DNA storage encryption and steganography method based on non-natural basic group

Abstract

The invention discloses a DNA storage encryption and steganography method based on a non-natural basic group, and relates to the technical field of data storage. According to the method, a non-natural base pair (UBPs, NaM-TPT3) is introduced to a DNA sequence of coded information, during reading, the information sequence generates signal termination at the UBPs position, and a complete DNA sequence cannot be obtained, so that the purpose of encrypting DNA storage information is achieved, and DNA information can be smoothly read and decoded through bridge base isoTAT-mediated base conversion PCR (Polymerase Chain Reaction). Besides, a non-natural basic group is added to the 5'end of the index primer to prevent the index primer and a similar sequence from generating non-specific amplification, further, a natural primer is used for marking error information, a primer containing UBP is used for marking target information, and the target of information steganography is achieved through mixed storage. According to the method, encryption and steganography of DNA storage are realized by using a UBP technology, so that the security of DNA data storage is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of data storage, and particularly relates to a DNA storage encryption and steganography method based on unnatural bases. Background Art

[0002] In recent years, with the rapid development of information technology, human society is facing severe challenges in information security and new solutions need to be developed to improve the security of information storage. Among various storage carriers, DNA has become an extremely attractive material due to its ultra-high storage density, low energy consumption, and long lifespan. In the past decade, rapid progress has been made in the basic technologies of DNA data storage, including encoding and synthesis (writing) of information, different preservation methods to increase the lifespan of DNA (preservation), different indexing methods to extract specific DNA sequences (random access), and methods to accurately read and convert it back to digital data (decoding). So far, DNA data storage has been proven to have great potential and its practical application trend is becoming increasingly obvious. However, these DNA-based storage strategies generally only utilize the natural double-base pair genetic alphabet (A-T and G-C) to achieve general storage applications.

[0003] Unnatural bases (UBPs) refer to other bases that do not belong to the four common bases (A, T, C, G) of DNA or RNA. They can replicate with natural bases, expanding the gene alphabet and playing an important role in biological research and applications. In the past two decades, the technology of unnatural bases has developed rapidly, and dNaM-d5SICS or its advanced version dNaM-dTPT3 is a very attractive combination. It is worth noting that it is still challenging to read DNA containing TPT3-NaM with traditional sequencing technology because the Sanger sequencing signal terminates after the dTPT3-dNaM site. Recently, a new method for reading sequences containing UBPs has been designed. This method converts dTPT3-dNaM into C-G or A-T natural bases through polymerase chain reaction (PCR) according to the presence or absence of the bridging base isoTAT, which makes it feasible to read the TPT3-NaM base pair by Sanger sequencing. Although the development of these UBP-enabled technologies for expanding the gene alphabet has provided unprecedented opportunities and conveniences for changing DNA-based applications, the potential of UBPs in the field of information storage remains to be explored. Summary of the Invention

[0004] Aiming at the deficiencies in the above background art, the present invention provides a DNA storage encryption and steganography method based on unnatural bases. The present invention utilizes UBP technology to achieve encryption and steganography of DNA storage, so as to improve the security of DNA data storage.

[0005] The first object of the present invention is to provide a DNA information encryption method based on unnatural bases, including:

[0006] Encoding digital information into DNA information using a DNA information encoding method;

[0007] Inserting unnatural bases into the DNA information to obtain the inserted DNA information;

[0008] Synthesizing a DNA strand by overlap PCR according to the inserted DNA information;

[0009] Purifying the synthesized DNA strand and directly storing it or ligating it onto a plasmid and transferring it into a transient bacterium for storage;

[0010] When reading, obtaining the DNA information through conversion PCR and sequencing.

[0011] Preferably, when synthesizing the DNA information by overlap PCR, it includes:

[0012] Designing a plurality of oligonucleotide sequences according to the inserted DNA information, each oligonucleotide sequence being designed alternately as a sense strand and an antisense strand; there being an overlapping sequence of a plurality of bases between adjacent oligonucleotide sequences;

[0013] Synthesizing the designed oligonucleotide sequences into DNA information by overlap PCR.

[0014] Preferably, the number of bases of each oligonucleotide sequence is <60 nt.

[0015] Preferably, the obtaining of the DNA information through conversion PCR and sequencing includes:

[0016] Subjecting the DNA information directly stored or ligated onto a plasmid and transferred into a transient bacterium for storage to conversion PCR and sequencing to obtain DNA information containing unnatural bases;

[0017] Removing the unnatural bases from the DNA information containing unnatural bases to obtain the original DNA information and decoding it into digital information.

[0018] Preferably, the transient bacterium includes Escherichia coli.

[0019] The second object of the present invention is to provide a DNA information steganography method based on unnatural bases, which is characterized by including:

[0020] Adding indexes at both ends of the correct DNA information and the incorrect DNA information, and then mixing and storing the correct DNA information and the incorrect DNA information, thus completing the DNA information steganography;

[0021] Among them, index sequences with unnatural bases carried at the 5' end are introduced at both ends of the correct DNA information;

[0022] Introduce natural index sequences at both ends of the incorrect DNA information.

[0023] Preferably, the natural part in the index sequence of the correct DNA information is the same as the index sequence of the incorrect DNA information.

[0024] Preferably, it further includes:

[0025] Based on the PCR reaction system, for the correctly and incorrectly DNA information stored in a mixture, use index primers containing unnatural bases and index primers without unnatural bases to index the information respectively; obtain the PCR products;

[0026] Sequence the corresponding PCR products using natural sequence primers to obtain the target information sequence.

[0027] Preferably, the PCR reaction system is as follows: 25 μL of 2xHieff PCR Master Mix, 100 mM dNaMTP and dTPT3TP, 10 pg of DNA mixed information, 1 μM forward and reverse primers, add ddH2O to 50 μL; the thermal cycling conditions are as follows: initial denaturation temperature 94 °C, duration 3 min, denaturation temperature 94 °C, duration 30 s, annealing temperature 52 °C, duration 30 s, and extension temperature 72 °C, duration 15 s, cycle 15 times, and finally extend at 72 °C for 10 min.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] A DNA storage encryption and steganography method based on unnatural bases provided by the present invention introduces unnatural base pairs (UBPs, NaM-TPT3) into the DNA sequence encoding information. When reading, the information sequence generates signal termination at the UBP positions, and the complete DNA sequence cannot be obtained, thereby achieving the purpose of encrypting DNA storage information. Through base conversion PCR mediated by the bridging base isoTAT, the DNA information can be successfully read and decoded. In addition, add unnatural bases at the 5' end of the index primers to prevent non-specific amplification of the index primers with similar sequences. Further, use natural primers to label incorrect information and primers containing UBP to label target information, and store them in a mixture to achieve the purpose of information steganography. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the principle of DNA encryption using UBP and ternary information coding table;

[0031] Figure 2 Schematic diagram of in vivo storage for encrypting DNA information;

[0032] Figure 3For encrypting the sequencing result of DNA information;

[0033] Figure 4 For the schematic diagram of DNA steganography;

[0034] Figure 5 For the sequencing results of correct and incorrect information of DNA steganography;

[0035] Figure 6 For the schematic diagram of DNA information encryption and steganography based on UBP. Detailed implementation manners

[0036] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments and the accompanying drawings. However, the specific embodiments cited do not limit the present invention.

[0037] The first aspect of the present invention provides a DNA information encryption method based on unnatural bases, including:

[0038] Encoding digital information into DNA information using a DNA information encoding method;

[0039] Inserting unnatural bases into the DNA information to obtain the inserted DNA information;

[0040] Synthesizing a DNA strand by overlap PCR according to the inserted DNA information;

[0041] Purifying the synthesized DNA strand and directly storing it or ligating it to a plasmid and transferring it into a transient bacterium for storage;

[0042] When reading, obtaining the DNA information through conversion PCR and sequencing.

[0043] Among them, when synthesizing DNA information by overlap PCR, it includes:

[0044] Designing a plurality of oligonucleotide sequences according to the inserted DNA information, and each oligonucleotide sequence is designed alternately according to the sense strand and the antisense strand; there are overlapping sequences of multiple bases between adjacent oligonucleotide sequences;

[0045] Synthesizing the DNA information by overlap PCR with the designed oligonucleotide sequences.

[0046] The number of bases of each oligonucleotide sequence < 60 nt.

[0047] According to the present invention, the obtaining of DNA information through conversion PCR and sequencing includes:

[0048] Subjecting the DNA information directly stored or ligated to a plasmid and transferred into a transient bacterium for storage to conversion PCR and sequencing to obtain DNA information containing unnatural bases;

[0049] The DNA information containing unnatural bases is processed to remove the unnatural bases, obtaining the original DNA information, which is then decoded into digital information.

[0050] The transient bacteria include Escherichia coli.

[0051] In one embodiment, a method for encrypting DNA information based on unnatural bases, as shown in Figure 6 (a), includes the following steps:

[0052] 1) Encoding digital information into DNA information using a DNA information encoding method;

[0053] 2) Inserting unnatural bases into the DNA information; randomly inserting unnatural bases into the encoded DNA information to prevent the DNA information from being read;

[0054] 3) Synthesizing the DNA information through overlap PCR; designing multiple oligonucleotide sequences of <60 nt according to the DNA sequence, with each oligonucleotide sequence designed alternately as the sense strand and the antisense strand, and having an overlapping sequence of about 20 nt between adjacent oligonucleotide sequences. The synthesized oligonucleotide sequences are used to synthesize a complete DNA sequence through overlap PCR;

[0055] 4) Directly storing the purified DNA information or ligating it to a plasmid and transferring it into Escherichia coli for storage;

[0056] 5) Subjecting the DNA information to conversion PCR and sequencing; conversion PCR is to convert dTPT3-dNaM into natural bases C-G or A-T through polymerase chain reaction (PCR) according to the presence or absence of the bridging base isoTAT. After Sanger sequencing, the complete sequence of the DNA information can be determined;

[0057] 6) Decrypting the DNA information and decoding it into digital information; decryption is achieved by removing the UBP determined after conversion PCR to obtain the correct DNA information sequence and decoding.

[0058] The second aspect of the present invention provides a method for steganography of DNA information based on unnatural bases, including:

[0059] Adding indexes at both ends of the correct DNA information and the incorrect DNA information, and then mixing and storing the correct DNA information and the incorrect DNA information, thus completing the steganography of DNA information;

[0060] Among them, an index sequence with unnatural bases carried at the 5' end is introduced at both ends of the correct DNA information;

[0061] Natural index sequences are introduced at both ends of the incorrect DNA information.

[0062] Among them, the natural part in the index sequence of the correct DNA information is the same as the index sequence of the incorrect DNA information.

[0063] According to the present invention, it further includes:

[0064] Based on the PCR reaction system, for the correctly and incorrectly stored DNA information mixed and preserved, use an index primer containing unnatural bases and an index primer without unnatural bases to index the information respectively; obtain the PCR product;

[0065] Use a natural sequence primer to sequence the corresponding PCR product to obtain the target information sequence.

[0066] Specifically, the PCR reaction system is as follows: 25 μL of 2xHieff PCR Master Mix, 100 mM dNaMTP and dTPT3TP, 10 pg of DNA mixed information, 1 μM forward and reverse primers, add ddH2O to 50 μL; the thermal cycling conditions are as follows: initial denaturation temperature 94 °C, duration 3 min, denaturation temperature 94 °C, duration 30 s, annealing temperature 52 °C, duration 30 s, and extension temperature 72 °C, duration 15 s, cycle 15 times, and finally extend at 72 °C for 10 min.

[0067] In one embodiment, a DNA information steganography method based on unnatural bases, as shown in Figure 6 (b), includes the following steps:

[0068] 1) Add indexes to both ends of the correct and incorrect DNA information; introduce an index sequence with an unnatural base at the 5' end at both ends of the correctly stored information, and introduce a natural index sequence at both ends of the incorrect information, and the natural part of the index sequence of the correct information is the same as the index of the incorrect information;

[0069] 2) DNA information storage: Different information is stored mixed, and the target information is steganographically hidden in the incorrect information; the correct and incorrect information is stored mixed to achieve DNA information steganography;

[0070] 3) DNA information indexing: Use a primer with an unnatural base at the 5' end to amplify the correct information, and use a natural index primer to amplify the incorrect information;

[0071] 4) DNA information sequencing; Use a natural primer to sequence to obtain the DNA information sequence.

[0072] It should be noted that the experimental methods used in the present invention are all conventional methods without special instructions; the reagents and materials used can be obtained in the market without special instructions.

[0073] Example 1

[0074] SeeFigure 1 (As shown in (A), a DNA information encryption method based on unnatural bases in this embodiment includes the following steps:

[0075] 1) Encoding digital information into DNA information

[0076] Using a ternary DNA information code table, referring to the code table shown in Figure 1 (B), encoding the information "JUNE6 INVASION:NORMANDY" into DNA information: AGTCTGTCTGGCTTAATAATGT CTCCTCGAACGATGGGATCTGCTTCTGGATCATCCCGATCTTTGAAA (SEQ ID No.1);

[0077] 2) Encrypting the DNA information

[0078] Randomly inserting unnatural bases into the encoded DNA information to prevent the DNA information from being directly sequenced. The inserted DNA sequence is: AGTCTGTCTGGCTTAATAAYTGTCTCCTCGAA CGATGGGXATCTGCTTCTGGATCATCCCGATCTTTGAAA (SEQ ID No.2). Where X is NaM and Y is TPT3. It should be noted that when generating the sequence list, X is represented by W.

[0079] 3) Synthesizing the DNA information

[0080] Designing oligonucleotide chains as: AGTCTGTCTGGCTTAATAAYTGTCTCCTCGAACG ATGGG (SEQ IDNo.3) and TTTCAAAGATCGGGATGATCCAGAAGCAGAT YCCCATCGTTCGAGGAGACA (SEQ ID No.4). The PCR reaction system is: 1 μM of each oligonucleotide chain, 25 μL of 2xHieff PCR Master Mix, 100 mM dNaMTP and dTPT3TP, and adding ddH2O to make up 50 μL. Synthesize the DNA information according to the following thermal cycling conditions: denaturation (94 °C, 30 s), annealing (52 °C, 30 s), and extension (72 °C, 15 s) for 15 cycles, and then final extension (72 °C, 10 min).

[0081] 4) In vitro and in vivo preservation

[0082] 4.1 In vitro preservation

[0083] The PCR product is purified by column and preserved in vitro.

[0084] 4.2 In vivo preservation

[0085] The DNA information is ligated to a plasmid and then transferred into Escherichia coli for storage ( Figure 2 ). The specific operations are as follows: The DNA information fragment uses primers F: gatcaGGTCTCatctaAGTCTGTCTGGCTTAATAA (SEQ ID No.5) and primer R: gactaGGTCTCagaatTTTCAAAGATCGGGATGATCC (SEQ ID No.6) to introduce BsaI restriction recognition sites at both ends of the information fragment. The PCR reaction system is: 25 μL of 2xHieff PCR Master Mix, 100 mM dNaMTP and dTPT3TP, 0.1 ng of DNA information fragment, 1 μM of primers F and R, and ddH2O is added to make up to 50 μL. The thermal cycling conditions are as follows: initial denaturation (94 °C, 3 min), denaturation (94 °C, 30 s), annealing (52 °C, 30 s), and extension (72 °C, 15 s) for 20 cycles, and final extension (72 °C, 10 min). The vector fragment is amplified from the modified PUC19 plasmid using primers gactatagacgagacCccactag (SEQ ID No.7) and gactaattcTgagacCCCTGCAGG (SEQ ID No.8), and then the PCR product is purified by column. Then the DNA information fragment is digested with BsaI, and the vector fragment is digested with BsaI and DpnI. The digested products are purified using 1% agarose gel. The two fragments are ligated with T4 ligase for 2 hours to obtain the DNA information plasmid. The sequence of the information plasmid (SEQ ID No.9) is as follows:

[0086] AGTCTGTCTGGCTTAATAAYTGTCTCCTCGAACGATGGGXATCTGCTTCT

[0087] GGATCATCCCGATCTTTGAAAattcTgagacCCCTGCAGGATAACTTCGTATA

[0088] GCATACATTATACGAAGTTATcgttAGAGACGGAGTCACTGCCAACCGAG

[0089] ACGGTCATAGCTGTTTCCTGTGTGCCGCTTCCTCGCTCACTGACTCGCTG

[0090] CGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC

[0091] ACTCAAAGGCGGTAATACGGTTACCCACAGAATCAGGGGATAACGCAG

[0092] GAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAA

[0093] AAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGC

[0094] ATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGAC

[0095] TATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCT

[0096] GTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG

[0097] AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGT

[0098] AGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCC

[0099] CGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTA

[0100] AGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCA

[0101] GAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAA

[0102] CTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAG

[0103] CCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAA

[0104] CCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGC

[0105] AGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTG

[0106] ACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATT

[0107] ATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTT

[0108] AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAAT

[0109] GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCC

[0110] ATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCT

[0111] TACCATCTGGCCCCAGTGCTGCAATAATACCGCGGGACCCACGCTCACC

[0112] GGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG

[0113] CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT

[0114] GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT

[0115] TGTTGCCATCGCTACAGGCATCGTGGTATCACGCTCGTCGTTTGGTATGG

[0116] CTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCC

[0117] ATGTTGCGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCA

[0118] GAAGTAAGTTGGCCGCCGTGTTATCACTCATGGTTATGGCAGCACTACA

[0119] TAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTG

[0120] AGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTG

[0121] CTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACT

[0122] TTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA

[0123] GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC

[0124] AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAA

[0125] AACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGA

[0126] AATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC

[0127] AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAA

[0128] TAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAC

[0129] GTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTA

[0130] TCACGAGGCCCTTTCGTTGTAAAACGACGGCCAGTCGAACCACGCAATG

[0131] CGTCTCGATCCGCAGTGTCTTGCGTCTCTggtgATAACTTCGTATAGCATACATTATACGAAGTTATactagtggGgtctcgtcta。

[0132] The plasmid carrying the ptNTT2 gene was transferred into BL21(DE3) cells and cultured overnight at 37 °C on 2×YT solid medium containing 33 mg / L chloramphenicol. The selected clone was inoculated into 3 ml of 2×YT medium containing 33 mg / L chloramphenicol and 50 mM KPi and cultured with shaking at 37 °C. 1 mL of the overnight culture was diluted in 100 mL of the same selective medium and grown to an OD600 of 0.4 to 0.5. The cells were quickly placed on ice for 10 min, then collected at 4 °C, 3500 rpm for 10 min, and washed 3 times with 30 ml of pre-cooled 15% glycerol. The cells were resuspended in 1 mL of pre-cooled 15% glycerol and aliquoted at 50 μL per portion. The competent cells were mixed with 2 μL of the DNA information plasmid containing UBP, and the cells were mixed by flicking and transferred to a pre-cooled 0.2 cm gap electroporation cuvette. Electroporation was performed using a Bio-Rad MicroPulser electroporator under the following conditions: Ec2, voltage 2.5 kV. Immediately afterwards, 400 μL of 2×YT medium containing 50 mM KPi, 125 μM dNaMTP, and 125 μM dTPT3TP was added, and the cells were resuscitated by shaking (220 rpm) at 37 °C for 1 h. Then the cell pellet was collected and resuspended in 100 μL of 2×YT medium containing 5 mg / L chloramphenicol, 50 mg / L ampicillin, 50 mM KPi, 125 μM dNaMTP, and 125 μM dTPT3TP. The cells carrying the DNA information plasmid were grown with shaking (220 rpm) at 37 °C for 17 h and stored.

[0133] 5) Conversion PCR and sequencing

[0134] When reading, 1 μL of bacterial solution or plasmid carrying DNA information is taken as a template, and M13F / R is used for conversion PCR and sequencing. The PCR reaction system is as follows: 25 μL of 2xHieff PCR Master Mix, 1 μL of bacterial solution or plasmid carrying DNA information, 100 nM of M13F / R, and ddH2O is added to 50 μL. For Bridge base PCR, 100 mM disoTATTP and dNaMTP are added, and for native base preference PCR, only 100 mM dNaMTP is added. The two PCR products are sequenced to identify the DNA information sequence containing UBP, and the sequencing results are as Figure 3 shown.

[0135] 6) Decode the DNA information

[0136] After removing UBP, the original information DNA sequence is obtained and decoded into digital information.

[0137] Example 2

[0138] See Figure 4 shown. A DNA steganography method using UBP in this example includes the following steps:

[0139] 1. Using the ternary information encoding table shown in Figure 1 (B), encode the information JUNE6 INVASION:NO RMANDY into the DNA information: AGTCTGTCTGGCTTAATAATGTCTCCTCGAA CGATGGGATCTGCTTCTGGATCATCCCGATCTTTGAAA (SEQ ID No.1);

[0140] Encode the error information JUNE9 INVASION:NORMANDY into the DNA information: AGTCT GTCTGGCGCGATAATGTCTCCTCGAACGATGGGATCTGCTTCTGGATCAT CCCGATCTTTGAAA (SEQ ID No.10);

[0141] 2. Add an index sequence containing unnatural bases at the 5' end to the DNA sequence encoding the information JUNE6INVASION:NORMANDY using the primer TCCCTCTTCGTCGAGTAGCAXAGTCTGTCTGGCTTAATAATG (SEQ ID No.11) and the primer TCTCATGTACGGCCGTGAATYTTTCAAAGATCGGGATGATCC (SEQ ID No.12); add an index sequence without unnatural bases to the DNA sequence encoding the information JUNE9 INVASION:NORMANDY using the primer TCCCTCTTCGTCGAGTAGCAAGTCTGTCTGGCgcgATAAT (SEQ ID No.13) and the primer TCTCATGTACGGCCGTGAATTTTCAAAGATCGGGATGATCC (SEQ ID No.14).

[0142] 3. Purify and mix the two DNA sequences for storage.

[0143] 4. Use the index primer TCCCTCTTCGTCGAGTAGCAX (SEQ ID No.15) containing unnatural bases and the primer TCTCATGTACGGCCGTGAATY (SEQ ID No.16), and the index primers TCCCTCTTCGTCGAGTAGCA (SEQ ID No.17) and TCTCATGTACGGCCGTGAAT (SEQ ID No.18) without unnatural bases to index the information respectively. The PCR reaction system is as follows: Mix 25 μL of 2xHieff PCR Master Mix, 100 mM dNaMTP and dTPT3TP, 10 pg of DNA mixed information, 1 μM of forward and reverse primers, and add ddH2O to 50 μL. The thermal cycling conditions are as follows: Initial denaturation (94 °C, 3 min), denaturation (94 °C, 30 s), annealing (52 °C, 30 s), and extension (72 °C, 15 s) for 115 cycles, and final extension (72 °C, 10 min) to obtain the PCR product.

[0144] 5. Sequence the corresponding PCR product using natural sequence primers to obtain the target information sequence, as shown in Figure 5 shown.

[0145] Although the embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A DNA information encryption method based on unnatural bases, characterized in that, Comprising: Encoding digital information into DNA information using a DNA information encoding method; Inserting unnatural bases into the DNA information to obtain the post-insertion DNA information; Synthesizing a DNA strand by overlap PCR based on the post-insertion DNA information; Purifying the synthesized DNA strand and directly storing it or ligating it to a plasmid and transferring it into a transient bacterium for storage; During reading, obtaining the DNA information through conversion PCR and sequencing.

2. The DNA information encryption method based on unnatural bases according to claim 1, characterized in that When synthesizing DNA information by overlap PCR, it includes: Designing multiple oligonucleotide sequences based on the post-insertion DNA information, each oligonucleotide sequence being designed alternately as a sense strand and an antisense strand; there is an overlapping sequence of multiple bases between adjacent oligonucleotide sequences; Synthesizing the DNA information by overlap PCR with the designed oligonucleotide sequences.

3. The DNA information encryption method based on unnatural bases according to claim 2, wherein The number of bases of each oligonucleotide sequence < 60 nt.

4. The DNA information encryption method based on unnatural bases according to claim 1, wherein The obtaining of DNA information through conversion PCR and sequencing includes: Subjecting the DNA information directly stored or ligated to a plasmid and transferred into a transient bacterium for storage to conversion PCR and sequencing to obtain DNA information containing unnatural bases; Removing the unnatural bases from the DNA information containing unnatural bases to obtain the original DNA information and decoding it into digital information.

5. The DNA information encryption method based on unnatural bases according to claim 1, wherein The transient bacterium includes Escherichia coli.

6. A DNA information steganography method based on unnatural bases, characterized in that, Comprising: Adding indexes to both ends of the correct DNA information and the incorrect DNA information, and then mixing and storing the correct DNA information and the incorrect DNA information, thus completing DNA information steganography; Among them, an index sequence with an unnatural base carried at the 5' end is introduced at both ends of the correct DNA information; A natural index sequence is introduced at both ends of the incorrect DNA information.

7. The method for DNA information steganography based on unnatural bases according to claim 6, wherein The natural part of the index sequence of the correct DNA information is the same as the index sequence of the incorrect DNA information.

8. The DNA information steganography method based on unnatural bases according to claim 6, wherein Also comprising: Based on a PCR reaction system, respectively indexing the correctly stored DNA information and the incorrectly stored DNA information using an index primer containing an unnatural base and an index primer without an unnatural base; Obtaining a PCR product; Sequencing the corresponding PCR product using a natural sequence primer to obtain a target information sequence.

9. The DNA information steganography method based on unnatural bases according to claim 8, characterized in that The PCR reaction system is as follows: 25 μL of 2xHieff PCR Master Mix, 100 mM dNaM TP and dTPT3TP, 10 pg of DNA mixed information, 1 μM forward and reverse primers, adding ddH2O to 50 μL; the thermal cycling conditions are as follows: initial denaturation temperature 94 °C, duration 3 min, denaturation temperature 94 °C, duration 30 s, annealing temperature 52 °C, duration 30 s, and extension temperature 72 °C, duration 15 s, cycling 15 times, and finally extending at 72 °C for 10 min.

Images