A duck circovirus genetically engineered subunit vaccine, its preparation method and application
By constructing a His-tagged prokaryotic expression vector in Escherichia coli, duck circovirus Cap protein was successfully expressed. The prepared vaccine was used for egg yolk antibody preparation, solving the expression problem in the existing technology and realizing efficient and safe vaccine production and antibody preparation.
Patent Information
- Application Number
- CN202310207062.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-28
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2043-02-28
AI Technical Summary
Existing technologies are insufficient for the efficient expression of duck circovirus Cap protein in E. coli systems, and existing expression systems suffer from problems such as high cost, complex conditions, or instability.
The Cap gene with its nuclear localization signal removed was amplified by primer set PCR, and a His-tagged prokaryotic expression vector pET-28a-cap was constructed. The Cap protein was induced to be expressed in Escherichia coli, and the vaccine was prepared by purification and refolding. The vaccine was then emulsified with white oil adjuvant to obtain the vaccine.
The efficient prokaryotic expression of duck circovirus Cap protein was achieved, and the prepared vaccine has good immunogenicity, is suitable for small and medium-scale production, and can be used for the preparation of egg yolk antibodies. The preparation process is simple, safe and non-toxic, and has significant protective effect.
Smart Images

Figure BDA0004111316700000051 
Figure BDA0004111316700000061 
Figure BDA0004111316700000091
Abstract
Description
Technical Field
[0001] This invention relates to poultry disease immunization control technology, specifically to a duck circovirus genetically engineered subunit vaccine and its preparation method and application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] The Cap protein of duck circovirus (DuCV) is the only structural protein of DuCV and possesses good immunogenicity. While there are studies on the induced expression of recombinant Cap proteins, mammalian cell expression systems require sophisticated preparation, expensive culture media, and complex growth conditions. Baculovirus-insect cell expression systems involve expensive culture media, and viral infection can lead to cell lysis and potential protein degradation. Bacillus subtilis expression systems suffer from poor compatibility, with recombinant plasmids being unstable, resulting in plasmid loss and low protein expression levels. Escherichia coli expression systems offer advantages such as low cost and simple culture conditions, but the full-length Cap gene is difficult to express in prokaryotic systems. Therefore, there are currently no reports on developing a prokaryotic system for expressing the DuCV Cap protein. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the present invention aims to provide a duck circovirus genetically engineered subunit vaccine, its preparation method, and its application. This vaccine achieves the expression of the cap recombinant protein in Escherichia coli and exhibits good immunogenicity, successfully solving the problem of prokaryotic expression preparation of duck circovirus Cap protein.
[0005] Based on the above research, the present invention provides the following technical solution:
[0006] On the one hand, a method for preparing a duck circovirus genetically engineered subunit vaccine involves using primer sets as shown in SEQ ID NO.1 and SEQ ID NO.2 to perform PCR amplification of the target Cap gene with its nuclear localization signal truncated, constructing a prokaryotic expression vector pET-28a-cap containing a His tag, transforming it into Escherichia coli for induced expression, purifying and refolding the His-tag-containing cap protein to obtain the antigen, and emulsifying it with white oil adjuvant to obtain the vaccine.
[0007] Furthermore, the target Cap gene was amplified by PCR using duck circovirus as a template. The duck circovirus has the accession number CGMCC No. 19296.
[0008] Furthermore, the target Cap gene is shown in SEQ ID NO.3.
[0009] Furthermore, IPTG was used to induce expression.
[0010] Furthermore, the inducible expression conditions are: IPTG concentration of 0.8–1 mmol / L, incubation at 36–38℃ with shaking at 150–200 rpm for 4–6 h. Induced expression under these conditions is better.
[0011] Furthermore, the purified cap protein was refolded using an activated dialysis bag.
[0012] Furthermore, a urea gradient dialysis was performed with urea concentrations of 5.8–6.2 mol / L, 3.8–4.2 mol / L, 1.8–2.2 mol / L, and 0 mol / L, respectively, so that the protein concentration after refolding reached more than 1 mg / mL (e.g., 1–5 mg / mL, 1–3 mg / mL, 1–2 mg / mL, etc.).
[0013] Furthermore, the vaccine is prepared by emulsifying the refolded cap protein liquid with white oil adjuvant at a volume ratio of 0.8-1.2:1.
[0014] On the other hand, a duck circovirus genetically engineered subunit vaccine was obtained by the above preparation method.
[0015] Thirdly, the application of one of the above-mentioned duck circovirus genetically engineered subunit vaccines in the preparation of egg yolk antibodies.
[0016] The specific steps are as follows:
[0017] (1) The prepared recombinant protein vaccine was used to immunize laying hens about one month before they started laying in 4 doses, with an interval of 2 weeks between each immunization; after the first 4 immunizations, subsequent immunizations were carried out every 1-2 months, with each immunization dose being 1.0-2.0 mL / hen.
[0018] (2) Two weeks after the fourth immunization, start collecting immunized eggs and continue collecting eggs, maintaining immunization once every 1-2 months; use an egg yolk separator to separate the egg yolk from the egg white, mix the egg yolk with purified water preheated to 30℃-37℃ at a volume ratio of 3-5:1 to dilute the egg yolk solution, stir evenly to obtain the egg yolk dilution solution, and preheat at 30℃-37℃ for 1 hour;
[0019] (3) Add 3-4% PEG6000 to the egg yolk dilution solution, mix with the egg yolk and stir thoroughly, let stand for 4-6 hours to allow for full reaction;
[0020] (4) Extract the supernatant after the reaction and filter it coarsely with a 100-200 mesh filter, first with a 100 mesh and then with a 200 mesh filter.
[0021] (5) The filtered supernatant is placed into a sterile container for secondary sedimentation for 24-48 hours;
[0022] (6) Extract the supernatant from the secondary precipitation, filter it once with a 200-mesh filter, and then filter it with a 0.22μm filter membrane for sterilization. Add formaldehyde with a volume fraction of 1 / 1000 to the sterilized supernatant to inactivate the unknown virus and use it as a preservative, i.e., refined egg yolk antibody. The agar amplification test titer against duck circovirus should be no less than 1:64.
[0023] (7) Under aseptic conditions, dispense the filtrate into sterile vaccine bottles, seal with rubber stoppers, roll aluminum caps, affix labels, and store for later use at a temperature of 4-8℃.
[0024] Furthermore, after the initial four immunizations in step (1), immunizations are administered every 1.5 months thereafter.
[0025] The dilution volume ratio in step (2) is 3.5:1, and the temperature is 35℃;
[0026] The amount of PEG6000 added in step (3) is 3.5%; wherein the PEG6000 can be dissolved in a small amount of warm water beforehand.
[0027] The beneficial effects of this invention are as follows:
[0028] 1. This invention designs a primer set and uses this primer set to amplify the cap gene with a nucleus-free localization sequence, constructs a prokaryotic expression plasmid, and uses an E. coli expression system to induce the expression of cap recombinant protein, effectively solving the problem of duck circovirus antigen preparation.
[0029] 2. The duck circovirus genetically engineered vaccine provided by this invention is a genetically engineered subunit vaccine. Its preparation process is simple, requires minimal equipment, has moderate viscosity, good needle penetration, low stress, and good protective effect. It is suitable for small- to medium-scale production or for antibody preparation.
[0030] 3. The present invention provides a duck circovirus genetically engineered subunit vaccine for the preparation of egg yolk antibodies. The preparation process is simple, easy to operate, and suitable for large-scale production. No toxic reagents are used in the preparation process, and concentration is not required. The remaining egg yolk paste can be made into feed egg yolk powder for secondary use and is non-toxic.
[0031] 4. The duck circovirus genetically engineered subunit vaccine provided by this invention is used for the preparation of egg yolk antibodies. The antibody titer is not less than 1:64, and the protective effect is outstanding, which can effectively prevent and treat the harm caused by the virus. Attached Figure Description
[0032] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0033] Figure 1 This is an image showing the electrophoresis results of the PCR products in Example 1 of the present invention;
[0034] Figure 2 This is an agarose gel electrophoresis result of the recombinant plasmid PCR amplification product in Example 2 of the present invention;
[0035] Figure 3 This is an agarose gel electrophoresis result of double enzyme digestion identification of the pET-28a-cap recombinant plasmid in Example 2 of the present invention;
[0036] Figure 4 This is a graph showing the protein electrophoresis (SDS-PAGE) results in Example 3 of the present invention;
[0037] Figure 5 This is a graph showing the results of a Western blot reaction for proteins in Example 3 of this invention;
[0038] Figure 6 This is an SDS-PAGE result diagram from Embodiment 4 of the present invention;
[0039] Figure 7 This is the protein concentration detection curve in Example 4 of the present invention;
[0040] Figure 8 Image of the duck circovirus genetically engineered subunit vaccine prepared in Example 8 of this invention. Detailed Implementation
[0041] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0042] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0043] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0044] Example 1: Construction of prokaryotic expression recombinant plasmid
[0045] Using the full genome sequence of duck porcine circovirus (CGMCC No. 19296) as a template (i.e., template DNA), PCR primers without the nuclear localization signal peptide (1-108 amino acids) were designed and synthesized. The primer sequences are as follows: (cap-F: GGATCCGAATTCTTTTCAGTAGTGACGTTCAA, as shown in SEQ ID NO.1; cap-R: GTGGTGCTCGAGCTAGAACCCGGTGAACTGAC, as shown in SEQ ID NO.2). PCR amplification was performed using these primers with a high-fidelity enzyme (annealing at 57℃ for 30 cycles). The amplification system is as follows:
[0046] Table 1. PCR system for amplifying the cap gene of duck circovirus.
[0047]
[0048]
[0049] The above PCR products were subjected to 1.0% agarose gel electrophoresis as follows:
[0050] (1) Weigh 2.5g of agarose powder and dissolve it in 25mL of 1×TAE nucleic acid electrophoresis buffer. Mix well and heat in a microwave oven on high for min until the agarose is completely dissolved and the solution is clear and transparent.
[0051] (2) After the solution has cooled slightly, add 2.5 μL of EB dye, shake well, pour into the glue-making plate with the comb inserted, and let it cool and solidify at room temperature for about 0.5 h.
[0052] (3) After the agarose gel solidifies, remove the comb vertically and place the gel into the electrophoresis tank.
[0053] (4) Add 5 μL of 5×Loading Buffer to the PCR product, mix thoroughly, and then add it to each sample well in sequence. Add 5 μL of DNA Marker to one sample well.
[0054] (5) Connect the electrophoresis apparatus, turn on the power, perform electrophoresis separation at 110V for 20 minutes. After electrophoresis stops, put the gel block into the UV nucleic acid gel imager, observe and record the experiment. Figure 1 The results show that well 1 was for the amplified cap gene, with a band size of 666 bp, while well 2 was for the control.
[0055] Example 2 Construction and Identification of Recombinant Plasmids
[0056] The amplified duck circovirus cap gene fragment and pET-28a vector plasmid were digested with EcoRI and XhoI, then ligated with T4 DNA ligase. The ligation product was removed overnight and placed on ice. This product was added to competent cells and incubated on ice for 30 min. Afterward, the cells were immediately placed in a 42°C water bath for 60 s for heat shock, then quickly returned to ice for 2 min. The product was then added directly to a 1.5 mL centrifuge tube containing 1 mL of antibiotic-free LB medium. The cells were incubated at 37°C and 220 rpm for 1 h, followed by centrifugation at 1500 × g for 2 min to precipitate the bacterial cells. 900 μL of medium was discarded, and the precipitate was resuspended in the remaining 100 μL of medium. The entire pellet was then plated onto LB agar plates containing 20 μg / mL kanamycin and incubated overnight at 37°C. Single colonies were picked, and plasmids were extracted and identified by PCR. The target fragment, 666 bp, identical to the expected size of the cap gene, was obtained. Figure 2 The pET-28a-cap ligation product was identified by double enzyme digestion and agarose gel electrophoresis, yielding two bands of 5341 bp and 666 bp, consistent with the expected size. This indicates successful construction of pET-28a-cap. Figure 3 .
[0057] Example 3: Induced Expression of Recombinant Protein
[0058] The recombinant bacteria were inoculated into LB liquid medium containing kanamycin and cultured at 37°C for 3 h at 220 rpm. IPTG, an inducer, was then added to the bacterial culture to a final concentration of 1 mmol / L. The bacterial cells were collected and lysed using an ultrasonic cell disruptor under ice bath conditions for 20 min. The ultrasonic power was 30%, and the ultrasonic program was 2 seconds on and 2 seconds off. The bacterial cell lysate was centrifuged at 12000 × g for 10 min at 4°C. The supernatant was transferred to a 1.5 mL centrifuge tube, and 500 μL of PBS was added to the pellet.
[0059] Prepare a 12.5% SDS-PAGE gel. Take a certain amount of protein sample, add 5× Loading Buffer to dilute the solution to 1×, mix thoroughly, and boil in boiling water for 10 min. Centrifuge briefly and set aside. Place the prepared gel in an electrophoresis tank, slowly add electrophoresis buffer, and use a micropipette to add 30 μL of the prepared protein sample to the gel wells. Add a protein marker to one side of the protein well. After correctly connecting the positive and negative electrodes to the electrophoresis apparatus, turn on the power. The electrophoresis voltage for the samples in the stacked gel is 140V. Stop electrophoresis when the blue band reaches the bottom of the gel. Remove the gel and place it in Coomassie Brilliant Blue staining solution for 5 h at room temperature. Place the stained gel in Coomassie Brilliant Blue destaining solution and destain on a shaker. Replace the destaining solution periodically until it no longer changes color. Scan the gel with a scanner and save the results image. Figure 4 The SDS-PAGE results show that in well 1 with the addition of the inducer IPTG, the cap protein showed a clear band at 28.7 kDa. In well 2 without the addition of the inducer IPTG.
[0060] Prepare a 12.5% SDS-PAGE gel for polyacrylamide gel electrophoresis. The electrophoresis procedure is the same as above. Cut a PVDF membrane of the appropriate size and immerse it in methanol solution for 30 seconds, then in deionized water for 1 minute, and then immerse it thoroughly in transfer buffer. After electrophoresis, immerse the gel in transfer buffer, place filter paper in the transfer apparatus, place the prepared PVDF membrane on the filter paper, and then place the gel and filter paper on top. Transfer the membrane at a constant current of 400 mA for 0.5 hours. After the PVDF membrane is transferred, wash it once with PBST solution, then place it in 5% BSA solution and block it on a shaker for 1 hour. Dilute the His antibody at a ratio of 1:2500 with primary antibody dilution buffer to prepare the primary antibody, place the blocked PVDF membrane in the primary antibody solution, and incubate overnight at 4°C. Wash the overnight incubated PVDF membrane three times with PBST solution for 10 minutes each time. Dilute the mouse secondary antibody 1:10000 with secondary antibody dilution buffer and incubate the PVDF membrane with this solution for 1 hour. Wash the PVDF membrane three times with PBST solution, 10 minutes each time. Prepare the developing solution by mixing equal volumes of solutions A and B from the substrate chemiluminescence kit in a 1:1 ratio. After removing the PBS washing solution from the PVDF membrane, place it in the chemiluminescence analyzer and evenly drop the developing solution onto the PVDF membrane for luminescence imaging. Figure 5 Western blot results showed that the cap protein had a distinct band at 28.7 kDa.
[0061] Example 4: Purification and refolding of recombinant proteins
[0062] The target protein was isolated into inclusion bodies after ultrasonic treatment of the bacterial culture. The protein was purified according to the instructions of the high-affinity nickel-filled resin reagent for His fusion protein purification. After purification, the purified protein was analyzed by SDS-PAGE. A high-purity single cap protein band was obtained by NI column purification, as shown below. Figure 6 As shown, sample well 1 contains total bacterial protein before purification, and sample well 2 contains purified cap protein with a distinct single band at 28.7 kDa. Cut the dialysis bag to a suitable length of 10-20 cm. Leave an extra length (approximately 1 / 5 of the total sample volume) at the top of the dialysis bag as head space. Prepare a solution of 2% (w / v) sodium bicarbonate and 1 mmol / L EDTA, and boil the dialysis bag in a large volume of the above solution for 10 min to activate it. Add 10 mL of purified protein sample to the dialysis bag, adjust the length of the head space, and clamp the dialysis clamp. Dialyze the sample in a urea gradient, with urea concentrations of 6 mol / L, 4 mol / L, 2 mol / L, and 0 mol / L, overnight. During continuous dialysis, each dialysis session should last at least 10 hours. After dialysis, the protein should be completely dissolved in PBS buffer. The protein concentration of the renatured protein sample was determined using the BCA method. Figure 7 The protein concentration was determined to be 1.0 mg / mL by the protein concentration detection curve.
[0063] Example 5: Preparation and Antibody Titer Determination of Duck Circovirus Genetically Engineered Subunit Vaccine
[0064] The refolded cap protein solution (volume ratio 1:1) was mixed with commercially available white oil adjuvant using a self-made microemulsifier and stirred for approximately 30 minutes. The degree of emulsification was monitored until the mixture formed droplets in water without spreading. The duck porcine circovirus genetically engineered vaccine was then complete. Figure 8 As shown in Table 2, healthy Cherry Valley ducklings were intramuscularly injected with a genetically engineered duck circovirus vaccine at 7 days of age, with a dose of 0.5 mL per duckling. A booster immunization with the same dose was administered one week later. Blood samples were collected 10 days after the second immunization, and serum antibody titers were detected using an indirect enzyme-linked immunosorbent assay (ELISA). The data in Table 2 show that the highest antibody titer in the duckling serum was 1:10240.
[0065] (1) Coating: The purified cap protein was used as an antigen and diluted with 1× carbonate buffer (pH=9.6) at the required concentration. 100 μl of the diluted cap protein solution was added to each well of a 96-well ELISA plate and incubated overnight at 4°C. The plate was then washed 5 times with PBST and the remaining liquid was shaken off.
[0066] (2) Blocking: Add 200 μl of blocking solution to the ELISA plate coated with antigen, incubate at room temperature for 1 h, and wash the plate (method as above).
[0067] (3) Add primary antibody: Add 100 μl of diluted serum to be tested to the blocked ELISA plate, incubate at room temperature for 1 h, and wash the plate (method as above).
[0068] (4) Add secondary antibody: Add 100 μl of diluted secondary antibody to the ELISA plate after incubation with primary antibody, incubate at room temperature for 1 h, and wash the plate (method as above).
[0069] (5) Add substrate: Add 100 μl of freshly prepared TMB buffer to each well of the ELISA plate and incubate at room temperature for 15 min.
[0070] (6) Termination: Add 50 μl of stop solution to each well, gently shake, and read the value at OD 450 nm using an ELISA reader.
[0071] (7) Organize and analyze the data using Excel.
[0072] Table 2. Antibody titers in serum immunized with duck circovirus genetically engineered subunit vaccine detected by indirect ELISA.
[0073]
[0074]
[0075] Example 6: Preparation of Egg Yolk Antibody
[0076] (1) The laying hens one month before the start of laying were immunized with the vaccine used in Example 5 in four doses, with a dose of 1.5 mL / hen and an interval of two weeks between each immunization.
[0077] (2) Two weeks after the fourth immunization, start collecting immunized eggs and continue collecting eggs, maintaining immunization once every 1-2 months. Use an egg yolk separator to separate the yolk from the egg white. Dilute the yolk with purified water preheated to 35°C at a volume ratio of 3.5:1. Stir well to obtain the diluted yolk solution and preheat it at 35°C for 1 hour.
[0078] (3) Add PEG6000 with a final concentration of 3.5% to the egg yolk dilution, mix it with the egg yolk and stir it thoroughly. Let it stand for 4 hours to allow it to react fully.
[0079] (4) Extract the supernatant after the reaction and filter it first with a 100-mesh filter and then with a 200-mesh filter.
[0080] (5) The filtered supernatant is placed into a sterile container for secondary sedimentation, and the sedimentation time is 48 hours.
[0081] (6) Extract the supernatant from the secondary precipitation, first filter it through a 200-mesh filter, and then filter it through a 0.22μm filter membrane for sterilization.
[0082] (7) Add a certain amount of preservative or formaldehyde at a concentration of 0.1% to the supernatant after sterilization to obtain refined egg yolk antibodies.
[0083] (8) The titer of the agar diffusion test for detecting anti-duck circovirus antibodies is ≥1:64.
[0084] (9) Dispensing and storage. Under aseptic conditions, dispense the filtrate into sterile vaccine vials, seal with rubber stoppers, press aluminum caps, affix labels, and store for later use at a temperature of 4-8℃.
[0085] Example 7: Quality Inspection of Egg Yolk Antibodies
[0086] (1) Safety inspection
[0087] Twenty healthy 1-day-old Cherry Valley ducklings were injected intramuscularly with 2.0 mL of the egg yolk antibody prepared in Example 6 of this invention at multiple sites. After 14 days of observation, all susceptible ducklings survived healthily, indicating that the egg yolk antibody of this invention has good safety.
[0088] (2) Aseptic testing
[0089] The egg yolk antibody of the present invention was tested in accordance with the Veterinary Pharmacopoeia of the People's Republic of China (2015 edition) and found to be free of bacterial, mycoplasma and exogenous viral contamination.
[0090] (3) Validity test
[0091] Forty healthy 1-day-old Cherry Valley ducklings (negative for duck circovirus antigen and antibody in serum tests) were randomly divided into two groups, A and B, with 20 ducklings in each group. Group A received an intramuscular injection of the egg yolk antibody prepared in Example 6, 0.5 mL per duckling; Group B served as the control group, receiving an intramuscular injection of physiological saline, 0.5 mL per duckling, and were kept in isolation. Eight hours after the injection, each duckling was simultaneously injected with 0.5 mL of liver homogenate supernatant containing duck circovirus (>1×10⁻⁶). 7 (Copies). Three days after challenge, 10 animals were euthanized, and their livers were collected for PCR testing to detect viral positivity. The remaining 10 animals were observed at 14 days of age, and their clinical symptoms were recorded. They were then euthanized and tested for viral positivity.
[0092] The results showed that all 20 ducks in the egg yolk antibody group (Group A) were negative for duck circovirus in their livers, while all 20 ducks in the control group (Group B) were positive for duck circovirus. Furthermore, Group A showed no clinical symptoms during the observation period, while some ducks in Group B exhibited symptoms such as lethargy, poor appetite, and reluctance to move. The results indicate that the egg yolk antibody prepared in Example 6 is effective, and only 0.5 mL needs to be injected into 1-day-old ducklings.
[0093] Example 8: Application of Egg Yolk Antibodies
[0094] In a poultry farm suspected of having duck circovirus infection, noticeably thin, poorly fed, and lethargic ducks were selected. Blood samples were collected and PCR was used to confirm duck circovirus infection in 40 ducks (approximately 25 days old). These ducks were randomly divided into two groups, A and B, with 20 ducks in each group, and kept in isolation. Group A was injected with 2.0 mL of the egg yolk antibody prepared in Example 6, while group B was injected with 2.0 mL of physiological saline. The ducks were observed for 14 days, and their condition and mortality were recorded. They were then euthanized, and the positivity rate of the virus in their livers was detected using PCR.
[0095] Results: In Group A, 2 days after injection of egg yolk antibodies, the feed intake of sick ducklings began to increase, and their mental state improved significantly. No ducklings died within 14 days. After 14 days, the ducks were culled and dissected. Most ducks showed mild or no symptoms upon necropsy. The positive rate of duck porcine circovirus in the liver using PCR was 2 / 20. In Group B, after injection of saline, the feed intake and mental state of sick ducks did not improve significantly. Sick ducks began to die from the second day after injection, and the mortality rate of sick ducks within 14 days was 25%. At the end of the observation period (14 days), the surviving ducks were culled. Most ducks showed symptoms such as yellowing of the liver, local swelling, and hemorrhages. The positive rate of duck porcine circovirus in the liver (including the frozen livers of dead ducks) using PCR was 17 / 20.
[0096] The above experimental results show that the egg yolk antibody of the present invention has good safety, good preventive effect and high cure rate, and can be used for the prevention and treatment of duck circovirus infection, which has significant economic and social benefits.
[0097] The capDNA sequence is as follows:
[0098] As shown in SEQ ID NO.3.
[0099] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A duck circovirus genetic engineering subunit vaccine preparation method, characterized in that, The Cap gene with nuclear localization signal removed is amplified by PCR using the primer set shown as SEQ ID NO. 1 and SEQ ID NO. 2, a prokaryotic expression vector pET-28a-cap containing a His tag is constructed, and the vector is transformed into E. coli for induced expression; the cap protein with His tag is purified and renatured to obtain an antigen, and the antigen is emulsified with white oil adjuvant to prepare a vaccine. The Cap gene is amplified by PCR using duck circovirus as a template, and the duck circovirus has a preservation number of CGMCC No. 19296; the Cap gene is shown as SEQ ID NO.
3.
2. The method for preparing the duck circovirus genetically engineered subunit vaccine according to claim 1, characterized in that, IPTG is used for induced expression.
3. The method for preparing the duck circovirus genetically engineered subunit vaccine according to claim 2, characterized in that, The expression conditions for induced expression are that the IPTG concentration is 0.8-1 mmol / L, the culture is performed at 36-38℃ with 150-200 r / min oscillation for 4-6 h.
4. The method for preparing the duck circovirus genetically engineered subunit vaccine according to claim 1, characterized in that, The purified cap protein is subjected to protein renaturation using an activated dialysis bag.
5. The method for preparing the duck circovirus genetically engineered subunit vaccine as described in claim 1, characterized in that, [the method involves] setting... Urea gradient dialysis is performed, and the urea concentration is sequentially 5.8-6.2 mol / L, 3.8-4.2 mol / L, 1.8-2.2 mol / L and 0 mol / L; the protein concentration after renaturation is above 1 mg / mL.
6. The method for preparing the duck circovirus genetically engineered subunit vaccine according to claim 1, characterized in that, The liquid of the cap protein after renaturation is emulsified with white oil adjuvant at a volume ratio of 0.8-1.2:
1.
7. A genetically engineered subunit vaccine of duck circovirus, characterized in that, The vaccine is obtained by the preparation method of any one of claims 1-6.
8. Use of the duck circovirus genetic engineering subunit vaccine of claim 7 in preparation of egg yolk antibody.
Citation Information
Patent Citations
Duck circovirus tissue inactivated vaccine, and preparation method of egg yolk antibody by using duck circovirus tissue inactivated vaccine
CN111349619A