FMO3 gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in judging bovine ketosis resistance

Through the SNP molecular marker of the FMO3 gene, especially the ENSBTAG00000020597:g.-1613T>C site, the problem of judging ketosis resistance in dairy cows was solved, and early prediction and breeding optimization of ketosis resistance in dairy cows was achieved.

CN120290753AActive Publication Date: 2025-07-11INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510795517.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-07-11
Estimated Expiration
2045-06-16

AI Technical Summary

Technical Problem

现有技术中缺乏有效的分子标记用于判断奶牛酮病抗性,导致酮病发病率高,影响奶牛健康与养殖效益。

Method used

Provide the SNP molecular marker of the FMO3 gene, especially the SNP molecular marker located at ENSBTAG00000020597:g.-1613T>C, determine the resistance to ketosis in wet cows by detecting genotypes, and use PCR amplification and sequencing technology for genotype analysis.

Benefits of technology

By detecting the SNP molecular marker of the FMO3 gene, ketosis resistance can be significantly predicted, early marker-assisted selection and breeding can be achieved, and ketosis resistance in dairy cow populations can be optimized.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290753A_ABST
    Figure CN120290753A_ABST
Patent Text Reader

Abstract

The invention discloses an FMO3 gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in judging bovine ketosis resistance, and belongs to the technical field of animal disease-resistant molecular breeding. The SNP molecular marker is located at the position of ENSBTAG00000020597: g.-1613Tgt, and the SNP molecular marker is located at the position of C, the genotype of the molecular marker is remarkably related to the blood BHB concentration, the activity of an FMO3 gene promoter is affected, and then the BHB concentration in cow blood is affected, the CC genotype cow blood BHB concentration is remarkably lower than the TT genotype, therefore, the ketosis resistance of a cow individual with the genotype being CC is remarkably higher than that of a cow individual with the genotype being TT, and the molecular marker can be used for auxiliary breeding of cows and can be used for breeding cows. The cow group quality is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding for animal disease resistance, and particularly relates to an FMO3 gene SNP molecular marker and its application in judging the resistance of cows to ketosis. Background Art

[0002] With the continuous improvement of the intensification degree of dairy cows, the metabolic stress problems brought about by the pursuit of high yields are becoming increasingly serious. Especially in the early lactation stage, the negative energy balance of dairy cows is significantly aggravated, and it is extremely easy to induce a series of metabolic diseases represented by ketosis. Ketosis is particularly common in high-yielding dairy cows. Its essence is the accumulation of ketone bodies caused by insufficient intake of carbohydrates and massive decomposition of fat, which in turn causes metabolic disorders and affects the normal functions of the body. Its typical clinical manifestations are "three ketones" - ketonemia, ketonuria, and ketonuria; and "three lows" - hypoglycemia, decreased digestive function, and decreased milk production.

[0003] The detection standards for cow ketosis mainly include detecting the content of β-hydroxybutyric acid (BHB) in the blood. The content of β-hydroxybutyric acid in the blood of healthy adult cows should be lower than 1.2 mmol / L; when the content is between 1.2 - 3.0 mmol / L, it is subclinical ketosis; when the content is greater than 3.0 mmol / L, it is clinical ketosis.

[0004] Diseased cows are often accompanied by exhalation with a smell of rotten pears, neurological symptoms, decreased immunity, and reproductive disorders, and are extremely prone to secondary diseases such as mastitis and endometritis, ultimately leading to an increase in the culling rate. In recent years, the incidence of ketosis has been continuously rising, and it has become a key factor restricting the health of dairy cows and the improvement of breeding efficiency. Because it has a certain genetic background, carrying out research on the screening of molecular markers related to ketosis and the susceptibility mechanism has important significance and application prospects for establishing an early and accurate detection and marker-assisted breeding system.

[0005] Flavin-containing monooxygenase 3 (FMO3) is an important member of the FMO enzyme family, mainly expressed in the liver and involved in the oxidative metabolism of various nitrogen- and sulfur-containing substrates. In recent years, studies have shown that FMO3 is not only related to the detoxification of exogenous substances but also plays a key role in the regulation of lipid metabolism. The expression of FMO3 can affect fatty acid synthesis, cholesterol metabolism, and fat deposition processes. Research has shown that the weakened function of the FMO3 protease can inhibit lipid deposition in blood vessel walls and hepatocytes; a decrease in FMO3 expression helps reduce the endoplasmic reticulum stress level during the peripartum period of dairy cows, thereby alleviating lipid metabolism disorders. The T329S mutation in the FMO3 gene can improve lipid metabolism in laying hens and reduce the occurrence of atherosclerosis and fatty liver. Therefore, the FMO3 gene plays an important role in the process of lipid synthesis and metabolism, and its genetic variation may be used as a regulatory marker for metabolic homeostasis, showing broad application prospects in the research on the energy metabolism adaptation of dairy cows and molecular breeding.

[0006] There is currently no report on the correlation between the FMO3 gene and ketosis in dairy cows. In view of this, the present invention is specifically proposed. Summary of the Invention

[0007] The purpose of the present invention is to provide an SNP molecular marker related to the ketosis resistance performance of dairy cows, and to judge the ketosis resistance ability of individual dairy cows by detecting its genotype for assistant breeding.

[0008] The technical solution of the present invention is described in detail as follows: In the first aspect, the present invention provides an SNP molecular marker of the FMO3 gene, and the SNP molecular marker is located at ENSBTAG00000020597: g.-1613T>C.

[0009] This SNP molecular marker is located in the core promoter region of the FMO3 gene. The promoter structure generally includes two parts, namely the upstream regulatory element and the core promoter element. The inventor has found through research that the functional genetic variation in the core promoter region of the FMO3 gene is significantly correlated with the concentration of BHB (β-hydroxybutyric acid). The concentration of BHB in the blood of dairy cow individuals with the CC genotype of the above SNP molecular marker is significantly lower than that of individuals with the TT genotype, and its resistance to ketosis is significantly higher than that of individuals with the TT genotype.

[0010] Optionally or preferably, the above SNP molecular marker is located at the 250th position shown in SEQ ID NO:1 in the sequence listing, and the nucleotide is T or C.

[0011] In the second aspect, the present invention provides the application of the above SNP molecular marker in judging the ketosis resistance of dairy cows. The ketosis resistance of dairy cow individuals with the CC genotype of the SNP molecular marker is significantly higher than that of dairy cow individuals with the TT genotype.

[0012] Optionally or preferably, in the above application, the method for judging the ketosis resistance of dairy cows includes the following steps: (1) Extract the genomic DNA of dairy cows; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NO: 2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; (3) Sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

[0013] In the third aspect, the present invention provides the application of the above molecular marker in the assisted breeding of dairy cows. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

[0014] In the fourth aspect, the present invention provides a product for detecting the above SNP molecular marker. The product is a primer pair, and the nucleotide sequences are as shown in SEQ ID NO: 2-3.

[0015] In the fifth aspect, the present invention provides another product for detecting the SNP molecular marker. The product is a detection kit, including a primer pair, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO: 2-3.

[0016] In the sixth aspect, the present invention provides the application of the above detection product in judging the ketosis resistance of dairy cows. Specifically, extract the genomic DNA of dairy cows, use the nucleotide sequences shown in SEQ ID NO: 2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

[0017] In the seventh aspect, the present invention provides the application of the above detection product in the assisted breeding of dairy cows. Specifically, extract the genomic DNA of dairy cows, use the nucleotide sequences shown in SEQ ID NO: 2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

[0018] Compared with the prior art, the present invention has the following beneficial effects: (1)The present invention provides a genetic variation SNP molecular marker in the core promoter region of the FMO3 gene, located at ENSBTAG00000020597 g.-1613T>C. Analysis reveals that it is significantly correlated with the blood BHB concentration in dairy cows. The blood BHB concentration of individuals with the CC genotype is significantly lower than that of individuals with the TT genotype ( P <0.05). When the SNP molecular marker is of the CC genotype, the promoter activity of the FMO3 gene is significantly increased, indicating that the CC genotype is the genotype resistant to ketosis.

[0019] (2)By using the SNP molecular marker provided by the present invention and analyzing the genotype of this genetic variation site through sequencing, the resistance of dairy cows to ketosis can be predicted, and then high-quality genotype dairy cow individuals can be screened, which can be used for early marker-assisted selection and assisted breeding of dairy cows to optimize the dairy cow population. Description of the Drawings

[0020] Figure 1 It is a bar chart of the statistical data of the luciferase activity detection results in Example 1, showing that the core promoter region of the bovine FMO3 gene is identified to be located at g.1862~g.-1600.

[0021] Figure 2 It is a bar chart of the statistical data of the influence of different genotypes of the SNP molecular marker on the promoter activity of the bovine FMO3 gene in Example 2. Detailed Embodiments

[0022] In order to enable those skilled in the art to better understand the solution of this application, the following will clearly and completely describe this application in combination with the embodiments and the drawings. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all from commercial channels unless otherwise specified.

[0023] Example 1 Screening and Identification of SNP Molecular Marker Identification of genetic variation in the core promoter region of the FMO3 gene.

[0024] 1. Extraction of blood DNA from ketosis cows and healthy cows (1)Sample collection and processing Use an EDTA-K2 anticoagulant vacuum blood collection tube (specification: 5 mL) to aseptically collect fresh blood from dairy cows, and immediately gently invert and mix 8-10 times. The whole blood sample is transported to the on-site laboratory in an ice box at 4°C.

[0025] (2)β-hydroxybutyric acid (BHB) detection The blood BHB concentration was measured using a dairy cow blood ketone body tester and recorded on site.

[0026] According to the international diagnostic criteria for subclinical ketosis (BHB ≥ 1.2 mmol / L), dairy cows were divided into: Ketosis group (BHB ≥ 1.2 mmol / L) Healthy control group (BHB < 1.2 mmol / L) (3)Genomic DNA extraction and preservation Take 200 μL of anticoagulated whole blood and extract it according to the operation instructions of the DNA extraction kit. After the extraction product was detected for concentration, it was aliquoted and stored in a -20°C ultra-low temperature refrigerator for later use.

[0027] 2. Determination of the core promoter region of the bovine FMO3 gene (1)Construction of truncated vectors in the promoter region Based on the reference sequence of the bovine FMO3 gene (Gene ID: ENSBTAG00000020597) in the Ensembl database, a series of primers were designed using Primer Premier 5.0.

[0028] Fix the downstream primer PGL3+70 (+70 bp site), and the upstream primer was designed by the method of fixing the 3' end and shortening the 5'→3' end in turn. The upstream primers were PGL3-1862, PGL3-1600, PGL3-1133, PGL3-754, and PGL3-410 respectively.

[0029] The above primers were used to amplify the 2000 bp promoter region upstream of the FMO3 gene, and the lengths of the amplified fragment products were 1932 bp, 1670 bp, 1203 bp, 824 bp, and 480 bp respectively.

[0030] After purifying the amplification products, they were cloned into the pGL3-basic vector to construct 5 truncated recombinant vectors: PGL3-1862 (-1862bp~+70bp), PGL3-1600 (-1600bp~+70bp), PGL3-1133 (-1133bp~+70bp), PGL3-754 (-754bp~+70bp), PGL3-410 (-480bp~+70bp).

[0031] (2)Co-transfect the 5 truncated recombinant vectors constructed above with the pRL-TK internal reference vector (1:50) into HEK-293T cells (Lipofectamine 3000). After 48 hours of transfection, use the Dual-Luciferase Reporter Assay System (Promega) to detect the activities of firefly luciferase and Renilla luciferase. The ratio of the two is the relative luciferase activity. The data was verified by three independent experiments (n = 6). The core promoter region of the bovine FMO3 gene was determined through the relative luciferase activity.

[0032] Statistical analysis showed that the luciferase activity of the PGL3-1862 recombinant vector was significantly higher than that of other truncations ( P <0.05), and it was determined that g.1862~g.-1600 is the core promoter region of the bovine FMO3 gene ( Figure 1 ).

[0033] 3. Screening and identification of genetic variations in the core promoter region of the FMO3 gene Design primers for the core promoter region of the bovine FMO3 gene: FMO3-F (TCAGTCATATCCGACCCTC, as shown in SEQ ID NO:2), FMO3-R (GGCAGTTTCTGATGGAGGC, as shown in SEQ ID NO:3), Use the genomic DNA extracted from the whole blood of ketotic cows and healthy cows as templates, and perform PCR amplification with the primers shown in SEQ ID NO:2~3 above. The amplified products are directly sequenced and analyzed. The sequence after PCR amplification is as follows: TCAGTCATATCCGACCCTCAGCGACCCCATGGATGGCAGCCCACCAGGCTCCTCCGTCCGTGGGATTTTCCAGGCAAGAGTACTGGAGTGGGGTGCCATTGCCTTCTCCGACATATATATATATATATATATATATGTATGTATGTATAAATATAAATACAAATACATTTATATCCTCTAAGTTTGTGACAATTGAGCAAGAAATAGTAGTAGTGTAGATCTTCATTTGATTAATGAATAAAACAAGAA T

[0034] The sequencing results were BLAST aligned with the Ensembl reference sequence (ENSBTAG00000020597). The results showed that there was a T>C base substitution (g.-1613T>C) at the -1613 bp position, which was located at the 250th base of the sequence (reference sequence number: NC_037348.1), verified as a true SNP locus, and showed T / C biallelic polymorphism in the population.

[0035] The core promoter region of the FMO3 gene (g.1862~g.-1600) was verified by Sanger sequencing. The sequencing results were BLAST aligned with the Ensembl reference sequence (ENSBTAG00000020597). The results showed that there was a T>C base substitution (g.-1613T>C) at the -1613 bp position, which was located at the 250th base of the sequence shown in SEQ ID NO:1 above (underlined and bolded), verified as a true SNP locus, and showed T / C biallelic polymorphism in the population.

[0036] Example 2 Verification of the Association between SNP Molecular Markers and Ketosis Resistance The effect of the genetic variation g.-1613T>C in the core promoter region on gene promoter activity and the correlation analysis with blood BHB concentration.

[0037] 1. The effect of the genetic variation g.-1613T>C in the promoter region of the FMO3 gene on promoter activity The site-directed mutagenesis technique was used to construct g.-1613T>C allele reporter plasmids (PGL3-1862-T / C), namely PGL3-1862-T (before mutation) and PGL3-1862-C (after mutation). These two plasmids were transfected into HEK-293T cells by Lipofectamine3000 respectively. After 48 hours, the dual-luciferase activity was detected using the Dual-Luciferase Reporter Assay System. The experimental results showed that the promoter activity was significantly enhanced in the CC genotype compared with the TT genotype, and the promoter activity of the FMO3 gene was significantly increased ( P <0.05), see Figure 2 , indicating that this SNP locus has a transcriptional regulatory function.

[0038] 2. Genotyping of the genetic variation in the promoter of the FMO3 gene and correlation analysis with blood BHB concentration Using the FMO3 gene promoter primers FMO3-F and FMO3-R, the genomic DNA of 285 Holstein cows (including healthy cows and ketosis cows) was amplified by PCR, and the g.-1613T>C gene typing was performed after sequencing. Association analysis was carried out using SAS software, and the results are shown in Table 1.

[0039] Table 1 Results of association analysis between three genotypes of genetic variation g.-1613T>C in the promoter region of the FMO3 gene in cows and blood BHB concentration Note: The same letter superscript indicates no significant difference, and different letter superscripts indicate significant difference.

[0040] The results showed that the genetic variation g.-1613T>C was significantly correlated with the BHB concentration, and the blood BHB concentration of individuals with the CC genotype was significantly lower than that of individuals with the TT genotype ( P <0.05).

[0041] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be pointed out that for those of ordinary skill in the art, any obvious modifications, equivalent replacements or other improvements made without departing from the inventive concept shall be included within the protection scope of the present invention.

Claims

1. The SNP molecular marker of the FMO3 gene, characterized in that, The SNP molecular marker is located at ENSBTAG00000020597: g.-1613T>C.

2. The SNP molecular marker according to claim 1, wherein It is located at the 250th position shown in SEQ ID NO:1 in the sequence listing, and the nucleotide is T or C.

3. Use of the SNP molecular marker according to claim 1 or 2 in judging the resistance of dairy cows to ketosis, characterized in that The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

4. The application according to claim 3, characterized in that, The method for judging the ketosis resistance of dairy cows includes the following steps: (1) Extract the genomic DNA of dairy cows; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NO:2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; (3) Sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

5. Use of the molecular marker according to claim 1 or 2 in the assisted breeding of dairy cows, characterized in that, The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

6. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that, The product is a primer pair, and the nucleotide sequence is as shown in SEQ ID NO:2-3.

7. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that, The product is a detection kit, including a primer pair, and the nucleotide sequence of the primer pair is as shown in SEQ ID NO:2-3.

8. Use of the product according to claim 7 in the determination of the ketosis resistance of dairy cows, characterized in that, Extract the genomic DNA of dairy cows, use the nucleotide sequences shown in SEQ ID NO:2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

9. Use of the product according to claim 7 in the assisted breeding of dairy cows, characterized in that, Extract the genomic DNA of dairy cows, use the nucleotide sequences shown in SEQ ID NO:2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker; sequence the amplification product. The ketosis resistance of dairy cow individuals with the SNP molecular marker genotype of CC is significantly higher than that of dairy cow individuals with the genotype of TT.

Citation Information

Patent Citations

  • Kit and method for detecting polymorphism of FMO3 gene of egg-laying chicken

    CN101899524A

  • Molecular marker related to concentration of beta-hydroxybutyric acid in blood of dairy cows and application

    CN113416789A

  • Blood coding gene CYP1A1 related to dairy cow ketosis and PCR detection kit thereof

    CN113481220A

  • SNP molecular marker for dairy cow milk heat resistance screening and application in breeding field

    CN113897441A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to cow mastitis resistance and application of SNP molecular marker

    CN117025797A