Composite adjuvant and application thereof in H7 subtype avian influenza subunit vaccine

Abstract

The invention belongs to the technical field of biology, and discloses a composite adjuvant which is obtained by assembling plasmids containing CpG oligonucleotide sequences and PEI polyethyleneimine in an electrostatic adsorption mode. The composite adjuvant is obtained by assembling plasmids of a CpG oligonucleotide sequence and PEI polyethyleneimine in an electrostatic adsorption mode, a cationic polymer PEI with positive charges can wrap CpG nucleic acid molecules through electrostatic interaction, surface charges are modified to form stable nanoparticles, and the cellular uptake efficiency and the degradation resistance of CpG are effectively improved; meanwhile, the invention also provides application of the composite adjuvant and a vaccine.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and specifically to a composite adjuvant and its application in a subunit vaccine against avian influenza subtype H7. Background Art

[0002] Avian influenza (AI) is caused by influenza A virus of the genus Orthomyxoviridae, and is an acute respiratory infectious disease that occurs in various domestic and wild birds. Among them, highly pathogenic avian influenza viruses can also infect humans. Since the 21st century, multiple outbreaks of highly pathogenic avian influenza mainly of subtype H7N9 have occurred globally, which have not only caused huge economic losses to the poultry industries in many countries, but also posed a serious threat to the health and life safety of humans.

[0003] At present, the main means and measures for preventing and controlling avian influenza are to inoculate inactivated avian influenza vaccines. In production practice, inactivated antigens are often supplemented with adjuvants to make oil emulsion vaccines, which are immunized in poultry by injection. Compared with traditional inactivated vaccines, subunit vaccines provide the same protective efficacy and higher biosafety, and have a faster vaccine development time. Using hemagglutinin (HA) as the protective antigen of influenza vaccines has been proven in different animal models. Separate antigen subunit vaccines have problems such as poor immunogenicity or a single induced immune response, so a suitable adjuvant is needed to enhance its immunogenicity and improve the ability of the body to produce an immune response.

[0004] Adjuvants have been widely used in the formulation of vaccines and play an important role in improving the prevention of infectious diseases by vaccines. However, the development of new vaccine adjuvants takes a long time. Common types of adjuvants include inorganic adjuvants, oil emulsion adjuvants, bacterial toxins, cytokines, nucleotides, and nano adjuvants. But only the following several types have been approved for use in vaccines currently: aluminum adjuvant (Alum), MF59 emulsion adjuvant, cholera toxin, cytokine adjuvant, etc. However, these vaccine adjuvants cannot induce the body to produce a long-lasting and highly efficient immune response, and still have certain toxic side effects on the body at the lowest effective concentration, and there are also carcinogenic and other adverse reactions.

[0005] CpG oligodeoxynucleotides (CpG ODNs) can bind to Toll-like receptor 9 (TLR 9) and activate the immune system. Therefore, CpG ODNs have attracted considerable interest as immunosuppressants or adjuvants for many diseases. CpG-ODN can stimulate dendritic cells, macrophages, and B cells by activating the NF-κB pathway, thereby promoting cytokine secretion and co-stimulatory molecule expression, ultimately enhancing the immune response and tending towards a Th1-type response. CpG-ODN has been proven to be an excellent immune adjuvant in a variety of mammalian vaccines, however, there are fewer reports on its efficacy in avian vaccines. Since CpG ODN is easily degraded and has low cellular internalization efficiency, its application in avian vaccines is limited due to its high synthesis cost.

[0006] Polyethyleneimine (PEI) is an organic polycation that has been widely used as a transfection reagent in recent years. Although the adjuvant potential of PEI has been well studied in mammals, its applicability and immunological characteristics in avians are still rare. Many studies have reported that cationic nanoadjuvants are promising antigen delivery systems. Positively charged nanoadjuvants are easily taken up by antigen-presenting cells (APCs), and may undergo lysosomal escape to promote antigen cross-presentation and induce cellular immune responses.

[0007] As disclosed in the prior art CN 116234587 A, an immunogenic construct includes a nanoparticle platform (NP), and the NP includes nanoparticles and a certain amount of cross-linked cationic polymer; the cross-linked cationic polymer includes polyethyleneimine (PEI) electrostatically bound to the outer surface of the nanoparticles, as well as a certain amount of stabilizer, antigen of an infectious agent or antigen producer, and further includes an adjuvant, and the adjuvant includes CpG oligonucleotides. The assembly mechanism of this scheme is as follows: PEI is assembled onto the NP based on electrostatic or other binding forces, and then CPG, antigen, etc. are assembled onto the PEI and / or NP based on electrostatic adsorption; its structure is a spherical assembly structure from the inside out, fixing the bioactive adjuvant and antigen on the outermost side of the spherical structure. As recorded in paragraph 83 of the specification of this scheme, the NP is an essential and important component, and all subsequent assembly processes must rely on the NP; at the same time, in order to maintain the stability of this assembly structure, the stabilizer PEG must be used;

[0008] The problems existing in this scheme are as follows: It requires a relatively complex formulation, where NP, PEI, antigen, and PEG are all essential components, which makes its industrial production and manufacturing extremely complex. As recorded in paragraph 351 of its specification, it needs to use a layer-by-layer coating method to manufacture the above interlayer structure.

[0009] Therefore, the technical problem to be solved in this case is: how to obtain a composite adjuvant with a simple structure, low cost, high immune-stimulating activity, and high internalization efficiency. Summary of the Invention

[0010] The object of the present invention is to provide a composite adjuvant, which is assembled by electrostatic adsorption of a plasmid containing a CpG oligonucleotide sequence and PEI (polyethyleneimine). PEI can enhance and regulate the immune-stimulating activity of CpG oligonucleotides, and promote the internalization efficiency of CpG-ODN. At the same time, the CpG oligonucleotides obtained by plasmid fermentation have the advantage of low cost.

[0011] Meanwhile, the present invention also provides the application of the composite adjuvant and vaccines, especially the application in H7 subtype avian influenza subunit vaccines.

[0012] To achieve the above object, the present invention provides the following technical solutions:

[0013] A composite adjuvant, wherein the composite adjuvant is assembled by electrostatic adsorption of a plasmid containing a CpG oligonucleotide sequence and PEI (polyethyleneimine).

[0014] The receptor of CpG is TLR9. Different from other TLR receptors, TLR9 is mainly expressed intracellularly. Therefore, CpG needs to be internalized into cells to effectively exert its immune-stimulating ability. However, CpG is a nucleic acid molecule and is easily degraded by nucleases, which results in insufficient stability of CpG in vivo. Studies have shown that particle sizes below 500 nm are beneficial for DC cell uptake, and particles with a diameter between 20 and 200 nm similar to virus particles can promote Th1-type immune responses. The cationic charges carried on the particle surface can also significantly enhance the phagocytic functions of macrophages and DC cells. Since both CpG and cell membranes carry the same negative charge, it is difficult for CpG to penetrate the cell membrane, which is not conducive to cell uptake.

[0015] In the present invention, a composite adjuvant is assembled by electrostatic adsorption of a plasmid containing a CpG oligonucleotide sequence and PEI (polyethyleneimine). The positively charged cationic polymer PEI can wrap the CpG nucleic acid molecule through electrostatic interaction and modify the surface charge to form stable nanoparticles, effectively improving the cell uptake efficiency and the anti-degradation ability of CpG.

[0016] The advantages of the structure of the present invention are as follows: The plasmid of the present invention can be directly synthesized by biological methods, and then the plasmid and PEI are assembled electrostatically. With the synergistic effect of subunit antigens, a satisfactory immune effect can be achieved; the structure has high stability and does not require the presence of a stabilizer PEG. At the same time, this structure can be achieved based on the random assembly method of electrostatic adsorption, without the layer-by-layer coating technology in the prior art, and has significant advantages in production and application.

[0017] Preferably, the mass of the PEI (polyethyleneimine) is at least 3 times that of the CpG oligonucleotide plasmid.

[0018] Preferably, the molecular weight of the PEI (polyethyleneimine) is 36,000 - 44,000.

[0019] Preferably, the CpG oligonucleotide sequence is one or a combination of more than one of the sequences CpG ODN1018, CpG ODN2007, and CpG ODN2395.

[0020] In addition, the present invention discloses the use of the composite adjuvant as described above to prepare a preparation for promoting cell proliferation.

[0021] In addition, the present invention also discloses the use of the composite adjuvant as described above to prepare a vaccine.

[0022] Finally, the present invention discloses a vaccine containing 5.7 wt% - 11.4 wt% of the composite adjuvant as described above.

[0023] Preferably, the vaccine further contains a subunit protein antigen.

[0024] Preferably, the vaccine is a subunit vaccine for preventing avian influenza of subtype H7.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] The present invention uses a plasmid of CpG oligonucleotide sequence and PEI (polyethyleneimine) to assemble a composite adjuvant through electrostatic adsorption. The positively charged cationic polymer PEI can wrap the CpG nucleic acid molecule through electrostatic interaction and modify the surface charge to form stable nanoparticles, effectively improving the cell uptake efficiency and the anti-degradation ability of CpG, and promoting the internalization efficiency of CpG-ODN. The plasmid of the present invention can be directly synthesized by a biological method, and then the plasmid and PEI are assembled by electrostatics. Under the synergistic action of the subunit antigen, a satisfactory immune effect can be achieved; the structure has high stability, does not require the presence of the stabilizer PEG, and at the same time, this structure can be realized based on the random assembly method of electrostatic adsorption, without the layer-by-layer coating technology in the prior art, and has significant advantages in production and application. Description of the Drawings

[0027] Figure 1 is the map of the pUC19 vector plasmid;

[0028] Figure 2 is the Zeta potential verification result diagram of the CpG / PEI composite adjuvant in Example 2;

[0029] Figure 3 is the particle size verification result diagram of the CpG / PEI composite adjuvant in Example 2;

[0030] Figure 4 It is the verification result graph of the particle size and morphology of the CpG / PEI composite adjuvant in Example 2;

[0031] Figure 5 It is the verification result graph of the agarose gel electrophoresis retardation in step (1) of Example 3;

[0032] Figure 6 It is the verification result graph of the CpG / PEI composite adjuvant against DNase I degradation test in step (2) of Example 3;

[0033] Figure 7 It is the verification result graph of step (3) of Example 3;

[0034] Figure 8 It is the verification result graph of CCK8 in step (1) of Example 4;

[0035] Figure 9 It is the verification result graph of ELISA-IFNα-24h in step (2) of Example 4;

[0036] Figure 10 It is the ELISA verification result graph of ELISA-IFNα-48h in step (2) of Example 4;

[0037] Figure 11 It is the map of the recombinant expression vector in step (1) of Example 5;

[0038] Figure 12 It is the verification graph of the protein electrophoresis result in step (3) of Example 5;

[0039] Figure 13 It is the verification result graph of the target protein identification in step (3) of Example 5;

[0040] Figure 14 It is the antibody titer graph induced by the vaccine in step (3) of Example 6;

[0041] Figure 15 It is the verification result graph of the serum IFN-γ expression level in step (4) of Example 6;

[0042] Figure 16 It is the verification result graph of the serum IFN-α expression level in step (4) of Example 6;

[0043] Figure 17 It is the verification result graph of the serum IL-4 expression level in step (4) of Example 6;

[0044] Figure 18 It is for CD4 in step (5) of Example 6 + Verification result graph of T cell analysis;

[0045] Figure 19 Verification diagram of the results of CD8 + T cell analysis in step (5) of Example 6. Specific implementation mode

[0046] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0047] Product information:

[0048] The product information of each raw material is shown in Table 1;

[0049] Table 1 Product information table

[0050]

[0051]

[0052] Example 1: Synthesis and preparation of CpG / PEI composite adjuvant

[0053] (1) Synthesis of plasmid-type CpG

[0054] Integrate the CpG ODN1018, CpG ODN2007, and CpG ODN2395 sequences. The integrated sequence is as follows:

[0055] TGACTGTGAACGTTCGAGATGATCGTCGTTTTCGGCGCTCGTCGTTGTCGTTTTG TCGTT(SEQ IDNO.1);

[0056] Subsequently, set an EcoRI restriction enzyme site at the front end of the sequence and a HindIII restriction enzyme site at the back end. Then clone the CpGODN hybrid sequence into the pUC19 vector plasmid, and extract the CpG plasmid. The pUC19 vector plasmid is as Figure 1 shown.

[0057] (2) Preparation of CpG / PEI composite adjuvant

[0058] Combine the extracted CpG plasmid and PEI according to the following binding ratios (w / w: CpG plasmid / PEI), which are 1:0, 1:0.5, 1:1, 1:3, 1:5, and 1:8 respectively. Use a micropipette to repeatedly pipette and mix, and incubate at room temperature for 30 min.

[0059] Example 2: Study on the Physicochemical Properties of CpG / PEI Composite Adjuvant

[0060] Using a Zetasizer Nano ZS90, the Zeta potential and particle size of the CpG / PEI composite adjuvant with different binding ratios (w / w: CpG plasmid / PEI) in step (2) of Example 1 were detected respectively. Prepare a CpG / PEI sample suspension to ensure uniform suspension, eliminate bubble and particle aggregation phenomena. Slowly push the sample into the sample cell using a syringe, avoiding the generation of bubbles, and place it in the instrument for detection. When changing samples, rinse the sample cell with electrode water, then rinse it with the sample, and then conduct the detection.

[0061] Transmission Electron Microscope (TEM) imaging was used to determine the morphological structure of the CpG / PEI composite adjuvant. First, evenly distribute the CpG / PEI composite adjuvant in alcohol, and use a dropper to drop it on a copper mesh covered with a support film. Then, use filter paper to absorb the excess liquid, place it in the air for about 20 minutes, and wait for it to dry. After drying, place the prepared sample in a negative stain for staining, and then use a TEM to observe the morphological structure of the CpG / PEI composite adjuvant.

[0062] The results showed that the Zeta potential of the CpG / PEI composite adjuvant increased with the increase of the binding ratio (refer to Figure 2 ). When the mass binding ratio of CpG / PEI was 1:3, the Zeta potential was (27.15 ± 0.62) mV. When the binding ratios were 1:3, 1:5, and 1:8, the Zeta potential tended to be stable, indicating that the negative charges carried by CpG had been completely bound. The particle size of the CpG / PEI composite adjuvant showed regular-shaped and uniform-sized particles when the binding ratio was 3 (refer to Figure 3 Figure 4 ), with a size of (186.1 ± 4.70) nm, which was beneficial for cell uptake at this time.

[0063] Example 3: Binding Optimization of CpG / PEI Composite Adjuvant

[0064] (1) Agarose Gel Electrophoresis Retardation

[0065] Accurately weigh 242 g of Tris, 37.2 g of Na2EDTA·2H2O, and 57.1 mL of acetic acid. Add the above reagents to 800 mL of deionized water and dissolve, then make up the volume to 1 L. The prepared buffer is 100 times the working concentration and needs to be diluted 100 times before use.

[0066] ​Weigh 0.6 g of agarose and place it in a conical flask. Add 60 mL of 1x TAE dilution solution and heat until the agarose boils and dissolves to obtain a 1% agarose gel solution. Cool it at room temperature. When the temperature drops to 50 - 65 °C, add 2 μL of Goldview dye to the agarose gel solution, mix gently, and then pour the agarose gel solution into the horizontal groove with a template comb inserted. Cool it at room temperature until it completely solidifies, and gently pull out the template comb. Then place the plate with the gel into the electrophoresis tank and fill the outer tank with 1x TAE dilution solution. The dilution solution in the outer tank should be 1 - 2 mm higher than the gel surface.

[0067] Then, respectively take 10 μL of 6 different binding ratio CpG / PEI complex adjuvants and pipette and mix them well with 2 μL of 6x DNA loading buffer, and load the sample into the sample loading well. The loading volume of each sample is 6 μL, and perform electrophoresis at a voltage of 75 V for 90 min, and observe the electrophoresis bands using an independent gel imager.

[0068] The results are referred to Figure 5 , in the figure, M: DNA Marker DL5000; 1 - 6: The binding ratios (w / w) of CpG / PEI are: 1:0, 1:0.5, 1:1, 1:3, 1:5, 1:8.

[0069] The results show that the CpG / PEI complex adjuvant after electrostatic adsorption assembly will remain in the sample loading well of the agarose gel, and the unbound CpG will migrate along the direction of the electrophoresis charge movement and bands will appear on the gel. When the binding ratio (w / w: CpG / PEI) of CpG / PEI is 1:1, no bands of free CpG will appear on the gel, indicating that when the binding ratio of CpG / PEI is greater than 1:1, CpG can be completely assembled with PEI.

[0070] (2) CpG / PEI complex adjuvant anti-DNase I degradation test

[0071] Respectively add 1 μL of deoxyribonuclease (DNase I), 1 μL of RNase-free ddH2O, 1 μL of 10x Reaction Buffer with MgCl2, and 7 μL of the above samples to the CpG / PEI complex adjuvants with binding ratios (w / w: CpG / PEI) of 1:0, 1:0.5, 1:1, 1:3, 1:5, 1:8. Use a micropipette to aspirate and mix repeatedly, and incubate the above reaction system at 37 °C statically. After 30 min, take out the sample, immediately add 1 μL of 50 mM EDTA to the ep tube, and incubate it at 65 °C statically for 10 min to terminate the degradation reaction and obtain the sample treated with DNase I.

[0072] Take out 5 μL of each tube of sample and place it in a new EP tube. Add 10 μL of the prepared heparin sodium (4 mg / mL) to the tube, and place it at 37 °C for 60 min to obtain the sample treated with DNase I - heparin sodium. Detect all the samples after the reaction by 1% agarose gel electrophoresis at a voltage of 75 V for 90 min. At the same time, add plasmid DNA without DNase I as the positive control group for electrophoresis.

[0073] Result reference Figure 6 , in the figure, M is DNA Marker DL5000; lanes 2 - 13 are CpG / PEI with different binding ratios after degradation by DNase I and reduction treatment with heparin sodium after degradation. Among them, 2 - 3: CpG / PEI (w / w: 1:0); 4 - 5: CpG / PEI (w / w: 1:0.5); 6 - 7: CpG / PEI (w / w: 1:1); 8 - 9: CpG / PEI (w / w: 1:3); 10 - 11: CpG / PEI (w / w: 1:5); 12 - 13: CpG / PEI (w / w: 1:8).

[0074] The results show that naked CpG has been completely degraded by DNase I and no band is presented in the gel. While the CpG / PEI complex adjuvant can effectively protect CpG from the degradation of DNase I. When the mass binding ratio of CpG / PEI is 1:0.5 and treated with heparin sodium solution replacement, the target band can be seen. When the binding ratio is 1:3, obvious intact bands can be seen, proving that when the CpG / PEI binding ratio (w / w: CpG / PEI) is 1:3, it can effectively protect CpG from degradation.

[0075] (3) Screening of the usage ratio of CpG / PEI complex adjuvant

[0076] Make RAW264.7 mouse macrophages adhere and grow in 1640 culture medium containing 10 wt% fetal bovine serum, and place them in a 37 °C incubator with 5 vol% CO2 saturated humidity for culture. After the cells cover 80%, blow the cells off with a pipette and transfer the cells to a new culture medium. Change the medium and passage the cells about once every 2 - 3 days on average, and take RAW264.7 cells in the logarithmic growth phase for the experiment.

[0077] In order to explore whether CpG / PEI can be effectively delivered into cells, this experiment selects the green fluorescent protein GFP plasmid, and prepares samples by mixing GFP and CpG at a ratio of 1:1 (w / w). Subsequently, the samples are combined with PEI at different ratios to simulate the cell transfection situation of CpG / PEI.

[0078] RAW 264.7 cells in logarithmic growth phase were seeded in 24-well plates. After the cell density reached 80%, the following groups were set up: blank group, experimental group 1 (w / w = 1:0.5, GFP-CpG / PEI), experimental group 2 (w / w = 1:1, GFP-CpG / PEI), experimental group 3 (w / w = 1:3, GFP-CpG / PEI), experimental group 4 (w / w = 1:5, GFP-CpG / PEI), and experimental group 5 (w / w = 1:8, GFP-CpG / PEI). The GFP-CpG and PEI solutions were prepared into a composite adjuvant according to the above ratios. For each well of cells, the GFP-CpG plasmid was diluted with 100 μL of serum-free DMEM medium, and thoroughly mixed to form a dilution. It was incubated at room temperature for 10 min to form a composite adjuvant. 100 μL of the composite adjuvant was added to the cells, and the culture plate was shaken gently to mix well. The cells were placed in an incubator at 37 °C with 5 vol% CO2 for culture. After stimulation for different times, the growth status of the cells in each group was observed under a microscope. After 24 h, the cell plate was placed under a fluorescence microscope for observation.

[0079] Results for reference Figure 7 , in the figure, A - F: The binding ratios of GFP-CpG / PEI were 1:0.5, 1:1, 1:3, 1:5, and 1:8 respectively. After co-culturing each sample with RAW264.7 for 24 h, pictures were taken using a fluorescence microscope.

[0080] The results showed that green fluorescent dots could be observed on the cells when the binding ratio (w / w: GFP-CpG / PEI) was 1:0.5, 1:1, 1:3, 1:5, and 1:8, while there were no fluorescent dots in the blank group. Among them, when the binding ratio was 1:0.5, 1:1, and 1:3, there were more fluorescent dots and the fluorescence intensity in the cells was greater.

[0081] Example 4: In vitro immune stimulation effect of CpG / PEI composite adjuvant

[0082] (1) CpG / PEI composite adjuvant cell proliferation assay

[0083] The cell suspension was added to a 96-well plate, 100 μL per well, and the concentration was set at 8x10 3cells / well. Place the 96-well plate in an incubator at 37 °C with 5 vol% CO2 for adherent culture for 12 h. Prepare CpG / PEI complex adjuvants with binding ratios (w / w: CpG / PEI) of 1:0, 1:0.5, 1:1, 1:3, 1:5, and 1:8, incubate at room temperature for 10 min, and at the same time add serum-free DMEM medium to the cells. After 10 min, add each group of complex adjuvants, gently shake the cell plate, and place it in a constant-temperature CO2 incubator for culture for 24 h. After 24 h, discard the supernatant and wash twice with sterile PBS. Subsequently, add 10 μL of CCK8 solution to each well of the 96-well plate, place it in the incubator for light-shielded incubation for 1-4 h, and finally use a multi-functional microplate reader to detect the absorbance value of the 96-well plate at a wavelength of 450 nm, detect it every half hour until the absorbance value is about 1, save the experimental results and perform statistical analysis using Graphpad Prism software.

[0084] Result reference Figure 8 , in the figure, Control: untreated cell control well; 0: CpG / PEI (1:0); 0.5: CpG / PEI (1:0.5); 1: CpG / PEI (1:1); 3: CpG / PEI (1:3); 5: CpG / PEI (1:5); 8: CpG / PEI (1:8)

[0085] The results showed that after co-incubating the CpG / PEI complex adjuvant with RAW264.7 macrophages for 24 h, when the CpG / PEI binding ratio was 1:0.5, 1:1, or 1:3, the cell survival rate was higher than that of the control group, indicating that CpG / PEI had a certain cell proliferation effect. When the CpG / PEI binding ratio was 1:1 and 1:3, the cell survival rate was the highest. We speculated that this was because after CpG / PEI stimulated the cells, it activated the TLR4 and TLR9 receptors, promoting macrophage proliferation. When the CpG / PEI binding ratio was 1:8, the cell survival rate was 83 ± 3.43%, significantly lower than that of CpG / PEI (1:3), indicating that a slight cell proliferation inhibitory effect occurred at this time.

[0086] (2) In vitro cytokine determination

[0087] Use the ELISA method to detect the secretion level of IFN-α factor in the cell culture supernatant. Referring to the method and ratio in step (1) of Example 4, co-incubate the CpG / PEI complex adjuvant with a binding ratio (w / w: CpG / PEI) of 1:0.5, 1:1, or 1:3 with the cells for 24 h and 48 h. Aspirate the cell supernatant, centrifuge at 10,000 rpm for 10 min, and collect it in a new EP tube. Store the sample at 4 °C for later use. Take out the ELISA kit from the 4 °C refrigerator in advance and place it at room temperature for 30 min.

[0088] Dissolve the standard product and dilute the standard product to concentrations such as 0, 15.6, 31.25, 62.5, 125, 250, 500, 1000 pg / mL. Prepare the biotin antibody working solution by mixing the biotin antibody and its diluent at a ratio of 100:1. Prepare the enzyme conjugate working solution by mixing the enzyme conjugate and its diluent at a ratio of 100:1. Prepare the washing solution by mixing the washing solution and deionized water at a ratio of 30:1.

[0089] Add the samples and standards to the ELISA wells, 100 μL per well. Set up 2 replicates for each sample. Seal the wells with a special membrane and incubate at 37 °C for 90 min. Remove the samples and standards, add 300 μL of the washing solution to each well, wash for 30 s, and wash 3 times in total. After washing, add 100 μL of the biotin antibody working solution to each well. After sealing the plate wells, incubate at 37 °C for 60 min. Remove the biotin antibody working solution, add 300 μL of the washing solution to each well, wash for 30 s, and wash 3 times in total. After washing, add 50 μL of the enzyme conjugate working solution to each well. After sealing the plate wells, incubate at 37 °C for 30 min. Remove the enzyme conjugate working solution, add 300 μL of the washing solution to each well, wash for 30 s, and wash 5 times in total. After washing, add 100 μL of the tetramethylbenzidine (TMB) chromogenic solution to each well and incubate in the dark for 10 - 20 min. After incubation, add 50 μL of the termination solution to each well to terminate the reaction. Use a multi-functional microplate reader to detect the absorbance value of the ELISA wells at a wavelength of 450 nm and save the data. Fit the standard regression curve according to the standard product concentration and the corresponding absorbance value, calculate the IFN-α factor concentration of the samples, and use Graphpad Prism software for plotting and analysis.

[0090] The results showed that the PBS group and the single PEI group (H: high dose; L: low dose), co-cultured with Raw264.7 cells for 24 h (reference Figure 9 ) and 48 h (reference Figure 10)After that, the IFN-α expression levels showed no obvious changes. At 24 h, there were no significant inter-group differences in the IFN-α expression levels among the CpG group, CpG / PEI(1:1) group, and CpG / PEI(1:3) group. At 48 h, both the CpG / PEI(1:1) group and the CpG / PEI(1:3) group could effectively stimulate the cells to secrete IFN-α. Among them, the immune-stimulating activity of the CpG / PEI(1:3) group was significantly higher than that of the CpG group and the CpG / PEI(1:1) group. Based on the above results, the IFN-α content of CpG / PEI at 48 h was higher than that at 24 h, probably because the binding of PEI caused a lag in the immune-stimulating activity of CpG. We believe that CpG / PEI can be effectively taken up by cells, and when CpG is not bound to PEI, its in vitro immune-stimulating activity is low. CpG / PEI improves the in vitro immune-stimulating activity of CpG, can significantly promote the cells to secrete IFN-α, and has a certain immunomodulatory effect.

[0091] Example 5: Expression of H7N9 avian influenza virus HA1 recombinant protein

[0092] (1) Construction and identification of H7-HA1-pBacpAK9 recombinant plasmid

[0093] Search for the hemagglutinin sequence of H7N9 subtype avian influenza virus in the sequences published in the GenBank section of the NCBI website, GenBank: AUS83937.1. According to the retrieved information, select the HA1 protein sequence, and its sequence is as follows:

[0094] DKICLGHHAVSNGTKVNTLTEKGVEVVNATETVERTNTPRICSKGKRTVDLGQCGLLGTITGPPQCDQFLEFSADLIIERRGGSDVCYPGKFVNEEALRQILRESGGIDKEPMGFTYNGIRTNGVTSACRRSGSSFYAEMKWLLSNTDNAAFPQMTKSYKNTRESPAIVVWGIHHSVSTAEQTKLYGSGNKLVTVGSSNYQQSFVPSPGARPQVNGQSGRIDFHWLILNPNDTVTFSFNGAFIAPDRASFLRGKSMGIQSGVQVDANCEGDCYHSGGTIISNLPFQNIDSRAVGKCPRYVKQRSLLLATGMKNVPEVPKRKRTAR (SEQ ID NO.2)

[0095] At the same time, add a 6×His tag to the C-terminal of the amino acid sequence and name it H7-HA1.

[0096] The target fragment H7-HA1 was inserted into the multiple cloning site of the pBacpAK9 vector by homologous recombination to obtain the recombinant product H7-HA1-pBacpAK9 containing the H7-HA1 fragment and the pBacpAK9 vector. The map is for reference Figure 11 . Take DH5α competent cells and thaw them on ice. After complete thawing, aliquot the DH5α competent cells into 1.5 mL centrifuge tubes, 20 - 50 μL per tube. Add all of the recombinant product to the aliquoted DH5α competent cells, mix gently, and incubate on ice for 30 min. After incubation, place it in a 42 °C water bath for 90 s, and then let it stand on ice for 2 - 5 min. After the above operations, add 800 μL of antibiotic-free LB liquid medium, and culture at 37 °C, 220 rpm for 45 min. After the culture, spread the above bacterial solution evenly on a solid LB culture dish with Amp+, and invert the plate and culture it in a 37 °C incubator for 12 - 16 h. Select well-growing single colonies for PCR, electrophoresis, and sequencing verification. After correct verification, the recombinant plasmid was successfully constructed and named H7-HA1-pBacpAK9. Pick a colony of H7-HA1-pBacpAK9 into Amp+LB liquid medium and expand the culture at 37 °C, 220 rpm. Subsequently, extract the recombinant plasmid and store it in a -20 °C refrigerator.

[0097] Take DH10Bac competent cells and thaw them on ice. After complete thawing, aliquot the DH10Bac competent cells into 1.5 mL centrifuge tubes, 50 - 100 μL per tube. Pipette 100 ng of the recombinant plasmid into the aliquoted DH10Bac competent cells, mix gently, and incubate on ice for 30 min. After incubation, place it in a 42 °C water bath for heat stress for 45 s, and then let it stand on ice for 2 - 5 min. After the above operations, add 800 μL of antibiotic-free LB liquid medium, and culture at 37 °C, 220 rpm for 4 h. After the culture, dilute the above bacterial solution 10-fold with antibiotic-free LB liquid medium and spread it evenly on a triple-antibody solid LB plate. Invert the plate and culture it in a 37 °C incubator for 24 - 48 h. After transformation, pick single colonies for PCR identification. PCR, electrophoresis, and sequencing verification. After correct verification, the recombinant shuttle vector was successfully constructed and named Bac-H7-HA1-pBacpAK9. Pick single colonies for expansion culture, and then extract the plasmid and store it in a -20 °C refrigerator.

[0098] (2) Obtaining recombinant baculovirus by transfection of the shuttle vector

[0099] Transfect the shuttle vector into sf9 cells. The transfection steps are as follows: Seed sf9 cells at a density of 1×106 cells / mL onto a 6-well plate. After the cells are completely adherent, transfection can be carried out. Take 8 μL II Liposomes were diluted in 100 μL of Grace's medium and vortexed thoroughly. 2 - 4 μg of Bac - pFastBac - H7 - HA1 was diluted in 100 μL of Grace's medium and vortexed thoroughly. The diluted shuttle vector plasmid was mixed with the diluted II liposomes, incubated at room temperature for 15 - 30 min. After incubation, 800 μL of Grace's medium was added to the mixture. The adherent sf9 cells were taken out, the original medium was discarded, and the mixture of the shuttle vector plasmid and liposomes was added drop - by - drop to each well of the cells. The six - well plate was placed at 27 °C and incubated for 3 - 5 h. After incubation, the mixture was discarded, 2 mL of sf900II medium was added to each well, and the cells were cultured at 27 °C. After 72 h of culture, the supernatant was aspirated, which was the first - generation recombinant baculovirus.

[0100] (3) Recombinant protein expression and identification

[0101] The first - generation virus solution was inoculated into sf9 cells at an MOI of 0.1 and cultured at 27 °C for 72 - 96 h. After the culture was completed, it was placed at 4 °C and centrifuged at 500×g for 5 min, and the supernatant was collected, which was the second - generation recombinant baculovirus solution. The second - generation virus solution was inoculated into sf9 cells under the above conditions. After the culture was completed, it was centrifuged at 500×g for 15 min, and the supernatant was collected, which was the protein solution and stored at - 20 °C. It was purified using a HisTrap FF crude (column volume 1 mL) affinity chromatography column. First, 10 mL of Binding Buffer was slowly passed through the column to equilibrate the chromatography column. Subsequently, all the collected protein solution was added to the column, and then 10 - 15 mL of Binding Buffer was used to wash the chromatography column to wash away the unbound components and miscellaneous proteins. Finally, 5 mL of Elution Buffer was used to elute the target protein. The first 1 mL of the liquid was discarded, and the remaining liquid was collected at 1 mL / tube, divided into 5 tubes, and the purified protein solution was obtained.

[0102] Take 40 μL of the purified protein solution, add 10 μL of 5x Loading Buffer, and pipette and mix well. Incubate in a metal bath at 100 °C for 10 min. Prepare an SDS - polyacrylamide gel (12.5%) using an SDS - PAGE gel preparation kit. Set up a vertical electrophoresis tank, load 30 μL of sample into each well. First, run the gel at 80 V for 30 min, then increase the voltage to 120 V and continue running for 1 h. When the bromophenol blue completely runs out from the bottom of the separation gel, turn off the power supply, take out the gel, place it in Coomassie Brilliant Blue staining solution for staining. After staining, wash it with water, and then place it in the decolorizing solution for decolorization several times to observe the results.

[0103] Result reference Figure 12, In the figure, lane 1 is the supernatant of protein expression; lane 2 is the flow-through of protein purification; lane 3 is the protein eluate with 10 mM imidazole; lane 4 is the protein eluate with 20 mM imidazole; lane 5 is the protein eluate with 50 mM imidazole; lane 6 is the protein eluate with 200 mM imidazole.

[0104] The results showed that a clear band was visible at 40 KDa in the gel block, indicating successful protein expression.

[0105] Meanwhile, protein Western-Blot identification was carried out. The protein samples were re-run on SDS-PAGE electrophoresis. The PVDF membrane cut to size was carefully picked up with forceps, soaked in methanol for 5 min, and then washed with transfer buffer. The membrane and the SDS-PAGE gel were clamped together in sequence and inserted into the transfer tank for electrotransfer at 100 V in an ice-water bath for 90 min. After the transfer, 1X TBS buffer was added, and the membrane was placed on a shaker and washed twice, 5 min each time. Subsequently, a rapid blocking solution was added, and the membrane was blocked at room temperature on the shaker for 20 min. After blocking, the membrane was washed again with 1X TBST four times, 10 min each time. After removing the washing solution, the diluted rabbit anti-6XHis Tag monoclonal antibody (diluted 1:3000) was added respectively, and the membrane was incubated at room temperature on the shaker for 2 h. 1X TBS buffer was added, and the membrane was washed four times, 10 min each. Subsequently, the HRP-labeled goat anti-rabbit IgG antibody (diluted 1:5000) was added and incubated at room temperature for 45 min. After incubation, the membrane was washed again, twice, 10 min each. Finally, the ECL developing solution was dropped onto the membrane, and it was placed in an ultrasensitive luminescence detector for development, and the results were observed. The results showed that after verification by Western blot, a clear specific band was visible at 40 KDa (reference Figure 13 ), proving the successful expression of the target protein.

[0106] Example 6: In vivo immune effect of CpG / PEI composite adjuvant

[0107] (1) Preparation of subunit vaccine by combining CpG / PEI composite adjuvant with H7-HA1

[0108] The purified H7-HA1 protein, CpG, and CpG / PEI adjuvant were used to prepare subunit vaccines according to the following groups: PBS group, HA group, HA-CpG group, HA-CpG / PEI (w / w: CpG / PEI = 1:3) group, and commercial vaccine group. Subsequently, the prepared components were mixed with SEPPIC MONTANIDETM ISA 201VG emulsifying adjuvant at a ratio of 1:1 (V / V), shaken on a shaker for 6 - 8 h, and then emulsified with a homogenizer. It was fully emulsified to a white and uniform emulsion at 6000 r / min. When dropped into water, it formed a complete and non-dispersed water-in-oil state, indicating complete emulsification, and stored at 4°C.

[0109] (2) Immunization schedule formulation

[0110] According to the experimental groups, 50 two-week-old SPF chickens were randomly divided into 5 groups (10 chickens / group) and raised in a negative pressure isolator. Before vaccination, 3 chickens were randomly selected from each group of SPF chickens for wing vein blood collection. The collected blood was incubated in an incubator at 37°C for 30 min, and then centrifuged at 3000 rpm / min for 10 min at 4°C. The upper serum was collected as the serum of the immunized sample on day 0 and stored in a -20°C refrigerator for later use.

[0111] Take the prepared vaccine and immunize by subcutaneous injection in the neck respectively. Blood was collected once a week after immunization for a total of 4 weeks. The serum was separated and stored at -20°C for antibody level detection.

[0112] (3) Determination of hemagglutination inhibition titer of post-immunization serum

[0113] Prepare four-unit antigen, and use the H7N9-Re4 strain as the antigen for serum HI detection. First, determine the hemagglutination titer of the antigen virus. Add 25 μL of PBS to wells 1-12 of a 96-well V-shaped microtiter plate. Pipette 25 μL of the antigen into the first well, mix well by pipetting, and then pipette 25 μL to the second well. Serial two-fold dilutions are made to the 11th well, and finally 25 μL is discarded. Well 12 is the negative control well. Add 25 μL of PBS to wells 1-12 again, and then add 25 μL of 1% chicken red blood cell suspension to each well. Place the 96-well plate on a micro shaker to shake well to fully mix the liquid in the wells. Observe the hemagglutination titer of the antigen after standing for 40 min.

[0114] According to the hemagglutination titer of the virus, prepare 4HAU of four-unit antigen. Take the highest dilution factor of the completely hemagglutinated antigen as the end point, and divide the dilution factor of the end point by 4 to obtain the dilution factor of the four-unit antigen. Verify the four-unit antigen. Add 25 μL of PBS to a 96-well plate, add 25 μL of the prepared 4HAU antigen to the first well, mix well by pipetting, take 25 μL to the second well, and make serial two-fold dilutions to the 5th well. Finally, discard 25 μL, that is, well 5 is the negative control well. Add 25 μL of PBS to wells 1-5 again, and then add 25 μL of 1% chicken red blood cell suspension to each well. Place the 96-well plate on a micro shaker to shake well to fully mix the liquid in the wells. Observe the hemagglutination titer after standing for 40 min. The result interpretation standard is: wells 1 and 2 are completely agglutinated, well 3 is incompletely agglutinated, and wells 4 and 5 do not show agglutination.

[0115] Then, the hemagglutination inhibition test was performed. Take a 96-well V-shaped reaction plate, add 25μL PBS to wells 1 to 11, and add 50μL PBS to well 12. Take out the sample serum, add 25μL of the test serum to well 1, mix it by blowing, take 25μL to well 2, dilute it to well 10 in turn, and finally discard 25μL of liquid. Add 25μL 4HAU antigen to wells 1 to 11, mix it thoroughly with a micro-oscillator, and let it stand at room temperature for 30min. After the incubation, add 25μL of 1vol% chicken red blood cell suspension to each well, shake and mix it again, incubate it at room temperature for 30min, and interpret the results. The highest dilution factor that can completely inhibit the agglutination of 4HAU antigen is taken as the hemagglutination inhibition titer of the serum sample, and the titer of the negative control group is lower than 2log2.

[0116] The results show (reference Figure 14 ), the average HI titer of each test group increased on the 14th day after immunization, and maintained a stable upward trend from the 14th day to the 28th day. On the 28th day after immunization, the average HI titer of the HA group was 6.42log2, the HA-CpG group was 7.92log2, the HA-CpG / PEI group was 8.14log2, and the commercial vaccine group was 8.42log2, indicating that CpG / PEI can assist CpG in promoting humoral immune response.

[0117] (4) ELISA method for detection of serum cytokines

[0118] The double antibody sandwich ELISA method was used to detect the cytokine contents of IFN-γ, IFN-α, and IL-4 in the chicken serum samples of different groups. The specific operation steps were the same as step (2) of Example 4.

[0119] On the 28th day after SPF chickens were immunized, the levels of cytokines such as IFN-α, IFN-γ and IL-4 in the serum were detected. Figure 15 As shown in the figure, the IFN-γ content of the HA group and the HA-CpG group was 82.1 (pg / mL) and 135.86 (pg / mL), respectively, with significant differences (p<0.01). The HA-CpG / PEI group was 155.23 (pg / mL), which was higher than the other test groups and significantly different from the commercial vaccine group (p<0.001).

[0120] The results of IFN-α detection are as follows Figure 16As shown in the figure, the IFN-α content in the HA-CpG / PEI group was the highest, at 22.37 (pg / mL), 16.97 (pg / mL) in the HA-CpG group, 8.81 (pg / mL) in the HA group, with a significant difference compared to the HA-CpG group (p<0.001); 7.84 (pg / mL) in the commercial vaccine group, with a significant difference compared to the HA-CpG / PEI group (p<0.001).

[0121] The detection results of IL-4 are as Figure 17 shown. The IL-4 content in the HA group was 56.981 (pg / mL), 62.167 (pg / mL) in the HA-CpG group, 69.772 (pg / mL) in the HA-CpG / PEI group, and 66.735 (pg / mL) in the commercial vaccine group. There was no significant difference among the experimental groups.

[0122] Based on the above experimental results, HA-CpG / PEI can effectively promote the secretion of IFN-γ, IL-4, and IFN-α. The IFN-γ content in the HA-CpG / PEI group was the highest, followed by the HA-CpG group. IFN-γ is a marker cytokine of Th1-type immune responses. As a TLR9 receptor agonist, CpG can promote Th1-type immune responses. When PEI binds to CpG, it further enhances the ability of CpG to induce Th1-type immune responses.

[0123] (5) Detection of T lymphocyte subsets by flow cytometry

[0124] At the fourth week after immunization, blood was collected from the wing vein of each group of chickens into an anticoagulant blood collection tube containing EDTA. The chicken peripheral blood lymphocyte separation kit was used to separate lymphocytes in the peripheral blood. First, an equal volume of diluent was added to the anticoagulated blood sample and gently pipetted to mix evenly. Then, a 15 mL centrifuge tube was taken, and 5 mL of lymphocyte separation medium was added to the tube. The diluted blood sample was slowly added to the separation medium and centrifuged at 400 rpm / min for 15 min. After taking out the centrifuged sample, it could be seen that the blood sample showed obvious stratification. The middle white film layer was aspirated to obtain lymphocytes. The lymphocytes were transferred to a new 15 mL centrifuge tube, 5 mL of sterile PBS was added and pipetted to mix evenly, and then centrifuged at 600 rpm / min for 5 min. The supernatant was discarded. The centrifuged cells were added to the flow cytometry sample loading buffer containing 0.1 wt% FBS PBS, gently pipetted to resuspend, and the cell concentration was adjusted to 5×10 6 cells / mL.

[0125] After diluting CD3-APC antibody, CD4-FITC antibody, and CD8α-PE antibody according to the cell number, they were added to the flow cytometry sample loading buffer respectively. Then, 100 μL of the cell suspension from each tube was taken into a 96-well U-bottom non-adherent cell plate, and 100 μL of the diluted antibody was added to each well. Incubate and stain at 4°C for 35 min. After the incubation, centrifuge the 96-well cell plate at 600 rpm / min for 5 min, discard the supernatant, wash the cells in each well with the flow cytometry sample loading buffer, centrifuge again and discard the supernatant. Finally, add 300 μL of the flow cytometry sample loading buffer to each well to resuspend the cells, and detect the samples using a flow cytometer within 3 h.

[0126] The results are as Figure 18 - 19 shown. Both the HA-CpG group and the HA-CpG / PEI group can promote the activation of CD4 + T and CD8 + T lymphocytes. Among them, HA1-CpG / PEI has a relatively high level of CD4 + T and CD8 + T cell activation level, indicating that the CpG / PEI complex adjuvant can promote antigen cross-presentation and thus activate CD8 + T cells, enhancing the cellular immune response induced by the vaccine.

[0127] Summary: In the present invention, a complex adjuvant is assembled by electrostatic adsorption of a plasmid with a CpG oligonucleotide sequence and PEI (polyethyleneimine). The positively charged cationic polymer PEI can electrostatically wrap the CpG nucleic acid molecule and modify the surface charge to form stable nanoparticles, effectively improving the cell uptake efficiency and the anti-degradation ability of CpG, and promoting the internalization efficiency of CpG-ODN. The plasmid of the present invention can be directly synthesized by biological methods, and then the plasmid and PEI are assembled by electrostatics. With the synergistic effect of the subunit antigen, a satisfactory immune effect can be achieved; the structure has high stability, does not require the presence of a stabilizer PEG, and at the same time, this structure can be achieved based on the random assembly method of electrostatic adsorption, without the layer-by-layer coating technology in the prior art, and has significant advantages in production and application.

[0128] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced within the present invention. Any reference signs in the claims should not be regarded as limiting the claimed rights.

Claims

1. A composite adjuvant, characterized in that, The composite adjuvant described above is assembled by electrostatic adsorption of a plasmid containing a CpG oligonucleotide sequence and PEI (polyethyleneimine).

2. The composite adjuvant according to claim 1, characterized in that The mass of the PEI (polyethyleneimine) described above is at least 3 times that of the CpG oligonucleotide plasmid.

3. The composite adjuvant according to claim 1, characterized in that, The molecular weight of the PEI (polyethyleneimine) described above is 36,000 - 44,000.

4. The composite adjuvant according to claim 1, wherein the CpG oligonucleotide sequence is one or a combination of more than one of the CpG ODN1018, CpG ODN2007, and CpG ODN2395 sequences.

5. Use of the composite adjuvant according to any one of claims 1 to 4 for preparing a preparation for promoting cell proliferation.

6. Use of the composite adjuvant according to any one of claims 1 to 4 for preparing a vaccine.

7. A vaccine, characterized in that, Contains 5.7wt% - 11.4wt% of the composite adjuvant according to any one of claims 1 to 4.

8. The vaccine according to claim 7, characterized in that, The vaccine described above also contains a subunit protein antigen.

9. The vaccine according to claim 8, wherein The vaccine is a subunit vaccine for preventing avian influenza of subtype H7.

Images