Primer probe composition for detecting border disease virus and RPA (recombinase polymerase amplification) detection method

By designing specific fluorescent probe compositions for RPA detection of boundary disease viruses, the problem of lack of rapid sensitive detection in the prior art is solved, and rapid and accurate detection of boundary disease viruses is achieved, which is suitable for emergency and on-site applications.

CN120290790APending Publication Date: 2025-07-11BEIJING BIAOCHI ZEHUI BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510473052.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The prior art lacks effective recombinase polymerase amplification (RPA) primers for rapid, sensitive and specific detection of border disease viruses, and existing methods are not suitable for large-scale epidemiological investigations and emergency testing.

Method used

A primer probe composition is designed, including a specific fluorescent probe and upstream and downstream primers. The specific fluorescent probe contains a tetrahydrofuran residue site between position 31 and position 32, and contains blocking modification, fluorescence reporter and quenching groups at the 3' end, with a molar ratio of 3:3:1, for isothermal amplification of recombinase enzymes, with a reaction temperature of 35-41°C, preferably 39°C, and a reaction time of 30 minutes.

Benefits of technology

实现了快速、准确的边界病病毒检测,操作简单,不需昂贵热循环设备,适合紧急和现场检测,降低气溶胶污染风险,提供了强有力的防控支持。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290790A_ABST
    Figure CN120290790A_ABST
Patent Text Reader

Abstract

The invention provides a primer probe composition for detecting border disease virus and application thereof, and relates to the technical field of biological detection, and the primer probe composition comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 34, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 40 and a specific fluorescent probe. The invention provides the primer probe for detecting the border disease virus based on the RPA, and solves the technical problem of lack of the RPA primer for detecting the border disease virus in the prior art.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and in particular to a primer-probe composition for detecting border disease virus and an RPA detection method. Background Art

[0002] Border disease (BD) is a class II infectious disease and a viral disease. It got its name because it was first discovered in the border areas of England and Wales. It is also known as the lamb wool tremor disease. It is a congenital infectious disease caused by the border disease virus, mainly characterized by hairy body, stunted growth and neurological abnormalities in newborn lambs.

[0003] Border disease virus (BDV) is a member of the genus Pestivirus in the family Flaviviridae. In addition to BDV, the genus Pestivirus also includes: classical swine fever virus (CSFV), bovine viral diarrhea virus type 1 (BVDV-1) and BVDV-2. These viruses have the key characteristics of single-stranded positive-sense RNA viruses, which are characterized by a single open reading frame encoding a polyprotein, which is subsequently cleaved by viral and cellular proteases into Npro, capsid (C), three envelope proteins (Erns, E1 and E2) and seven non-structural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B). According to the 5'-UTR and Npro regions of the virus, BDV strains are divided into eight genotypes (BDV-1 - BDV-8), and all Chinese isolates so far belong to BDV-3.

[0004] BDV is an important infectious disease of ruminants. Grassroots veterinarians and farmers in many areas do not understand this disease. Moreover, there is no specific medicine for treating this disease and no effective vaccine for prevention. It is difficult to prevent and control, posing a threat to the healthy development of the sheep industry. Achieving rapid and accurate detection of BDV virus and cooperating with timely and effective prevention and control measures, such as isolating infected and diseased animals, eliminating the source of infection, reducing the incidence of this disease, reducing the economic losses of the livestock industry, and promoting the healthy development of the aquaculture industry.

[0005] The diagnosis of border disease usually adopts a combination of various detection techniques. The laboratory diagnosis of border disease mainly includes virus isolation and identification, nucleic acid detection (RT-PCR), and serological detection techniques (virus neutralization test, ELISA, cross-serum neutralization test). The virus isolation and identification method is the gold standard for diagnosing this disease, but it is time-consuming and laborious, and is not suitable for large-scale epidemiological investigations and emergency detections at the scene of sudden infectious diseases. Recombinase Polymerase Amplification (RPA) is a new type of isothermal nucleic acid amplification technology, which can directly read the test results in a portable constant temperature amplification fluorescence detector, without the need for complex thermal cycling equipment, and usually without nucleic acid purification. The RPA reaction is fast, and the amplification and detection can be completed in a short time, which is suitable for emergency and on-site detection needs.

[0006] This application has established a rapid, sensitive, and specific RPA detection method for border disease virus. Summary of the Invention

[0007] One of the purposes of the present invention is to provide a primer-probe composition for detecting border disease virus, so as to solve the technical problem of the lack of RPA primers for detecting border disease virus in the prior art.

[0008] Another purpose of the present invention is to provide the application of the above primer-probe composition in the preparation of products for detecting or assisting in the detection of border disease virus, products for detecting whether a test sample contains border disease virus, products for diagnosing or assisting in the diagnosis of diseases caused by border disease virus, or products for screening diseases caused by border disease virus.

[0009] Another purpose of the present invention is to provide a reagent for detecting border disease virus.

[0010] Another purpose of the present invention is to provide a kit for detecting border disease virus.

[0011] Another purpose of the present invention is to provide the application of the above reagent or the above kit in the preparation of products for detecting or assisting in the detection of border disease virus, products for detecting whether a test sample contains border disease virus, products for diagnosing or assisting in the diagnosis of diseases caused by border disease virus, or products for screening diseases caused by border disease virus.

[0012] Another purpose of the present invention is to provide a method for detecting or assisting in the detection of border disease virus for non-therapeutic and non-diagnostic purposes.

[0013] In order to achieve the above purposes of the present invention, the following technical solutions are specifically adopted:

[0014] In a first aspect, the present invention provides a primer-probe composition for detecting border disease virus, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 34, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 40, and a specific fluorescent probe with a nucleotide sequence as shown in SEQ ID NO: 16.

[0015] Furthermore, a tetrahydrofuran residue site is contained between the 31st and 32nd positions of the specific fluorescent probe, and a blocking modification is included at the 3'-end of the nucleotide sequence shown in SEQ ID NO: 16.

[0016] Furthermore, the T base at the 30th position of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quenching group, and the T base at the 32nd position is labeled with a fluorescent reporter group or a fluorescent quenching group;

[0017] Preferably, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460 or LCRED705;

[0018] The fluorescent quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1 or TAMRA;

[0019] The 3'-end of SEQ ID NO. 16 is linked to a C3-spacer.

[0020] Furthermore, the molar ratio of the upstream primer, the downstream primer and the specific fluorescent probe is 3:3:1.

[0021] In a second aspect, the present invention provides the application of the above primer-probe composition in any of the following:

[0022] A1. Application in the preparation of products for detecting or assisting in the detection of border disease virus;

[0023] A2. Application in the preparation of products for detecting whether a test sample contains border disease virus;

[0024] A3. Application in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by border disease virus;

[0025] A4. Application in the preparation of products for screening diseases caused by border disease virus.

[0026] In a third aspect, the present invention provides a reagent for detecting border disease virus, comprising the above primer-probe composition.

[0027] Fourthly, the present invention provides a kit for detecting border disease virus, comprising the above-mentioned primer-probe composition or the above-mentioned reagent.

[0028] Furthermore, it further comprises other reagents required for recombinase isothermal amplification.

[0029] Fifthly, the present invention provides the application of the above-mentioned reagent or the above-mentioned kit in any of the following:

[0030] B1. Application in detecting or assisting in detecting border disease virus or preparing a product for detecting or assisting in detecting border disease virus;

[0031] B2. Application in detecting whether a test sample contains border disease virus or preparing a product for detecting whether a test sample contains border disease virus;

[0032] B3. Application in preparing a product for diagnosing or assisting in diagnosing a disease caused by border disease virus;

[0033] B4. Application in screening a disease caused by border disease virus or preparing a product for screening a disease caused by border disease virus.

[0034] Sixthly, the present invention provides a method for detecting or assisting in detecting border disease virus for non-therapeutic and non-diagnostic purposes, comprising performing recombinase isothermal amplification on a sample by using the above-mentioned primer-probe composition, the above-mentioned reagent or the above-mentioned kit, and determining whether border disease virus exists in the sample according to the fluorescence signal.

[0035] Furthermore, the reaction temperature of the recombinase isothermal amplification is 35-41 °C, preferably 39 °C;

[0036] Preferably, the reaction time of the recombinase isothermal amplification is 30 min.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] (1) The primer-probe composition provided by the present invention has good specificity and sensitivity for border disease virus and can be effectively and accurately detected.

[0039] (2) Compared with the existing PCR technology, the detection method provided by the present invention is simple and rapid in operation, does not require expensive thermal cycling detection equipment, and the method can directly read the detection result in only 30 minutes, which is suitable for the urgent and on-site detection requirements with a short detection time. Compared with the RPA test strip method, this method does not need to open the lid after amplification, minimizing the risk of aerosol contamination to the greatest extent. This method provides strong technical support for the prevention and control of border disease virus and has a very broad application prospect. Description of the Drawings

[0040] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0041] Figure 1 RPA amplification results after pairing different upstream primers and downstream primers for Example 1;

[0042] Figure 2 RPA amplification results after pairing different upstream primers and downstream primers for Example 2;

[0043] Figure 3 RPA amplification results after pairing different upstream primers and downstream primers for Example 3;

[0044] Figure 4 RPA amplification results for different primer concentrations (Figure A) and different probe concentrations (Figure B) in Example 4;

[0045] Figure 5 For Example 5, the RPA amplification results at different Mg 2+ concentrations;

[0046] Figure 6 RPA amplification results for the sensitivity of different copy numbers of samples to be tested in Example 6. Specific Embodiments

[0047] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meanings and scopes of the terms should be clear. However, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or extrinsic definition. In this application, unless otherwise specified, the use of "or" means "and / or". In addition, the use of the term "comprising" and other forms is non-restrictive.

[0048] Unless otherwise specified, the methods and techniques of the present invention generally follow the conventional methods well-known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.

[0049] On the one hand, the present invention provides a primer-probe composition for detecting border disease virus, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 34, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 40, and a specific fluorescent probe with a nucleotide sequence as shown in SEQ ID NO: 16.

[0050] The 31st and 32nd positions of the specific fluorescent probe contain a tetrahydrofuran residue site, and a blocking modification is included at the 3' end of the nucleotide sequence shown in SEQ ID NO: 16.

[0051] Specifically, the blocking modification is a modified blocking group, and any modified group that can prevent the polymerase from synthesizing new bases can be specifically selected.

[0052] In some alternative embodiments, the T base at the 30th position of the specific fluorescent probe is labeled with a fluorescent reporter group, and the T base at the 32nd position is labeled with a fluorescent quenching group.

[0053] In some alternative embodiments, the T base at the 30th position of the specific fluorescent probe is labeled with a fluorescent quenching group, and the T base at the 32nd position is labeled with a fluorescent reporter group.

[0054] Specifically, the fluorescent reporter group modified on the probe can be any fluorescent group, and the fluorescent quenching group modified on the probe can be any group sufficient to quench the corresponding fluorescent group.

[0055] In some specific embodiments, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460 or LCRED705. The fluorescent quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1 or TAMRA. A C3-spacer is connected to the 3' end of SEQ ID NO: 16.

[0056] The primer-probe composition provided by the present invention is designed according to the nucleotide sequence shown in SEQ ID NO: 1, which solves the technical problem of the lack of RPA primers for detecting border disease virus in the prior art.

[0057] In order to further improve the amplification efficiency, in some specific embodiments, the molar ratio of the upstream primer, the downstream primer and the specific fluorescent probe is 3:3:1.

[0058] According to another aspect of the present invention, there is also provided the application of the above primer-probe composition in any one of the following:

[0059] A1. Application in the preparation of products for detecting or assisting in the detection of border disease virus;

[0060] A2. Application in the preparation of products for detecting whether a test sample contains border disease virus;

[0061] A3. Application in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by border disease virus;

[0062] A4. Use in the preparation of products for screening diseases caused by border disease virus.

[0063] Among them, the product can be a reagent, or a kit, or other detection products.

[0064] According to another aspect of the present invention, there is also provided a reagent for detecting border disease virus, comprising the above primer-probe composition.

[0065] According to another aspect of the present invention, there is also provided a kit for detecting border disease virus, comprising the above primer-probe composition or the above reagent.

[0066] In some specific embodiments, it further comprises other reagents required for recombinase isothermal amplification.

[0067] According to another aspect of the present invention, there is also provided the use of the above reagent or the above kit in any of the following:

[0068] B1. Use in the detection or auxiliary detection of border disease virus or the preparation of products for detecting or auxiliary detecting border disease virus;

[0069] B2. Use in the detection of whether a sample contains border disease virus or the preparation of products for detecting whether a sample contains border disease virus;

[0070] B3. Use in the preparation of products for diagnosing or auxiliary diagnosing diseases caused by border disease virus;

[0071] B4. Use in the screening of diseases caused by border disease virus or the preparation of products for screening diseases caused by border disease virus.

[0072] According to another aspect of the present invention, there is also provided a method for detecting or auxiliary detecting border disease virus for non-therapeutic and non-diagnostic purposes, comprising performing recombinase isothermal amplification on a sample using the above primer-probe composition, the above reagent or the above kit, and determining whether border disease virus is present in the sample according to the fluorescence signal.

[0073] Among them, the sample includes environmental samples or animal tissues and / or organs.

[0074] The system for performing recombinase isothermal amplification is 50 μL, and the reaction system is shown in Table 1.

[0075] Table 1 Recombinase isothermal amplification system

[0076] Reagent Volume (μL) RPA Lyophilized Enzyme 1 tube 10 μmol / L Forward Primer 3 10 μmol / L Reverse Primer 3 10 μmol / L Specific Fluorescent Probe 1 <![CDATA[0.5M of Mg 2+ > 1.4 RPA Reaction Buffer 29.5 Nucleic Acid to be Measured 1 <![CDATA[ddH2O]]> 10.9

[0077] In some specific embodiments, the reaction temperature of the recombinase isothermal amplification is 35 - 41 °C, preferably 39 °C;

[0078] In some specific embodiments, the reaction time of the recombinase isothermal amplification is 30 min.

[0079] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0080] In the following examples, the recombinase isothermal amplification (RPA amplification) used was the TwistAmp nfo kit (manufacturer: TwistDx, model: TANFO02KIT).

[0081] Example 1 Primary screening of RPA amplification primers

[0082] 1. Design of the primary candidate primer set

[0083] Using the 5'-UTR sequence (the nucleotide sequence shown in SEQ ID NO: 1) as a template, seven primer sets were designed with a fixed length of 32 bp. The upstream primer sets were F1 to F7, and the downstream primer sets were R1 to R7, as shown in Table 2 specifically. The following sequences were sent to Shanghai Sangon Biotech Co., Ltd. for synthesis.

[0084] Table 2 Primary candidate primer set

[0085] Primer Sequence (5’—3’) Number F1 GCCATGCCCTTAGTAGGACTAGCAGACGGGGG SEQ ID NO:2 F2 TAGTAGGACTAGCAGACGGGGGGACTAGCCAT SEQ ID NO:3 F3 AGCAGACGGGGGGACTAGCCATCGTGGTGAGA SEQ ID NO:4 F4 GGGACTAGCCATCGTGGTGAGATCCCTGAGTG SEQ ID NO:5 F5 ATCGTGGTGAGATCCCTGAGTGGTCTAAGTCC SEQ ID NO:6 F6 GATCCCTGAGTGGTCTAAGTCCTGAGTACAGG SEQ ID NO:7 F7 TGGTCTAAGTCCTGAGTACAGGACAGTCGTCA SEQ ID NO:8 R1 CAGCAGAGATTTTTATACTAGCCTATACGTGG SEQ ID NO:9 R2 TTTTATACTAGCCTATACGTGGGCCTCTGCAG SEQ ID NO:10 R3 GCCTATACGTGGGCCTCTGCAGCACCCTATCA SEQ ID NO:11 R4 GGGCCTCTGCAGCACCCTATCAGGTTGTAATC SEQ ID NO:12 R5 AGCACCCTATCAGGTTGTAATCCCAACACCAC SEQ ID NO:13 R6 CAGGTTGTAATCCCAACACCACTAGGTGTTTA SEQ ID NO:14 R7 TCCCAACACCACTAGGTGTTTAAACCCTGGCG SEQ ID NO:15

[0086] 2. Design of the probe

[0087] Using the sequence between F7 and R7 as a template, the probe was designed according to the TwistDx RPA kit instructions. The probe sequence is:

[0088] CAAGGCCAAAGCGTGTCTTGGGCATGCCCTCHTCCACGTAGCATCTC B (SEQ ID NO: 16), where H is the THF (tetrahydrofuran residue) site, B is the blocking group C3-spacer, the 30th T base is labeled with the fluorescent reporter group dT-FAM, and the 32nd T base is labeled with the fluorescent quenching group dT-BHQ1. The sequence was sent to Shanghai Sangon Biotech Co., Ltd. for synthesis.

[0089] 3. Amplification of RPA

[0090] The primers and probes in Table 2 were used for recombinase polymerase isothermal amplification with the TwistDx RPA kit. The total volume of the RPA reaction system was 50 μL. Among them, 2.1 μL of the forward primer with a concentration of 10 μmol / L was added, 2.1 μL of the reverse labeled primer was added, 0.6 μL of the probe with a concentration of 10 μmol / L was added, 1 μL of the DNA template (plasmid containing the 5'-UTR sequence) with a concentration of 2 pg / μL was added, 29.5 μL of the RPA reaction buffer, and 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL.

[0091] First, fix the selection of F1 and pair it with R1-R7 primers for pairwise amplification. After comparing the amplification efficiencies of these primer pairs, then fix the best amplification primer among the R primers and pair it with F1-F7 primers for pairwise amplification and compare the amplification effects.

[0092] The RPA amplification reaction procedure was: isothermal reaction at 39 °C for 30 minutes.

[0093] Detection of RPA products: Use a constant temperature fluorescence detector to record the changes in fluorescence signals in real time, and then compare the signal start time and signal strength of each reaction. The results are as Figure 1 shown. Among them, A is the RPA amplification result after fixing the upstream primer F1 and then pairing F1 with downstream primers pairwise; B is the RPA amplification result after fixing the downstream primer R3 and then pairing R3 with upstream primers pairwise. From Figure 1 A, it can be seen that the amplification efficiency of the R3 pairing is better, and from Figure 1 B, it can be seen that the amplification efficiency of F5 is better.

[0094] Primary screening result: F5 and R3 are a pair of primers with the highest amplification efficiency in this round of amplification.

[0095] Example 2 Secondary screening of RPA primers

[0096] 1. Primer design

[0097] Based on the best primer pair F5 and R3 in Example 1, while keeping the primer length unchanged, the primers were translated by about 2 bp, and thus a new set of upstream primers and a new set of downstream primers were obtained. The following sequences were sent to Shanghai Sangon Biotech Co., Ltd. for synthesis. The specific sequences are shown in Table 3.

[0098] Table 3 Secondary candidate primer sets

[0099]

[0100]

[0101] 2. RPA amplification

[0102] The primers in Table 3 were used for recombinase polymerase isothermal amplification with the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. Among them, 2.1 μL of the forward primer with a concentration of 10 μmol / L was added, 2.1 μL of the reverse labeled primer was added, 0.6 μL of the probe with a concentration of 10 μmol / L was added, 1 μL of the DNA template (plasmid containing the 5'-UTR sequence) with a concentration of 20 fg / μL was added, 29.5 μL of the RPA reaction buffer, and 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL.

[0103] First, fix the selection of F5 and amplify it pairwise with the primers R31 - R33, R3, R34 - R37. After comparing the amplification efficiencies of these primer pairs, then fix the best amplification primer among the R primers and amplify it pairwise with the primers F51 - F53, F5, F54 - F57, and compare the amplification effects.

[0104] The RPA amplification reaction program was: isothermal reaction at 39°C for 30 minutes.

[0105] Detection of RPA products: Use a constant temperature fluorescence detector to record the change of fluorescence signals in real time, and then compare the signal start time and the strength of each reaction signal. The results are as Figure 2 shown. Among them, A is the RPA amplification result after fixing the upstream primer F5 and then pairing F5 with the downstream primers pairwise; B is the RPA amplification result after fixing the downstream primer R36 and then pairing R36 with the upstream primers pairwise. From Figure 1 A, it can be seen that the amplification efficiency of the pairing with R36 is better, and from Figure 1 B, it can be seen that the amplification efficiency of F52 is better.

[0106] The second-level screening result: F52 and R36 are a pair of primers with the highest amplification efficiency in this round.

[0107] Example 3 Tertiary Screening of RPA Primers

[0108] 1. Primer Design

[0109] Based on the best primer pair F52 and R36 in Example 2, while keeping the 5'-end position of the primers unchanged, the primers were shortened or extended by 1 bp, and thus new upstream primer groups and downstream primer groups were obtained. The sequences were sent to Shanghai Sangon Biotech Co., Ltd. for synthesis. The specific sequences are shown in Table 4.

[0110] Table 4 Tertiary Candidate Primer Groups

[0111] Primer Sequence (5’—3’) Number F521 AGCCATCGTGGTGAGATCCCTGAGTGGTCT SEQ ID NO:31 F522 AGCCATCGTGGTGAGATCCCTGAGTGGTCTA SEQ ID NO:32 F523 AGCCATCGTGGTGAGATCCCTGAGTGGTCTAAG SEQ ID NO:33 F524 AGCCATCGTGGTGAGATCCCTGAGTGGTCTAAGT SEQ ID NO:34 F525 AGCCATCGTGGTGAGATCCCTGAGTGGTCTAAGTC SEQ ID NO:35 F526 AGCCATCGTGGTGAGATCCCTGAGTGGTCTAAGTCC SEQ ID NO:36 F527 AGCCATCGTGGTGAGATCCCTGAGTGGTCTAAGTCCT SEQ ID NO:37 R361 ACGTGGGCCTCTGCAGCACCCTATCAGGTT SEQ ID NO:38 R362 ACGTGGGCCTCTGCAGCACCCTATCAGGTTG SEQ ID NO:39 R363 ACGTGGGCCTCTGCAGCACCCTATCAGGTTGTA SEQ ID NO:40 R364 ACGTGGGCCTCTGCAGCACCCTATCAGGTTGTAA SEQ ID NO:41 R365 ACGTGGGCCTCTGCAGCACCCTATCAGGTTGTAAT SEQ ID NO:42 R366 ACGTGGGCCTCTGCAGCACCCTATCAGGTTGTAATC SEQ ID NO:43 R367 ACGTGGGCCTCTGCAGCACCCTATCAGGTTGTAATCC SEQ ID NO:44

[0112] 2. RPA Amplification

[0113] The primers in Table 4 were used for recombinase polymerase isothermal amplification with the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. Among them, 2.1 μL of the forward primer with a concentration of 10 μmol / L was added, 2.1 μL of the reverse labeled primer was added, 0.6 μL of the probe with a concentration of 10 μmol / L was added, 1 μL of the DNA template (plasmid containing the 5’-UTR sequence) with a concentration of 2 fg / μL was added, 29.5 μL of the RPA reaction buffer, and 1.4 μL of 0.5 M Mg 2+ was added, and ddH2O was added to make up to 50 μL.

[0114] First, F52 was fixed and paired with R361-R362, R36, and R363-R367 primers for pairwise amplification. After comparing the amplification efficiencies of these primer pairs, the best amplification primer among the R primers was fixed and paired with F521-F522, F52, and F523-F527 primers for pairwise amplification, and the amplification effects were compared.

[0115] The RPA amplification reaction procedure was: an isothermal reaction at 39 °C for 30 minutes.

[0116] Detection of RPA products: The change of fluorescence signal was recorded in real time using an isothermal fluorescence detector, and then the signal start time and the strength of each reaction signal were compared. The results are as Figure 3 shown. A is the RPA amplification result after fixing the upstream primer F52 and then pairing F52 with downstream primers pairwise; B is the RPA amplification result after fixing the downstream primer R363 and then pairing R363 with upstream primers pairwise. From Figure 3 A, it can be seen that the reaction signal of R363 starts the fastest and the signal is strong, so R363 is the best downstream primer; from Figure 3 B, it can be seen that the reaction signal of F524 starts the fastest and the signal is strong, so F524 is the best upstream primer.

[0117] The result of the third-level screening: F524 and R363 are a pair of primers with the highest amplification efficiency in this round of amplification.

[0118] Example 4 Screening of Primer and Probe Concentrations

[0119] 1. Optimal Primer Concentration

[0120] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. Primers F524 and R363 with a concentration of 10 μmol / L were added to the system at the following gradient volumes: 1.5 μL, 1.8 μL, 2.1 μL, 2.4 μL, 2.7 μL, 3 μL, 3.3 μL, and 3.6 μL respectively. A probe with a concentration of 10 μmol / L was added at 0.6 μL, a DNA template (plasmid containing the 5'-UTR sequence) with a concentration of 0.2 fg / μL was added at 1 μL, 29.5 μL of RPA reaction buffer, and 0.5 M Mg 2+ was added at 1.4 μL, and ddH2O was added to make up to 50 μL.

[0121] The RPA amplification reaction procedure was: isothermal reaction at 39 °C for 30 minutes.

[0122] Detection of RPA products: The change in fluorescence signal was recorded in real time using a constant temperature fluorescence detector, and then the signal start time and signal strength of each reaction were compared. The results are as Figure 4 shown in A, which shows the effect of different primer concentrations. It can be seen from the figure that the amplification efficiency is the highest when the primer addition amount is 3 μL (i.e., 600 nM).

[0123] 2. Optimal probe concentration

[0124] Recombinase polymerase isothermal amplification was performed using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. Primers F524 and R363 with a concentration of 10 μmol / L were added at 3 μL each, probes with a concentration of 10 μmol / L were added at 0.6 μL, 0.8 μL, 1 μL, and 1.2 μL respectively, a DNA template (plasmid containing the 5'-UTR sequence) with a concentration of 0.2 fg / μL was added at 1 μL, 29.5 μL of RPA reaction buffer, and 0.5 M Mg 2+ was added at 1.4 μL, and ddH2O was added to make up to 50 μL.

[0125] The RPA amplification reaction procedure was: isothermal reaction at 39 °C for 30 minutes.

[0126] Detection of RPA products: The change in fluorescence signal was recorded in real time using a constant temperature fluorescence detector, and then the signal start time and signal strength of each reaction were compared. The results are as Figure 4 shown in B, which shows the effect of different probe concentrations. It can be seen from the figure that the amplification efficiency is the highest when the probe addition amount is 1 μL (i.e., 200 nM).

[0127] Example 5 Screening of the optimal Mg 2+ ion concentration

[0128] Recombinase polymerase isothermal amplification was carried out using the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL. 3 μL of primer F524 and 3 μL of primer R363 with a concentration of 10 μmol / L were added respectively, 1 μL of the probe with a concentration of 10 μmol / L was added, 1 μL of the DNA template (plasmid containing the 5'-UTR sequence) with a concentration of 0.2 fg / μL was added, 29.5 μL of the RPA reaction buffer, and 0.5 M Mg 2+ was added in amounts of 1.2 μL, 1.4 μL, 1.6 μL, and 1.8 μL respectively, and ddH2O was added to make up to 50 μL.

[0129] The RPA amplification reaction procedure was: isothermal reaction at 39 °C for 30 minutes.

[0130] Detection of RPA products: The change in fluorescence signal was recorded in real time using a constant temperature fluorescence detector, and then the signal start time and signal strength of each reaction were compared. The results were as Figure 5 shown. The amplification efficiency was the highest when 1.4 μL of 0.5 M Mg 2+ was added.

[0131] Example 6 Sensitivity Detection of Primers and Probes

[0132] Using the optimized primers F524 and R363 and the probe obtained by screening, the sensitivity of the primers and probes was detected according to the optimal reaction system explored in Example 4 and Example 5. The templates tested were negative control, 5*10 4 copies, 5*10 3 copies, 5*10 2 copies, 5*10 1 copies. The positive template was the nucleotide sequence shown in SEQ ID NO:1, which was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0133] The results were as Figure 6 shown. Using the optimal RPA reaction conditions explored in this application, a minimum of 5*10 1 copies of BDV could be detected.

[0134] Comparative Example 1 Comparison between the Method of the Present Invention and the qPCR Method

[0135] To compare the coincidence of the detection results between the RPA method developed in the present invention and the qPCR method, in this example, the qPCR method widely used in the literature (the specific method refers to PMID: 10958243) was used as the comparative method to detect 48 clinically suspected samples.

[0136] The results are shown in Table 5, and the coincidence rate between the RPA method and the qPCR method is as high as 100%. It can be seen that the RPA method developed in the present invention has the same sensitivity and specificity as the qPCR method. However, the reaction conditions of this method are milder, the reaction speed is faster, and it is more conducive to use at the breeding site.

[0137] Table 5 Comparison of the results between the RPA method and qPCR

[0138]

Claims

1. A primer-probe composition for detecting border disease virus, characterized in that, An upstream primer comprising a nucleotide sequence as shown in SEQ ID NO: 34, a downstream primer comprising a nucleotide sequence as shown in SEQ ID NO: 40, and a specific fluorescent probe comprising a nucleotide sequence as shown in SEQ ID NO:

16.

2. The primer-probe composition according to claim 1, wherein The 31st and 32nd positions of the specific fluorescent probe contain a tetrahydrofuran residue site, and a blocking modification is included at the 3'-end of the nucleotide sequence shown in SEQ ID NO:

16.

3. The primer-probe composition according to claim 1, characterized in that, The T base at the 30th position of the specific fluorescent probe is labeled with a fluorescent reporter group or a fluorescent quenching group, and the T base at the 32nd position is labeled with a fluorescent reporter group or a fluorescent quenching group; Preferably, the fluorescent reporter group is selected from at least one of FAM, VIC, HEX, JOE, FITC, TRT, CY3, CY5, ROX, TET, TexasRed, SYTO-13, SYTO-82, LCRED460 or LCRED705; The fluorescent quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, Dabcy1 or TAMRA; The 3'-end of SEQ ID NO. 16 is linked to a C3-spacer.

4. The primer-probe composition according to claim 1, wherein The molar ratio of the upstream primer, the downstream primer and the specific fluorescent probe is 3:3:

1.

5. Use of the primer-probe composition according to any one of claims 1 to 3 in any of the following: A1. Use in the preparation of a product for detecting or assisting in the detection of border disease virus; A2. Use in the preparation of a product for detecting whether a sample contains border disease virus; A3. Use in the preparation of a product for diagnosing or assisting in the diagnosis of a disease caused by border disease virus; A4. Use in the preparation of a product for screening a disease caused by border disease virus.

6. A reagent for detecting border disease virus, characterized in that, Comprising the primer-probe composition according to any one of claims 1 to 3.

7. A kit for detecting border disease virus, characterized in that, Comprising the primer-probe composition according to any one of claims 1 to 3 or the reagent according to claim 5; Preferably, the kit further comprises other reagents required for recombinase isothermal amplification.

8. Use of the reagent according to claim 5 or the kit according to claim 6 or 7 in any of the following: B1. Use in detecting or assisting in the detection of border disease virus or in the preparation of a product for detecting or assisting in the detection of border disease virus; B2. Use in detecting whether a sample contains border disease virus or in the preparation of a product for detecting whether a sample contains border disease virus; B3. Use in the preparation of a product for diagnosing or assisting in the diagnosis of a disease caused by border disease virus; B4. Use in screening a disease caused by border disease virus or in the preparation of a product for screening a disease caused by border disease virus.

9. A method for detecting or assisting in the detection of border disease virus for non-therapeutic and non-diagnostic purposes, characterized in that, Comprising subjecting a sample to recombinase isothermal amplification using the primer-probe composition according to any one of claims 1 to 3, the reagent according to claim 5 or the kit according to claim 6 or 7, and determining whether border disease virus is present in the sample according to the fluorescence signal.

10. The method according to claim 9, characterized in that, The reaction temperature of the recombinase isothermal amplification is 35 to 41 °C, preferably 39 °C; Preferably, the reaction time of the recombinase isothermal amplification is 30 min.