SNP (Single Nucleotide Polymorphism) molecular marker related to pig litter size character in pig CCDC170 gene, primer pair and application of SNP molecular marker

By detecting the polymorphism of the rs81348764 locus in the CCDC170 gene of pigs, individuals of GG genotype were screened, and the problem of improving the genetic traits in the middle and lower levels of pig breeding traits was solved, and the breeding efficiency and accuracy of pig litter traits were improved.

CN120290747AActive Publication Date: 2025-07-11INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510586739.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-07-11
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

It is difficult for the prior art to effectively improve the medium and low heritability traits of pig breeding traits, especially pig litter traits. Conventional breeding methods are inefficient and have a great impact on the environment.

Method used

SNP molecular markers and primer pairs in the CCDC170 gene were provided for assisted selection and breeding. By detecting the polymorphism of the intron rs81348764 locus of the CCDC170 gene, individuals of GG genotype were screened to increase pig litter count.

Benefits of technology

It significantly increases the total number of pigs, live litter counts and healthy litter counts, provides fast and accurate breeding methods, and reduces environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290747A_ABST
    Figure CN120290747A_ABST
Patent Text Reader

Abstract

The invention provides a pig litter size character related SNP molecular marker in a pig CCDC170 gene, a primer pair and application thereof, and belongs to the technical field of pig molecular marker screening, the molecular marker is located in an intron of the pig CCDC170 gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and the polymorphism of the 225th site of the sequence is T or G. The invention also provides a primer pair for amplifying the molecular marker and a method for detecting and judging the litter size of pigs. The invention provides a new marker for molecular marker-assisted breeding of the pig litter size character, and the rapid identification of the pig litter size character can be realized by utilizing the marker, so that the pig breeding efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of pig molecular marker screening, and specifically relates to an SNP molecular marker, a primer pair and their applications within the porcine CCDC170 gene that are related to the litter size trait of pigs. Background Art

[0002] The reproductive traits of pigs are important economic traits and play a decisive role in the production efficiency and economic benefits of pig farms. Reproductive traits belong to medium to low heritability traits. For example, the heritability of litter traits is less than 0.1, and it is relatively difficult to improve through conventional breeding. Therefore, finding molecular markers that affect reproductive traits and combining conventional breeding with marker-assisted selection (MAS) can accelerate the genetic improvement of the litter size trait of pigs.

[0003] MAS uses molecular markers associated with specific traits as an auxiliary means for selective breeding, which has the advantages of being fast, accurate, and not affected by the environment. It can reduce the workload of on-site testers and shorten the breeding time limit. Single nucleotide polymorphism (SNP) refers to gene polymorphism caused by mutations of single nucleotides in the genomic DNA sequence, which is widely present in the genome and is often applied to breeding practice through the MAS method, playing a key role in the genetic improvement of important traits.

[0004] The CCDC170 gene is a coiled-coil protein located in the Golgi apparatus. Rosemarie Ungrichtd et al. confirmed that CCDC170 plays an important role in renal tubule formation (Ungricht et al 2022). The fusion of CCDC170 with the estrogen receptor 1 (ESR1) gene promotes tumor formation (Veeraraghavan et al 2014). In addition, Jia et al. identified CCDC170 as a potential susceptibility gene for osteoporosis (Jia et al 2023). However, the role of CCDC170 in pig reproductive traits has not been reported so far. Summary of the Invention

[0005] Aiming at the problems existing in the above-mentioned prior art, the present invention aims to provide a new molecular marker, a primer pair and their applications within the porcine CCDC170 gene that are related to the litter size trait of pigs, providing a reference basis for marker-assisted selection of the litter size trait of pigs.

[0006] The technical solution of the present invention is specifically as follows:

[0007] In the first aspect, the present invention discloses an SNP molecular marker within the porcine CCDC170 gene that is related to the litter size trait of pigs. The SNP molecular marker is located in the intron of the porcine CCDC170 gene, and its nucleotide sequence is as shown in SEQ ID NO.1 in the sequence listing. The polymorphism at the 225th position of this sequence is T or G.

[0008] In a preferred embodiment of the present invention, the polymorphism of the SNP molecular marker is manifested as three genotypes: TT, TG, or GG.

[0009] Furthermore, the total number of piglets born, the number of live-born piglets, and the number of healthy piglets of individuals with the GG genotype are significantly higher than those of individuals with the TT genotype, and the G allele is the dominant allele.

[0010] In a second aspect, the present invention discloses a primer pair for amplifying the molecular marker as described in the first aspect, and the primer pair comprises an upstream primer with a sequence as shown in SEQ ID NO.2 and a downstream primer with a sequence as shown in SEQ ID NO.3.

[0011] In a third aspect, the present invention discloses a kit for detecting the litter size trait of pigs, which comprises the primer pair as described in the second aspect.

[0012] In a fourth aspect, the present invention discloses the application of the SNP molecular marker as described in the first aspect, or the primer pair as described in the second aspect, or the kit as described in the third aspect in detecting or assisting in detecting the litter size of pigs.

[0013] In a fifth aspect, the present invention discloses the application of the SNP molecular marker as described in the first aspect, or the primer pair as described in the second aspect, or the kit as described in the third aspect in pig breeding, genetic improvement, or molecular marker-assisted selection.

[0014] In a sixth aspect, the present invention discloses the application of the SNP molecular marker as described in the first aspect, or the primer pair as described in the second aspect, or the kit as described in the third aspect in pig screening.

[0015] In a seventh aspect, the present invention discloses a method for detecting and judging the litter size of pigs, which comprises the following steps:

[0016] S1. Using the genomic DNA extracted from the test sample as a template, performing PCR amplification with primers having sequences as shown in SEQ ID NO.2 to 3;

[0017] S2. Using the PCR product as a template, reading the amplified sequence by Sanger sequencing to obtain the genotype;

[0018] S3. Judging the litter size of pigs according to the genotype.

[0019] In an eighth aspect, the present invention discloses a method for pig screening or pig breeding, which includes the method for detecting and judging the litter size of pigs as described in the seventh aspect.

[0020] Compared with the prior art, the beneficial effects of the present invention are:

[0021] The present invention discovers SNP molecular markers related to the litter size trait within the intron of the porcine CCDC170 gene. The polymorphic site of this SNP molecular marker is located at the rs81348764 site of the porcine CCDC170 gene, which is significantly associated with the litter size trait. Thus, the present invention provides a new molecular breeding marker for marker-assisted breeding of the litter size trait in pigs. Description of the Drawings

[0022] Figure 1 It is the agarose gel electrophoresis pattern of the SEQ ID NO.1 sequence fragment in the porcine CCDC170 gene;

[0023] Figure 2 It is the SANGER sequencing reading result map of the rs81348764 site of the porcine CCDC170 gene, where Figure A is the TT genotype, Figure B is the TG genotype, and Figure C is the GG genotype. Detailed Embodiments

[0024] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with specific embodiments and their accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0025] Unless otherwise specified, the embodiments are all carried out under conventional experimental conditions. The reagents and materials used, unless otherwise stated, can all be obtained from commercial channels.

[0026] Example 1 Obtaining of Porcine CCDC170 Gene Fragment and Establishment of Polymorphism Detection Method

[0027] 1. Extraction of porcine genomic DNA.

[0028] The experimental pig breed in the present invention is the Large White pig raised by the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. The porcine genomic DNA was extracted using the animal tissue genomic DNA kit produced by Beijing Tsingke New Industry Biotechnology Co., Ltd. (operated according to the instructions of this kit).

[0029] 2. Obtaining of porcine CCDC170 gene fragment.

[0030] (1) PCR amplification.

[0031] According to the genomic sequence of the porcine CCDC170 gene (GenBank accession number: NC_010443.5), the following primer pair was designed:

[0032] Upstream primer for amplifying the SEQ ID NO.1 sequence: 5’-CGACGACGACCTGGTTTAGG-3’ (SEQ ID NO.2);

[0033] Downstream primer for amplifying SEQ ID NO.1 sequence: 5’-AGTCGATCTTGTTGCTCGTGT-3’ (SEQ ID NO.3).

[0034] Perform PCR amplification on the genomic DNA of Large White pigs using the above primer pair. The PCR reaction system is 50 μL, and the concentrations of each component in the system are 100 ng template DNA, 10× buffer (containing Mg 2+ ) 4 μL, 0.5 μM of each of the above upstream and downstream primers, 2.5 μM dNTPs, and 1 U Taq DNA polymerase.

[0035] The running program of PCR is: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 10 min; storage at 4 °C.

[0036] (2) Purification of PCR products.

[0037] Purify the above PCR products using the Gel ExtraCAion Kit of Shanghai Sangon Biotech Co., Ltd. The specific steps are shown in the kit instruction manual.

[0038] 3. Detect the molecular marker by SANGER sequencing of the purified PCR products after purification.

[0039] Submit the recovered PCR products to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for SANGER sequencing. The result shows that the specific SEQ ID NO.1 of the present invention is:

[0040] CGACGACGACCTGGTTTAGGAAACACACAGCTGCTCCTGCTATGACCCATCACAGCCTGCCCACCATCTCCAGGAGCATTAATATCCAGAAACCATGGATGTATCACATATAACCATAAGCCCTAACAGGAGAAGAGCCGTCTTGCCTTTGACGCTGTGGGTGTTCTGGAACATACTTCCCAGTCGCTGAGGAGCTTCTCCTATACCATGGCAGGATCATAAGTTAAAGGCTAGTCCTTTAGCTTTTCCTGTAATCAATCTTTACAGTTTACCAACGGTCTAGAGCTTAGAGAATGACTTTAACTTCCAACCAAAGTTCTGAATTTATTTCTTACCTGATGTCAAAACAAGAAAAACAAATAAGGAAGTGAGCAAATGGCAGGAAAGAAAGATTGCAAGAGGGAATGAAGCAGAAAGAGAATGTTGAGTAGCTGCTGGCACCGTGCACTTGTTAGGGGTGTGCCAGTTTGACTTGGCTCTTCCAAATAGATCAACACGAGCAACAAGATCGACT (Total 514bp).

[0041] Example 2 Detection of Polymorphism Distribution of SNP Molecular Markers in Large White Pigs

[0042] In this example, the polymorphism of the rs81348764 site in the intron of the porcine CCDC170 gene was detected in Large White pigs, and the detection results are shown in Table 1.

[0043] Table 1 Genotype Frequencies and Allele Frequencies of the rs81348764 Site of the CCDC170 Gene in Large White Pigs

[0044]

[0045] The results in Table 1 show that at the rs81348764 site of the CCDC170 gene in Large White pigs, there are three genotypes: TT, TG, or GG, and the frequency of the T allele is 0.64.

[0046] Example 3 Association Analysis and Application of SNP Molecular Markers with Litter Size Traits in Pigs

[0047] To determine whether there is a correlation between the rs81348764 locus of the porcine CCDC170 gene and the difference in the litter size trait of pigs, the method established in Example 1 was used for polymorphism detection, and the correlation between different genotypes of the rs81348764 locus of the porcine CCDC170 gene and the litter size trait of pigs was analyzed. The GLM procedure of the SAS statistical software (SAS Institute Inc, Version 9.1) was used for the analysis of variance of different SNP genotype combinations and significant tests. The model used was:

[0048] Yij = μ + Gi + Fj + eij;

[0049] In the formula, Yij is the phenotypic value of the trait, μ is the average value, Gi is the genotype effect (including gene additive effect and dominant effect; the additive effect represents the TT, TG, and GG genotypes with 1, 0, and -1 respectively, and the dominant effect represents the TT, TG, and GG genotypes with 1, -1, and 1 respectively); Fj is the comprehensive effect of the pig farm; eij is the residual effect.

[0050] The association analysis between different genotypes and the litter size trait was carried out in Large White pigs, and the statistical analysis results are shown in Table 2.

[0051] Table 2 - Association analysis of the rs81348764 locus of the CCDC170 gene and the litter size trait of pigs

[0052]

[0053] Note: a and b indicate significant differences (P < 0.05), and * indicates significant differences (P < 0.05).

[0054] As can be seen from Table 2, in Large White pigs, the total litter size, number of live born piglets, and number of healthy born piglets of the GG genotype at the rs81348764 locus were significantly higher than those of the TT genotype (P < 0.05). The G allele is the dominant allele in this population. Therefore, individuals carrying the G allele should be retained in breeding, which is beneficial to improving the total litter size, number of live born piglets, and number of healthy born piglets of the population.

[0055] In summary, the polymorphism of the rs81348764 locus of the CCDC170 gene provided by the present invention is significantly correlated with the total litter size, number of live born piglets, and number of healthy born piglets of pigs, and can be used as a molecular marker for the litter size trait of pigs. It can be seen that the present invention provides a new molecular breeding marker for marker-assisted breeding of the litter size trait of pigs.

[0056] The above-mentioned embodiments are only to illustrate the technical solutions and features of the present invention, and their purpose is to enable those who are familiar with the technology to implement it better. It cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit and essence of the present invention are within the protection scope of the present invention. Those not described in detail are prior arts.

Claims

1. The SNP molecular marker related to the litter size trait within the porcine CCDC170 gene, characterized in that, The SNP molecular marker is located in the intron of the porcine CCDC170 gene, and its nucleotide sequence is as shown in SEQ ID NO.1 in the sequence listing. The polymorphism at the 225th position of this sequence is T or G.

2. The SNP molecular marker according to claim 1, wherein The polymorphism of the SNP molecular marker shows three genotypes: TT, TG, or GG.

3. The SNP molecular marker according to claim 2, wherein The total number of piglets born, the number of live-born piglets, and the number of healthy piglets of individuals with the GG genotype are significantly higher than those of individuals with the TT genotype, and the T allele is the dominant allele.

4. A primer pair for amplifying the molecular marker according to claim 1 or 2, characterized in that, The primer pair includes an upstream primer with a sequence as shown in SEQ ID NO.2 and a downstream primer with a sequence as shown in SEQ ID NO.

3.

5. A kit for detecting the litter size trait of pigs, characterized in that, Comprising the primer pair according to claim 4.

6. The application of the SNP molecular marker according to any one of claims 1-3, the primer pair according to claim 4, or the kit according to claim 5 in detecting or assisting in detecting the litter size of pigs.

7. The application of the SNP molecular marker according to any one of claims 1-3, the primer pair according to claim 4, or the kit according to claim 5 in pig breeding, genetic improvement, or marker-assisted selection.

8. The application of the SNP molecular marker according to any one of claims 1-3, the primer pair according to claim 4, or the kit according to claim 5 in pig screening.

9. A method for detecting and judging the litter size of pigs, characterized in that, Comprising the following steps: S1. Using the genomic DNA extracted from the test sample as a template, performing PCR amplification with primers having sequences as shown in SEQ ID NOs. 2-3. S2. Using the PCR product as a template, reading the amplified sequence by Sanger sequencing to obtain the genotype. S3. Judging the litter size of pigs according to the genotype.

10. A method for pig screening or pig breeding, characterized in that, Including the method for detecting and judging the litter size of pigs according to claim 9.

Citation Information

Patent Citations

  • Pig SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in pig litter size character screening and / or pig breeding

    CN116287293A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to litter size character of pig and application of SNP molecular marker

    CN119307626A