Application of fucosan in preparation of preparation for delaying intestinal aging of old people

Abstract

The invention provides application of fucosan in preparation of a preparation for delaying intestinal aging of old people, and belongs to the technical field of application of natural active substances. Research on the fucosan shows that the fucosan can improve intestinal function decline caused by aging, reduce the oxidative stress level of colon, aging-related secretion phenotypes and the content of intestinal aging markers, and delay intestinal aging. The potential application value of the fucosan is developed, and the fucosan has important guiding significance on development of dietary supplements for delaying intestinal aging of old people.

Description

Technical Field

[0001] The present invention belongs to the technical field of the application of natural active substances, and particularly relates to the application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly. Background Art

[0002] Aging is a systemic functional decline process that occurs as the body ages and involves multiple molecular mechanisms. Aging is not only a natural physiological phenomenon but also the core cause of many chronic diseases. In recent years, the academic community has put forward the concept of "healthy aging", emphasizing delaying the degradation of organ functions by intervening in aging-related pathways. Among them, the intestine, as the second "aging clock" of the human body, has become an important target for anti-aging research.

[0003] Intestinal aging is mainly manifested as a comprehensive decline in physiological functions. At the structural and functional level, the contractility of intestinal smooth muscle in the elderly weakens and the neuroendocrine regulation ability decreases, resulting in slow intestinal motility and a high incidence of constipation; the renewal rate of intestinal epithelial cells decreases and the activity of digestive enzymes decreases, significantly weakening the digestion and absorption efficiency of nutrients. At the molecular level, the over-release of senescence-associated secretory phenotype (SASP) - related factors such as IL-6 and TNF-α leads to the formation of a chronic low-grade inflammatory microenvironment in the body, further destroying the integrity of the intestinal mucosal barrier and exacerbating the increase in intestinal permeability. These changes induce systemic inflammation and metabolic disorders through interactive networks such as the "gut-brain axis" and the "gut-liver axis". Therefore, intestinal aging is not only an "amplifier" of the degradation of multiple organ functions but also a key hub in the progression of aging-related diseases. Therefore, comprehensive regulation of intestinal function has become an important strategy for extending healthy lifespan.

[0004] Fucoidan is a characteristic sulfated polysaccharide of echinoderms and brown algae. With L-fucose as the backbone, it also has structural units such as galactose, mannose, and glucuronic acid. Its unique chemical composition endows it with multiple biological activities. Research has confirmed that this substance has multiple biological activities such as lipid-lowering, immune regulation, and kidney protection. It can delay the process of atherosclerosis by regulating the activity of key enzymes in lipid metabolism and can reduce chronic kidney injury by inhibiting the renal fibrosis pathway. Due to its functional diversity, fucoidan has become a hot component in the development of global marine biological resources and is widely used as a core raw material in the development of functional foods, innovation of medical materials, and maintenance of skin health, demonstrating the strategic value of marine active molecules in the health industry. However, there is no report on whether fucoidan can delay intestinal aging in the elderly. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide an application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly. Through the research on fucoidan, the present invention discovers that fucoidan can improve the decline in intestinal function caused by aging, reduce the levels of colonic oxidative stress, senescence-associated secretory phenotype, and the content of intestinal senescence markers, delay intestinal senescence, and can be used as a dietary supplement for improving intestinal senescence, and is applicable to delaying intestinal senescence in the elderly.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions: The present invention provides an application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly.

[0007] Preferably, the fucoidan is obtained by extraction from echinoderms or brown algae.

[0008] Preferably, the extraction method of the fucoidan includes the following steps: (3.1) Mix the crushed echinoderms or brown algae with a buffer solution, and the ratio of the crushed echinoderms or brown algae to the buffer solution is 1 g: 8 - 12 mL. After maintaining a constant temperature for 20 - 40 min, carry out an enzymatic hydrolysis reaction to obtain an enzymatic hydrolysate; (3.2) After inactivating the enzyme in the enzymatic hydrolysate, centrifuge to obtain a supernatant; (3.3) Carry out alcohol precipitation on the supernatant, centrifuge, and collect the precipitate; (3.4) After redissolving the precipitate, centrifuge, take the supernatant, carry out dialysis treatment, and lyophilize to obtain fucoidan.

[0009] Preferably, the buffer solution is composed of an acetic acid - sodium acetate solution with a final concentration of 90 - 110 mM, 4 - 6 mM of disodium ethylenediaminetetraacetate, and 4 - 6 mM of L - cysteine.

[0010] Preferably, the enzymatic hydrolysis is carried out using papain; the usage amount of the papain is 0.05 - 0.2 times the mass of the echinoderms or brown algae.

[0011] Preferably, the dosage of the fucoidan is ≥ 100 mg / kg / d.

[0012] Preferably, the fucoidan further includes a pharmaceutically acceptable carrier.

[0013] Preferably, the intestinal senescence in the elderly includes a decline in intestinal function, an increase in intestinal oxidative stress level, and an increase in the content of intestinal senescence markers.

[0014] Preferably, the fucoidan promotes the absorption of nutrients by the intestine and reduces the risks of infection and chronic diseases by increasing the activities of α - amylase and lipase.

[0015] Preferably, the fucoidan delays intestinal senescence by reducing the level of colonic oxidative stress and the content of intestinal senescence markers.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) The present invention provides an application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly. Through the research on fucoidan, the present invention finds that fucoidan can improve the decline of intestinal function caused by senescence, reduce the levels of colonic oxidative stress, senescence-associated secretory phenotype and intestinal senescence markers, and delay intestinal senescence. The present invention develops the potential application value of fucoidan, which has important guiding significance for the development of dietary supplements for delaying intestinal senescence in the elderly.

[0018] (2) The present invention determines that the dosage of fucoidan is at least 100 mg / kg, which can give full play to the effect of fucoidan. Description of the Drawings

[0019] Figure 1 are graphs of the changes in intestinal function of groups N, M, VC, LF, MF and HF, where * indicates compared with group N, P <0.05; Figure 2 are H&E staining diagrams of the small intestine of mice in groups N, M and HF, where the scale bar is 100 μm; Figure 3 are statistical result diagrams of H&E sections of the small intestine of mice in groups N, M and HF, where ** indicates compared with group N, P <0.01, *** indicates compared with group N P <0.001, # indicates compared with group M, P <0.05, indicates compared with group M, P <0.001, # indicates compared with group M, P <0.0001; Figure 4 are graphs of the oxidative stress changes of groups N, M, VC, LF, MF and HF, where * indicates compared with group N, P <0.05, ** indicates compared with group N, P <0.01, **** indicates compared with group N, P <0.0001, # indicates compared with group M, P <0.05, ## indicates compared with group M, P <0.01, # indicates compared with group M, P <0.0001; Figure 5The senescence-associated secretory phenotypes of the N group, M group, VC group, LF group, MF group, and HF group, where ** indicates compared with the N group, P <0.01, *** indicates compared with the N group, P <0.001, # indicates compared with the M group, P <0.05, indicates compared with the M group, P <0.001; Figure 6 The contents of intestinal senescence markers of the N group, M group, VC group, LF group, MF group, and HF group, where ## indicates compared with the M group, P <0.01. Detailed implementation manners

[0020] The present invention provides an application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly.

[0021] In the present invention, the fucoidan is extracted from echinoderms or brown algae. The echinoderms are sea cucumbers or sea urchins, and the brown algae are kelp, Ascophyllum nodosum, Fucus, Undaria pinnatifida, Sargassum fusiforme, Undaria pinnatifida, Sargassum thunbergii, or Sargassum pallidum.

[0022] In the present invention, the extraction method of the fucoidan includes the following steps: (3.1) Mix the crushed echinoderms or brown algae with a buffer solution. The ratio of the crushed echinoderms or brown algae to the buffer solution is 1 g: 8 - 12 mL. After keeping at a constant temperature for 20 - 40 min, carry out an enzymatic hydrolysis reaction to obtain an enzymatic hydrolysate; (3.2) After inactivating the enzymes in the enzymatic hydrolysate, centrifuge to obtain a supernatant; (3.3) Carry out alcohol precipitation on the supernatant, centrifuge, and collect the precipitate; (3.4) After redissolving the precipitate, centrifuge, take the supernatant, carry out dialysis treatment, and freeze-dry to obtain fucoidan.

[0023] In the present invention, the crushed echinoderm or brown alga is mixed with a buffer solution. The ratio of the crushed echinoderm or brown alga to the buffer solution is 1 g: 8 - 12 mL. After constant temperature for 20 - 40 min, an enzymatic hydrolysis reaction is carried out to obtain an enzymatic hydrolysate; in the present invention, there is no limitation on the crushing method, and a conventional method can be adopted. The ratio of the echinoderm or brown alga to the buffer solution is preferably 1 g: 9 - 11 mL, and more preferably 1 g: 10 mL; the buffer solution is composed of an acetic acid - sodium acetate solution with a final concentration of 90 - 110 mM, 4 - 6 mM of disodium ethylenediaminetetraacetate, and 4 - 6 mM of L - cysteine, preferably composed of an acetic acid - sodium acetate solution with a final concentration of 95 - 105 mM, 4.5 - 5.5 mM of disodium ethylenediaminetetraacetate, and 4.5 - 5.5 mM of L - cysteine, and more preferably composed of an acetic acid - sodium acetate solution with a final concentration of 100 mM, 5 mM of disodium ethylenediaminetetraacetate, and 5 mM of L - cysteine; the constant temperature is 20 - 40 min, preferably 25 - 35 min, and more preferably 30 min. When the constant temperature is 20 - 40 min, the controlled temperature is 50 - 70 °C, 55 - 65 °C, and more preferably 60 °C; the usage amount of papain is preferably 0.08 - 0.15 times the mass of the echinoderm or brown alga, and more preferably 0.1 times. The temperature of the enzymatic hydrolysis is preferably 55 - 65 °C, and more preferably 60 °C.

[0024] In the present invention, after inactivating the enzyme in the enzymatic hydrolysate, centrifugation is carried out to obtain a supernatant; the enzyme inactivation is preferably carried out by boiling water bath treatment, and the time of the boiling water bath treatment is 10 - 20 min, preferably 12 - 18 min, and more preferably 15 min; the centrifugation time is 10 - 20 min, preferably 12 - 18 min, and more preferably 15 min, and the centrifugation speed is 3500 - 5500 rpm, preferably 4000 - 5000 rpm, and more preferably 4500 rpm.

[0025] In the present invention, alcohol precipitation is carried out on the supernatant, followed by centrifugation to collect the precipitate; 95% ethanol is added to the supernatant until the final concentration of ethanol is 40%. During the addition of ethanol, continuous stirring is carried out. After alcohol precipitation overnight at 4 °C, centrifugation is carried out to collect the supernatant. Then, 95% ethanol is continuously added to the supernatant until the final concentration of ethanol is 75%. After alcohol precipitation overnight at 4 °C, centrifugation is carried out to collect the precipitate. The centrifugation speed is 3500 - 5500 rpm for both, preferably 4000 - 5000 rpm, and more preferably 4500 rpm. The centrifugation time is 10 - 20 min for both, preferably 12 - 18 min, and more preferably 15 min.

[0026] In the present invention, after the precipitate is redissolved, it is centrifuged, the supernatant is taken, dialyzed, and freeze-dried to obtain fucoidan. The precipitate is redissolved with ultrapure water, centrifuged at 7000 - 11000 rpm for 5 - 15 min, the supernatant is collected, placed in a dialysis bag with a molecular weight cut-off of 8 - 14 kDa, dialyzed for 3 d, and the water is changed every 3 h, and then freeze-dried to obtain fucoidan. The mass-to-volume ratio of the precipitate to ultrapure water during redissolution is 1 g:8 - 12 mL, preferably 1 g:9 - 11 mL, and more preferably 1 g:10 mL; the rotation speed of the centrifugation is preferably 8000 - 10000 rpm, more preferably 9000 rpm, and the centrifugation time is preferably 8 - 12 min, more preferably 10 min.

[0027] In the present invention, the dosage of the fucoidan is ≥100 mg / kg / d.

[0028] In the present invention, the fucoidan further comprises a pharmaceutically acceptable carrier.

[0029] In the present invention, the intestinal senescence of the elderly includes decreased intestinal function, increased intestinal oxidative stress level, and increased content of intestinal senescence markers; the intestinal senescence markers include P16, P21, and P53.

[0030] In the present invention, the fucoidan promotes the absorption of nutrients by the intestine and reduces the risks of infection and chronic diseases by increasing the activities of α-amylase and lipase.

[0031] In the present invention, the fucoidan delays intestinal senescence by reducing the intestinal oxidative stress level and the content of intestinal senescence markers.

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1 Extraction of fucoidan from sea cucumber

[0034] Sea cucumbers (purchased from Qingdao Aquatic Products Market) were pulverized using a powder mill, and buffer solution (the buffer solution was prepared as 100 mM acetic acid-sodium acetate solution (pH = 6.0) + 5 mM disodium ethylenediaminetetraacetate + 5 mM L-cysteine) was added according to a solid-liquid ratio of 1 g:10 mL. After maintaining at a constant temperature of 60 °C for 30 min, papain (purchased from Beijing Gold Clone Biotechnology Co., Ltd.) at 0.1 times the mass of the sea cucumbers was added, and enzymatic hydrolysis was carried out overnight at 60 °C. After overnight enzymatic hydrolysis, the sea cucumber enzymatic hydrolysate was treated in a boiling water bath for 15 min, and centrifuged at 4500 rpm for 15 min to obtain the supernatant. 95% ethanol was added until the ethanol concentration reached 40%, and stirring was continuous during ethanol addition. Ethanol precipitation was carried out overnight at 4 °C. Centrifugation was carried out at 4500 rpm for 15 min to collect the supernatant, and 95% ethanol was further added to the supernatant until the final ethanol concentration reached 75%, and ethanol precipitation was carried out overnight at 4 °C. Centrifugation was carried out at 4500 rpm for 15 min to collect the precipitate. The precipitate (only the precipitate obtained by ethanol precipitation when the final ethanol concentration was 75%) was redissolved with ultrapure water at a ratio of 1 g:10 mL, centrifuged at 9000 rpm for 10 min, and the supernatant was filled into a dialysis bag (8 - 14 kDa) for dialysis for 3 d, with water changed every 3 h. The dialyzed product was freeze-dried to obtain the crude fucoidan product.

[0035] Establishment, administration, and sampling methods for the aging mouse model in Example 2

[0036] 1. Experimental animals Forty-eight male C57BL / 6J mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. They were housed in a room with standard environmental conditions, at a constant temperature of 22 - 25 °C and a relative humidity of 40% - 60%. The mice were housed separately in cages and had free access to water and food.

[0037] 2. Experimental methods After 7 days of adaptive feeding of mice, the animals were randomly divided into 6 groups: normal group (N group), model group (M group), vitamin C positive control group (VC group), low-dose fucoidan group (LF group), medium-dose fucoidan group (MF group), and high-dose fucoidan group (HF group), with 8 mice in each group. The fucoidan was obtained by the method of Example 1. The N group was intraperitoneally injected with normal saline (10 mL / kg) and gavaged with distilled water (10 mL / kg) every day; the M group was intraperitoneally injected with 400 mg / (Kg·bw) D-galactose (D-gal) and gavaged with distilled water (10 mL / kg) every day; the VC group was intraperitoneally injected with 400 mg / (Kg·bw) D-gal and gavaged with 100 mg / (Kg·bw) VC solution every day; the LF, MF, and HF groups were intraperitoneally injected with 400 mg / (Kg·bw) D-gal and gavaged with 100, 200, and 300 mg / (Kg·bw) fucoidan (AJ-FUC) solution, respectively. The intestinal motility and absorption ability of mice were detected at the 8th week. The mice were sacrificed on the second day after the last administration at the end of the 8th week. A 1-cm colon segment was placed in paraformaldehyde for HE and AB-PAS staining. A 4-cm small intestine segment was quickly frozen in liquid nitrogen and placed in a -80 °C refrigerator for subsequent detection of intestinal digestion ability. A 4-cm colon segment was quickly frozen in liquid nitrogen and placed in a -80 °C refrigerator for subsequent detection of oxidative stress level and senescence-related factors. The gavage of each group was carried out at 0.1 mL / 10 g.

[0038] Determination of Intestinal Function of Mice in Example 3

[0039] 1. Experimental Method The experiment was carried out by the method of Example 2. The intestinal motility and absorption ability of mice were detected at the 8th week of the experiment.

[0040] 1.1 Intestinal motility detection method: The mice were placed separately in a cage. 250 μL of 6% (w / v) carmine dye was mixed in 0.5% (w / v) methylcellulose. The time from gavage of carmine dye to the appearance of the first red feces was recorded as the intestinal transit time.

[0041] 1.2 Intestinal absorption ability detection method: After the mice were fasted for 16 h, they were gavaged with 2 mg / g glucose solution (10 mL / kg). Blood was collected from the tail vein of the mice at 0, 30, 60, 90, and 120 min, and the blood glucose level was measured with a blood glucose test strip. The area under the curve (AUC) of the blood drug concentration-time curve was calculated by software.

[0042] 1.3 Intestinal digestion ability detection method: The ileal tissue was retrieved for homogenization. The determination kits from Nanjing Jiancheng Bioengineering Co., Ltd., namely the α-amylase (AMS) test kit (starch-iodine colorimetric method) and the lipase (LPS) determination kit (colorimetric method), were used to detect the activities of intestinal α-amylase and lipase.

[0043] 2. Experimental results Figure 1 This is a graph of intestinal function changes. As Figure 1 can be seen, the intestinal motility, absorption, and digestion abilities of mice in the M group all showed a downward trend. After fucoidan intervention, the intestinal motility, absorption, and digestion abilities all showed an upward trend. Among them, the intestinal transit times of the LF, MF, and HF groups decreased by 15.28%, 5.21%, and 17.58% respectively; the area under the glucose blood concentration-time curve of high-dose fucoidan increased by 92.34% ( p =0.0504). At the same time, the α-amylase activity and lipase activity of high-dose fucoidan increased by 5.85% and 51.69% compared with the model group. Intestinal function is closely related to the quality of life of the elderly. Improving the decline in intestinal function (motility, absorption, and digestion) caused by aging can promote the efficiency of nutrient absorption, reduce the risk of infection and chronic diseases, and improve the overall quality of life and healthy lifespan by enhancing intestinal health.

[0044] It can be seen that fucoidan can enhance the intestinal motility, absorption, and digestion abilities of aging mice and improve the decline in intestinal function caused by aging.

[0045] Example 4: H&E staining of small intestinal tissue was performed and observed

[0046] 1. Experimental method 1.1 H&E section staining of small intestinal tissue The small intestinal tissue of the mice obtained in Example 2 was sent to Wuhan Sevier Biotechnology Co., Ltd. for sectioning and H&E staining. The specific operations were as follows: The small intestinal tissue was quickly fixed with 4% paraformaldehyde, then embedded in paraffin, sectioned and stained with hematoxylin-eosin (H&E), and observed and photographed under an electric fluorescence microscope to obtain the small intestinal H&E staining map, as Figure 2 shown.

[0047] 1.2 Determination of small intestinal villus length and crypt depth The small intestinal villus length and crypt depth of the mice obtained in Example 2 were measured using ImageJ software, and the ratio of villus length to crypt depth (V / C ratio) was calculated. Among them, the small intestinal villus height and crypt depth were measured from the tip of the villus to the crypt-villus junction and from the crypt-villus junction to the bottom of the crypt respectively. The results are as Figure 3 shown.

[0048] 2. Experimental results Figure 2 It was shown that, compared with the M group, the small intestinal villi in the HF group were arranged neatly, slender and tight. Figure 3 It was shown that the intervention with high-dose fucoidan significantly increased the length of small intestinal villi ( p <0.0001), significantly decreased the crypt depth ( p <0.0001), and increased the V / C ratio by 45.7% ( p =0.0267). The increase in villus length can increase the intestinal surface area and improve the absorption efficiency of nutrients; the decrease in crypt depth can reduce the infiltration of inflammatory cells and the expression of inflammatory factors, and alleviate the intestinal inflammatory response; the increase in the V / C ratio can enhance the intestinal barrier function and overall health status.

[0049] It can be seen that fucoidan can increase the length of small intestinal villi, crypt depth and V / C ratio, and delay the damage of the small intestinal apparent morphology caused by aging.

[0050] Example 5 Detection of the level of oxidative stress in colon tissue

[0051] 1. Experimental method The colon tissue obtained in Example 2 was made into 10% tissue homogenate, and the contents of malondialdehyde (MDA), total superoxide dismutase (T-SOD) and total antioxidant capacity (T-AOC) in the colon tissue homogenate were measured using the relevant assay kits of Nanjing Jiancheng Bioengineering Institute. The specific operation was carried out according to the instructions of the kits. The relevant results are as Figure 4 shown.

[0052] 2. Experimental results Figure 4 It was shown that, compared with the M group, the intervention with fucoidan could significantly reduce the level of oxidative stress in the colon. Among them, the intervention with low-, medium- and high-dose fucoidan decreased the intestinal MDA content by 72.90% ( p <0.0001), 64.10% ( p <0.0001) and 73.56% ( p <0.0001) respectively; increased the intestinal T-SOD content by 16.00% ( p =0.0071), 12.86% ( p =0.0340) and 5.87%; increased the intestinal T-AOC content by 17.05%, 32.74% ( p =0.0798) and 30.06% ( p =0.0547). The decrease in MDA content can reduce lipid peroxidation damage and maintain the integrity of the intestinal cell membrane; the enhancement of SOD activity can efficiently scavenge free radicals and protect intestinal tissues from oxidative attack; the increase in T-AOC level can synergistically strengthen the antioxidant defense system and delay the oxidative stress damage related to aging.

[0053] It can be seen from this that fucoidan can reduce the increased oxidative stress level caused by aging.

[0054] Example 6 detected the content of SASP in colon tissue

[0055] 1. Experimental method The colon tissue obtained in Example 2 was made into 10% tissue homogenate, and the contents of representative factors interleukin-6 (IL-6), interleukin-10 (IL-10) and tumor necrosis factor-α (TNF-α) in SASP were measured using the relevant assay kits of Shanghai Yaji Biotechnology Co., Ltd. The specific operation was carried out according to the kit instructions. The relevant results are as Figure 5 shown.

[0056] 2. Experimental results From Figure 5 it can be seen that compared with the M group, fucoidan intervention can significantly improve the SASP changes in mice. Among them, high-dose fucoidan from sea cucumber can significantly reduce the content of TNF-α ( p <0.001), and significantly increase the content of IL-10 ( p <0.001). SASP is a complex molecular assembly released by senescent cells, which can promote the local microenvironment to enter a chronic low-grade inflammatory state, leading to cell cycle arrest and the accumulation of senescent cells, accelerating aging. By regulating the changes of SASP, the toxic effects of inflammatory factors on systemic organs can be reduced, and finally the weakening of intestinal motility, the decline of digestive enzyme activity and the degradation of immune defense function related to aging can be delayed, providing a key intervention target for delaying intestinal aging.

[0057] It can be seen from this that fucoidan can improve the SASP changes in the aging intestine.

[0058] Example 7 detected the content of intestinal aging markers in colon tissue

[0059] 1. Experimental method The colon tissue of the mice in Example 2 was taken, and total RNA was extracted by grinding with Trizol solution and reverse transcribed to obtain cDNA. The internal reference gene was selected as GAPDH, and the expression levels of senescence markers P16, P21 and P53 were analyzed. The experimental results are as Figure 6 shown. The relevant primer sequences are shown in Table 1.

[0060] Table 1 Primer names and sequences Primer Name Sequence (5' to 3') GAPDH-F AATGGTGAAGGTCGGTGTGAACG (SEQ ID NO.1) GAPDH-R TCGCTCCTGGAAGATGGTGATGG (SEQ ID NO.2) P16-F TTCAGGTGATGATGATGGGCAACG (SEQ ID NO.3) P16-R CGGGCGGGAGAAGGTAGTGG (SEQ ID NO.4) P21-F CCCCACCCCATACTTCCCCTTC (SEQ ID NO.5) P21-R GTTGCCACTGGAGCTGCCTAAG (SEQ ID NO.6) P53-F ACCGCCGACCTATCCTTACCATC (SEQ ID NO.7) P53-R GGCACAAACACGAACCTCAAAGC (SEQ ID NO.8) 2. Experimental results From Figure 6It can be seen that compared with group M, after fucoidan intervention, the levels of intestinal senescence markers can be significantly reduced. Among them, high-dose fucoidan intervention reduced the contents of intestinal P16, P21 and P53 by 40.72% ( p = 0.088), 57.12% ( p = 0.002) and 44.89% ( p < 0.001), respectively. p16, p21 and p53 proteins are key factors in cell cycle regulation and senescence. Their overexpression will prompt cells to enter an irreversible growth arrest state, leading to the accumulation of senescent cells, triggering chronic inflammation and tissue function decline. Reducing their levels can relieve the senescence stress of intestinal stem cells and epithelial cells, enhance the regenerative capacity of intestinal tissue, promote mucosal repair, maintain the integrity of the intestinal barrier, thereby improving nutrient absorption, reducing inflammatory responses, and delaying senescence-related intestinal function degradation.

[0061] It can be seen that fucoidan can reduce the content of intestinal senescence markers and delay intestinal senescence.

[0062] In summary, the present invention provides an application of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly. Through the research on fucoidan, the present invention has determined that it has the efficacy of improving the decline of intestinal function caused by senescence, reducing the level of colonic oxidative stress and the content of intestinal senescence markers, and delaying intestinal senescence. The present invention has developed the potential application value of fucoidan, which has important guiding significance for the development of dietary supplements for delaying intestinal senescence in the elderly.

[0063] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of fucoidan in the preparation of a preparation for delaying intestinal senescence in the elderly.

2. The application according to claim 1, characterized in that, The fucoidan is obtained by extraction from echinoderms or brown algae.

3. The application according to claim 2, characterized in that, The extraction method of the fucoidan includes the following steps: (3.1) Mix the crushed echinoderms or brown algae with a buffer solution. The ratio of the crushed echinoderms or brown algae to the buffer solution is 1 g: 8 - 12 mL. After maintaining a constant temperature for 20 - 40 min, carry out an enzymatic hydrolysis reaction to obtain an enzymatic hydrolysate; (3.2) After inactivating the enzyme in the enzymatic hydrolysate, centrifuge to obtain a supernatant; (3.3) Carry out alcohol precipitation on the supernatant, centrifuge, and collect the precipitate; (3.4) After redissolving the precipitate, centrifuge, take the supernatant, carry out dialysis treatment, and lyophilize to obtain fucoidan.

4. The application according to claim 3, characterized in that, The buffer solution is composed of an acetic acid - sodium acetate solution with a final concentration of 90 - 110 mM, 4 - 6 mM of disodium ethylenediaminetetraacetate, and 4 - 6 mM of L - cysteine.

5. The application according to claim 3, wherein, The enzymatic hydrolysis uses papain; the usage amount of the papain is 0.05 - 0.2 times the mass of the echinoderms or brown algae.

6. The application according to claim 1, characterized in that The dosage of the fucoidan is ≥ 100 mg / kg / d.

7. The application according to claim 1, characterized in that, The fucoidan further includes a pharmaceutically acceptable carrier.

8. The application according to claim 1, characterized in that The intestinal senescence in the elderly includes a decline in intestinal function, an increase in intestinal oxidative stress level, and an increase in the content of intestinal senescence markers.

9. The application according to claim 8, characterized in that The fucoidan promotes the absorption of nutrients by the intestine and reduces the risks of infection and chronic diseases by increasing the activities of α - amylase and lipase.

10. The application according to claim 8, wherein The fucoidan delays intestinal senescence by reducing the intestinal oxidative stress level and the content of intestinal senescence markers.

Images