotype at the Chr_15238328 locus is significantly higher than that of the GT and TT genotypes ( P <0.05, Figure 5 A), and the caproic acid concentration of the CC genotype at the Chr_15315697 locus is extremely significantly higher than that of the CT and TT genotypes ( P <0.001, Figure 5 B).

[0070] 6. Dual - luciferase verification of causal variant sites of caproic acid concentration in the intestine of Guangming No. 2 white - feather broilers The results show that the Chr_15238328 and Chr_15315697 loci have a significant activating effect on the promoter of the IFT70A gene ( Figure 6 ). After transfection of the cells, obvious luciferase activity was detected in all experimental groups transfected with the pGL4.18 - Pro plasmid, proving that this sequence has promoter function; while the plasmids containing Chr_15238328(GG), Chr_15315697(CC), Chr_15238328(TT), and Chr_15315697(TT) constructed separately only showed weak promoter activity. After adding the above - mentioned SNP sequences into the Pro plasmid respectively, compared with the single pGL4.18 - Pro group, there was no obvious change in luciferase activity after adding Chr_15238328(GG) and Chr_15315697(CC) (P>0.05), while the luciferase activity was significantly increased after adding Chr_15238328(TT) and Chr_15315697(TT) (P<0.05), suggesting that the promoter activities of Chr_15238328(GG) and Chr_15315697(CC) are significantly lower than those of Chr_15238328(TT) and Chr_15315697(TT) (P<0.05).

[0071] 7. Linear relationship between caproic acid concentration in the intestine of Guangming No. 2 white - feather broilers and the expression level of IFT70A gene in the cecal tonsil The verification results show that there is an extremely significant negative correlation between the caproic acid concentration in the intestine and the expression level of the IFT70A gene in the cecal tonsil (P<0.01), and the correlation coefficient is - 0.24 ( Figure 7 ).

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. These modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. SNP molecular markers related to the caproic acid concentration in chicken intestines, characterized in that, The SNP molecular markers include one or two of the following (1)-(2): (1) The SNP molecular marker contains a nucleotide sequence with a polymorphism of G / T at the 51st position of the sequence shown in SEQ ID NO:1; (2) The SNP molecular marker contains a nucleotide sequence with a polymorphism of C / T at the 51st position of the sequence shown in SEQ ID NO:

2.

2. The SNP molecular marker related to the caproic acid concentration in chicken intestines according to claim 1, wherein In (1) above, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:1, the polymorphic site is located at the 51st position of the sequence shown in SEQ ID NO:1, and the polymorphism is G / T; In (2) above, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO:2, the polymorphic site is located at the 51st position of the sequence shown in SEQ ID NO:2, and the polymorphism is C / T.

3. The SNP molecular marker related to the caproic acid concentration in chicken intestine according to claim 1 or 2, characterized in that In (1) above, the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotype is GT or TT, corresponding to a low caproic acid concentration; In (2) above, the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotype is CT or TT, corresponding to a low caproic acid concentration.

4. Primers for amplifying the SNP molecular marker related to the caproic acid concentration in chicken intestine according to any one of claims 1 to 3.

5. Detection reagent, characterized in that, The detection reagent contains the primers according to claim 4.

6. Any one of the following (1)-(8) applications of the SNP molecular marker according to any one of claims 1 to 3, the primer according to claim 4, or the detection reagent according to claim 5: (1) Predicting the caproic acid concentration or disease resistance traits in chicken intestine; (2) Screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; (3) Selecting chickens with high intestinal caproic acid concentration or high disease resistance; (4) Selecting the caproic acid concentration or disease resistance traits in chicken intestine; (5) Molecular marker-assisted breeding related to the caproic acid concentration or disease resistance traits in chicken intestine; (6) Variety improvement related to the caproic acid concentration or disease resistance traits in chicken intestine; (7) Preparing a reagent for predicting the caproic acid concentration or disease resistance traits in chicken intestine; (8) Preparing a reagent for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance.

7. Any one of the following (1)-(8) applications of the SNP molecular marker or the detection reagent of the SNP molecular marker: (1) Predicting the caproic acid concentration or disease resistance traits in chicken intestine; (2) Screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; (3) Selecting chickens with high intestinal caproic acid concentration or high disease resistance; (4) Selecting the caproic acid concentration or disease resistance traits in chicken intestine; (5) Molecular marker-assisted breeding related to the caproic acid concentration or disease resistance traits in chicken intestine; (6) Variety improvement related to the caproic acid concentration or disease resistance traits in chicken intestine; (7) Preparing a reagent for predicting the caproic acid concentration or disease resistance traits in chicken intestine; (8) Preparing a reagent for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance; Among them, The SNP molecular markers include one or two of the following (1)-(2): (1) The polymorphic site of the SNP molecular marker is located at position 15238328 on chromosome 7 of the seventh edition of the chicken genome data GRCg7b, and the polymorphism is G / T; (2) The polymorphic site of the SNP molecular marker is located at position 15315697 on chromosome 7 of the seventh edition of the chicken genome data GRCg7b, and the polymorphism is C / T.

8. The application according to claim 7, wherein In (1) above, the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotype is GT or TT, corresponding to a low caproic acid concentration; In (2) above, the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotype is CT or TT, corresponding to a low caproic acid concentration.

9. A method for screening or identifying chickens with high intestinal caproic acid concentration or high disease resistance, characterized in that, The method includes: detecting the SNP molecular marker related to the caproic acid concentration in the chicken intestine of the chicken to be screened, and determining the chicken with a high intestinal caproic acid concentration or high disease resistance according to the genotype of the SNP molecular marker; Among them, the SNP molecular marker includes one or two of the following (1)-(2): (1) The polymorphic site of the SNP molecular marker is located at position 15238328 on chromosome 7 of the seventh edition of the chicken genome data GRCg7b, and the polymorphism is G / T; (2) The polymorphic site of the SNP molecular marker is located at position 15315697 on chromosome 7 of the seventh edition of the chicken genome data GRCg7b, and the polymorphism is C / T.

10. The method according to claim 9, characterized in that, In (1) above, the genotype of the polymorphic site of the SNP molecular marker is GG, corresponding to a high caproic acid concentration, and the genotype is GT or TT, corresponding to a low caproic acid concentration; In (2) above, the genotype of the polymorphic site of the SNP molecular marker is CC, corresponding to a high caproic acid concentration, and the genotype is CT or TT, corresponding to a low caproic acid concentration.

Images