Pig snp molecular marker of ccdc170 gene associated with pig litter size trait, primer pair and application thereof

Abstract

The application provides a SNP molecular marker, a primer pair and application thereof which are related to a pig litter size character in a pig CCDC170 gene, belongs to the technical field of pig molecular marker screening, and the molecular marker is located in an intron of the pig CCDC170 gene, the nucleotide sequence is shown in the sequence table SEQ ID NO.1, and the polymorphism of the 225th position of the sequence is T or G. The application further provides a primer pair for amplifying the molecular marker and a method for detecting and judging the pig litter size. The application provides a new marker for molecular marker assisted breeding of the pig litter size character, and the pig litter size character can be rapidly identified by using the marker, and thus the pig breeding efficiency is improved.

Description

Technical Field

[0001] This invention belongs to the field of porcine molecular marker screening technology, specifically relating to a SNP molecular marker, primer pair and their application in the porcine CCDC170 gene that is related to the litter size trait. Background Technology

[0002] Reproductive traits in pigs are important economic traits, playing a decisive role in the production efficiency and economic benefits of pig farms. Reproductive traits are of medium to low heritability; for example, the heritability of litter size is less than 0.1, making improvement through conventional breeding difficult. Therefore, identifying molecular markers that influence reproductive traits and combining conventional breeding with marker-assisted selection (MAS) can accelerate the genetic improvement of litter size in pigs.

[0003] MAS (Molecular Marker Analysis) utilizes molecular markers associated with specific traits as an auxiliary means for selection breeding. It offers advantages such as speed, accuracy, and independence from environmental influences, reducing the workload of field testing personnel and shortening breeding timelines. Single nucleotide polymorphisms (SNPs) refer to gene polymorphisms caused by mutations in a single nucleotide in the genomic DNA sequence. Widely present in the genome, SNPs are frequently applied to breeding practices using MAS methods and play a crucial role in the genetic improvement of important traits.

[0004] The CCDC170 gene is a coiled-coil protein located in the Golgi apparatus. Rosemarie Ungrichtd et al. demonstrated that CCDC170 plays an important role in renal tubule formation (Ungricht et al 2022). Fusion of CCDC170 with the estrogen receptor 1 (ESR1) gene promotes tumorigenesis (Veeraraghavan et al 2014). Furthermore, Jia et al. identified CCDC170 as a potential susceptibility gene for osteoporosis (Jia et al 2023). However, the role of CCDC170 in porcine reproductive traits has not yet been reported. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention aims to provide a novel molecular marker, primer pair, and their application related to pig litter size traits within the porcine CCDC170 gene, providing a reference for marker-assisted selection of pig litter size traits.

[0006] The specific technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention discloses SNP molecular markers in the porcine CCDC170 gene that are associated with the pig litter size trait. The SNP molecular markers are located in the introns of the porcine CCDC170 gene, and their nucleotide sequences are shown in the sequence listing SEQ ID NO.1. The polymorphism at position 225 of the sequence is either T or G.

[0008] In a preferred embodiment of the present invention, the polymorphism of the SNP molecular marker is expressed as three genotypes: TT, TG, or GG.

[0009] Furthermore, individuals with the GG genotype had significantly higher total number of offspring, number of live offspring, and number of healthy offspring than individuals with the TT genotype, indicating that the G allele was the dominant allele.

[0010] In a second aspect, the present invention discloses a primer pair for amplifying the molecular marker as described in the first aspect, the primer pair comprising an upstream primer with the sequence shown in SEQ ID NO.2 and a downstream primer with the sequence shown in SEQ ID NO.3.

[0011] Thirdly, the present invention discloses a kit for detecting the piglet litter size trait, comprising the primer pair as described in the second aspect.

[0012] Fourthly, this invention discloses the application of the SNP molecular marker as described in the first aspect, or the primer pair as described in the second aspect, or the kit as described in the third aspect in detecting or assisting in the detection of pig litter size.

[0013] Fifthly, the present invention discloses the application of an SNP molecular marker as described in the first aspect, or a primer pair as described in the second aspect, or a kit as described in the third aspect in pig breeding, genetic improvement, or marker-assisted selection.

[0014] In a sixth aspect, the present invention discloses the application of an SNP molecular marker as described in the first aspect, or a primer pair as described in the second aspect, or a kit as described in the third aspect in pig screening.

[0015] Seventhly, the present invention discloses a method for detecting and determining the number of piglets born, comprising the following steps:

[0016] S1. Using genomic DNA extracted from the sample to be tested as a template, PCR amplification was performed using primers with sequences as shown in SEQ ID NO.2-3;

[0017] S2. Using the PCR product as a template, the amplified sequence is read by SANGER sequencing to obtain the genotype;

[0018] S3. Determine the number of piglets born based on the genotype.

[0019] Eighthly, the present invention discloses a method for pig screening or pig breeding, including the method for detecting and determining the number of piglets produced as described in the seventh aspect.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention has discovered a SNP molecular marker within an intron of the porcine CCDC170 gene that is associated with the pig litter size trait. The polymorphic site of this SNP molecular marker is located at the rs81348764 site of the porcine CCDC170 gene and is significantly associated with the pig litter size trait. Therefore, this invention provides a new molecular breeding marker for marker-assisted breeding of the pig litter size trait. Attached Figure Description

[0022] Figure 1 Agarose gel electrophoresis pattern of the sequence fragment SEQ ID NO.1 in the porcine CCDC170 gene;

[0023] Figure 2 The image shows the SANGER sequencing reads of the rs81348764 locus of the porcine CCDC170 gene. Image A shows the TT genotype, image B shows the TG genotype, and image C shows the GG genotype. Detailed Implementation

[0024] To better understand the present invention, the following detailed description, in conjunction with specific embodiments and accompanying drawings, further clarifies the invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0025] Unless otherwise specified, all examples were conducted under standard experimental conditions. All reagents and materials used are commercially available unless otherwise specified.

[0026] Example 1: Obtaining the porcine CCDC170 gene fragment and establishing a method for polymorphism detection.

[0027] 1. Extraction of porcine genomic DNA.

[0028] The experimental pig breed used in this invention was the Large White pig raised by the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. Pig genomic DNA was extracted using an animal tissue genomic DNA kit produced by Beijing Qingke Xinyue Biotechnology Co., Ltd. (procedure was performed according to the kit's instructions).

[0029] 2. Obtaining the porcine CCDC170 gene fragment.

[0030] (1) PCR amplification.

[0031] The following primer pairs were designed based on the genomic sequence of the porcine CCDC170 gene (GenBank accession number: NC_010443.5):

[0032] Amplification of the upstream primer of SEQ ID NO.1 sequence: 5'-CGACGACGACCTGGTTTAGG-3' (SEQ ID NO.2);

[0033] The downstream primer for amplifying the sequence SEQ ID NO.1 is 5'-AGTCGATCTTGTTGCTCGTGT-3' (SEQ ID NO.3).

[0034] PCR amplification was performed on Large White pig genomic DNA using the primer pairs described above. The PCR reaction system was 50 μL, and the concentrations of each component in the system were 100 ng template DNA and 10× buffer (containing Mg). 2+ 4 μL, 0.5 μM each of the above upstream and downstream primers, 2.5 μM dNTPs, and 1 U Taq DNA polymerase.

[0035] The PCR procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

[0036] (2) Purification of PCR products.

[0037] The PCR products were purified using the Gel ExtraCAion Kit from Shanghai Sangon Biotech Co., Ltd. Specific steps are detailed in the kit's instruction manual.

[0038] 3. After purifying the PCR product, molecular markers were detected by SANGER sequencing.

[0039] The recovered PCR product was sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for SANGER sequencing. The results showed that SEQ ID NO.1 of this invention specifically contains:

[0040] CGACGACGACCTGGTTTAGGAAACACACAGCTGCTCCTGCTATGACCCATCACAGCCTGCCCACCATCTCCAGGAGCATTAATATCCAGAAACCATGGATGTATCACATATAACCATAAGCCCTAACAGG AGAAGAGCCGTCTTGCCTTTGACGCTGTGGGTGTTCTGGAACATACTTCCCAGTCGCTGAGGAGCTTCCTATACCATGGCAGGATCATAAGTTAAAGGCTAGTCCTTTAGCTTTTCCTGTAATCAATCT TTACAGTTTACCAACGGTCTAGAGCTTAGAGAATGACTTTAACTTCCAACCAAAGTTCTGAATTTATTTCTTACCTGATGTCAAAACAAGAAAAACAAATAAGGAAGTGAGCAAATGGCAGGAAAGAAAGA TTGCAAGAGGGAATGAAGCAGAAAGAGAATGTTGAGTAGCTGCTGGCACCGTGCACTTGTTAGGGGTGTGCCAGTTTGACTTGGCTCTTCCAAATAGATCAACACGAGCAACAAGATCGACT (514 bp in total).

[0041] Example 2: Detection of polymorphic distribution of SNP molecular markers in large white pigs

[0042] In this embodiment, the polymorphism of the rs81348764 site of the porcine CCDC170 gene in large white pigs was detected, and the detection results are shown in Table 1.

[0043] Table 1 Genotype and allele frequencies of the CCDC170 gene rs81348764 locus in Large White pigs.

[0044]

[0045] Table 1 shows that the CCDC170 gene rs81348764 locus in Large White pigs exhibits three genotypes: TT, TG, or GG, with a T allele frequency of 0.64.

[0046] Example 3: Association Analysis and Application of SNP Molecular Markers with Pig Litter Size Trait

[0047] To determine whether the rs81348764 locus of the porcine CCDC170 gene is associated with differences in piglet number, polymorphism detection was performed using the method established in Example 1, and the correlation between different genotypes of the rs81348764 locus of the porcine CCDC170 gene and piglet number was analyzed. Analysis of variance for different SNP genotype combinations was performed using the GLM program of SAS statistical software (SAS Institute Inc, Version 9.1), and significance tests were conducted. The model used was as follows:

[0048] Yij = μ + Gi + Fj + eij;

[0049] In the formula, Yij is the phenotypic value, μ is the mean, Gi is the genotype effect (including gene additive effect and dominant effect; additive effect is represented by 1, 0 and -1 for TT, TG and GG genotypes respectively, and dominant effect is represented by 1, -1 and 1 for TT, TG and GG genotypes respectively); Fj is the pig farm comprehensive effect; eij is the residual effect.

[0050] Association analysis between different genotypes and litter size was conducted in Large White pigs, and the statistical results are shown in Table 2.

[0051] Table 2 - Association analysis between the CCDC170 gene rs81348764 locus and pig litter size trait.

[0052]

[0053] Note: a and b indicate significant differences (P<0.05), and * indicates significant differences (P<0.05).

[0054] As shown in Table 2, in Large White pigs, the total litter size, live litter size, and healthy litter size of the GG genotype at the rs81348764 locus were significantly higher than those of the TT genotype (P<0.05). The G allele is the dominant allele in this population. Therefore, individuals carrying the G allele should be retained in breeding programs to increase the total litter size, live litter size, and healthy litter size of the population.

[0055] In summary, the polymorphism at the rs81348764 locus of the CCDC170 gene provided by this invention is significantly correlated with the total number of piglets born, the number of live piglets born, and the number of healthy piglets. It can be used as a molecular marker for the pig litter size trait. It can be seen that this invention provides a new molecular breeding marker for marker-assisted breeding of the pig litter size trait.

[0056] The above embodiments are only for illustrating the technical solutions and features of the present invention, and are intended to enable those skilled in the art to implement them better. They should not be used to limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention are within the scope of protection of the present invention. The parts not described in detail are prior art.

Claims

1. Use of a primer pair for detecting a SNP molecular marker in detecting pig litter size traits, wherein the SNP molecular marker is located in an intron of pig CCDC170 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the polymorphism at position 225 of the sequence is T or G; the polymorphism of the SNP molecular marker is represented by three genotypes of TT, TG or GG; the total number of piglets, the number of live piglets and the number of healthy piglets of an individual with GG genotype are significantly higher than those of an individual with TT genotype, and the G allele is the dominant allele. The primer pair is an upstream primer with the sequence shown in SEQ ID NO. 2 and a downstream primer with the sequence shown in SEQ ID NO.

3. The pig is a Large White pig. The litter size traits are the total number of piglets, the number of live piglets and the number of healthy piglets.

2. Use of a kit for detecting pig litter size traits in detecting pig litter size traits, wherein the kit comprises the primer pair of claim 1, and the primer pair is used for detecting the SNP molecular marker of claim 1; the polymorphism of the SNP molecular marker is represented by three genotypes of TT, TG or GG; the total number of piglets, the number of live piglets and the number of healthy piglets of an individual with GG genotype are significantly higher than those of an individual with TT genotype, and the G allele is the dominant allele. The pig is a Large White pig. The litter size traits are the total number of piglets, the number of live piglets and the number of healthy piglets.

3. Use of the primer pair of claim 1 or the kit of claim 2 in pig litter size trait breeding, wherein the pig is a Large White pig; the litter size traits are the total number of piglets, the number of live piglets and the number of healthy piglets; and the total number of piglets, the number of live piglets and the number of healthy piglets of an individual with GG genotype are significantly higher than those of an individual with TT genotype, and the G allele is the dominant allele.

4. Use of the primer pair of claim 1 or the kit of claim 2 in pig litter size trait screening, wherein the pig is a Large White pig; the litter size traits are the total number of piglets, the number of live piglets and the number of healthy piglets; and the total number of piglets, the number of live piglets and the number of healthy piglets of an individual with GG genotype are significantly higher than those of an individual with TT genotype, and the G allele is the dominant allele.

5. A method for detecting and judging pig litter size traits, comprising the following steps: S1, using genomic DNA extracted from a sample to be tested as a template, and performing PCR amplification with primers with sequences shown in SEQ ID NO. 2-3; S2, using the PCR product as a template, reading the amplified sequence by SANGER sequencing, and obtaining the genotype of the SNP molecular marker of claim 1; S3, judging the pig litter size traits according to the genotype; 5. A method for detecting a pig litter size trait, characterized by, The pig is a Large White pig. The litter size traits are the total number of piglets, the number of live piglets and the number of healthy piglets. The total number of piglets, the number of live piglets and the number of healthy piglets in an individual with GG genotype are significantly higher than those in an individual with TT genotype, and the G allele is the dominant allele.

6. A kit for detecting and judging pig litter size traits, comprising the method of claim 5. The pig is a Large White pig. The litter size traits are the total number of piglet s, the number of live piglets and the number of healthy piglets. The total number of piglet s, the number of live piglets and the number of healthy piglet s in an individual with GG genotype are significantly higher than those in an individual with TT genotype, and G allele is the dominant allele.

6. A method for screening or selecting for pig litter size traits, characterized in that, ​ ​ ​ ​

Images