MiR-108 and miR-049 and application thereof

Abstract

The invention discloses miR-108 and miR-049 and application thereof, and relates to the technical field of biology. The nucleotide sequence of the miR-108 is as shown in SEQ ID No. 1; the nucleotide sequence of the miR-049 is as shown in SEQ ID No. 2. According to the present invention, the miR-108 and the miR-049 are adopted as the micromolecule RNA (miRNA), can accurately regulate and control the pancreatic cancer related KRAS gene through RNA interference (RNAi), can directly inhibit the tumor proliferation or metastasis pathway, and can avoid the non-specific killing effect of the traditional chemotherapeutic drug on the normal cells;

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to miR-108 and miR-049 and their applications. Background Art

[0002] Currently, pancreatic cancer remains one of the most lethal cancers. Existing chemotherapy drugs for treating pancreatic cancer have obvious side effects. For example, gemcitabine often causes systemic toxicity such as myelosuppression and gastrointestinal reactions, and pancreatic cancer is prone to develop drug resistance to these chemotherapy drugs. Therefore, there is an urgent need to develop new drugs to provide more treatment options for pancreatic cancer patients. Compared with traditional protein-targeted and DNA-based drugs, ribonucleic acid (RNA)-based drugs have received extensive attention in recent years due to their unique physicochemical and physiological properties.

[0003] Therefore, providing a new miRNA for treating pancreatic cancer is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention provides miR-108 and miR-049 and their applications.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: miRNA, where the miRNA is miR-108 or miR-049; The nucleotide sequence of the miR-108 is as shown in SEQ ID No.1; The nucleotide sequence of the miR-049 is as shown in SEQ ID No.2.

[0006] A recombinant vector containing the coding gene of the miRNA, where the miRNA is miR-108 or miR-049.

[0007] The application of the miRNA or the recombinant vector in the preparation of a drug for treating human pancreatic cancer.

[0008] Through the above technical solutions, compared with the prior art, the beneficial effects of the present invention are as follows: The miR-108 and miR-049 of the present invention, as small molecule RNAs (miRNAs), can precisely regulate the KRAS gene related to pancreatic cancer through RNA interference (RNAi), directly inhibit the tumor proliferation or metastasis pathway, and avoid the non-specific killing of normal cells by traditional chemotherapy drugs. RNA drugs can improve the tumor tissue enrichment degree through a delivery system (such as lipid nanoparticles), and significantly reduce the off-target effect. Brief Description of the Drawings

[0009] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required for the description of the embodiments or the prior art. Obviously, the accompanying drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can also be obtained based on the provided drawings.

[0010] Figure 1 Thought for the construction of shRNA vector; Figure 1 a is the HindIII restriction site; Figure 1 b is the BamHI restriction site; Figure 1 c is the target miRNA fragment ligated to the vector; Figure 1 d is the target shRNA expressed in the cell; Figure 2 qRT-PCR experiment of PANC-1 cells transfected with different miRNAs; Figure 2 a and Figure 2 b are the experimental results of the same group; Figure 3 Absorbance at 450 nm of PANC-1 cells before and after transfection; Figure 3 a is the standard curve of absorbance at 450 nm of PANC-1 cells at different concentrations; Figure 3 b is the cell proliferation of PANC-1 cells transfected with mimics0000, mimics0001 and mimics0002; Figure 4 Tumor volume change and tumor inhibition rate of each group of nude mice; Figure 4 a is the tumor volume change of each group of nude mice within two weeks; Figure 4 b is the tumor inhibition rate of each group of nude mice. Specific implementation mode

[0011] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0012] Example 1 In previous studies, a total of 168 milRNAs present in Ganoderma lucidum were identified by high-throughput sequencing in the present invention. The present invention used four existing prediction websites (MiRanda, RNAhybrid, PITA, and Targetscan) to conduct preliminary prediction analysis on these 168 miRNAs. After taking the intersection of the results of the above four websites for summarization, 48 miRNAs were preliminarily screened out.

[0013] Subsequently, the present invention selected 25 miRNAs with the highest credibility in the prediction results for experimental screening, and further verified the activity targeting the KRAS gene through qRT-PCR experiments.

[0014] Vector construction Design PCR primers Short hairpin RNA (shRNA) is a short double-stranded RNA structure generated by relying on a stem-loop sequence. In fact, it is a way to obtain siRNA in vivo through vector construction, and it can also regulate target genes through the RNAi pathway. According to the corresponding basic sequence design requirements and principles of shRNA technology, the sequence of the miRNA fragment ligated to the vector was designed. When constructing the vector, the original vector was double-digested at the two endonuclease sites of BamHI and HindIII. Taking the sequence of miR007 as an example, the idea of vector construction is shown in Figure 1 ( Figure 1 a is the HindIII cleavage site; Figure 1 b is the BamHI cleavage site; Figure 1 c is the target miRNA fragment ligated to the vector. When designing PCR primers, corresponding cleavage sites were designed at both ends of the target sequence to facilitate the subsequent ligation of the target fragment and the vector; Figure 1 d is the target shRNA expressed in cells, where CTCGAG forms a stem-loop structure, and the two complementary miRNA sequences form a double strand. In cells, shRNA will be further processed into siRNA to play a role).

[0015] Anneal to form double strand The synthetic shRNA oligonucleotide single strands were annealed to form double strands according to the following system.

[0016] Table 1: PCR system

[0017] Annealing conditions: Water bath at 98°C for 15 min, cool naturally at room temperature, and store at 4°C.

[0018] Obtain linearized vector The vector pSilencer-U6-Puro was double digested with two enzymes, BamHI and HindIII, to obtain a linearized vector. The enzyme digestion reaction system is as follows.

[0019] Table 2: Enzyme digestion system

[0020] At 37 °C for 4 h, the target vector was recovered by 1% agarose electrophoresis.

[0021] Ligation The linearized vector in 3.3.1.3 and the annealed product (target fragment) obtained in 3.3.1.2 were ligated with T4 ligase. The ligation system is as follows.

[0022] Table 3: Ligation system

[0023] After the above system was mixed evenly on ice, it was ligated at 37 °C for 1.5 h.

[0024] Transformation Thaw E. coli DH5α competent cells on ice. Take 10 μL of the enzyme digestion and ligation product and add it to 100 μL of competent cells. Gently flick the tube wall several times to mix evenly and place it on ice for 30 min. Heat shock at 42 °C for 90 s and then ice bath for 3 min. Add about 500 μL of antibiotic-free LB medium, incubate at 37 °C and 200 rpm for 30 min. Centrifuge briefly, discard the supernatant, resuspend the cells with 500 μL of fresh LB medium, then pipette 100 μL of the bacterial solution and spread it evenly on the resistant plate, and incubate it upside down at 37 °C overnight. Pick 5 monoclonal colonies for colony PCR verification, and select positive clones to extract plasmids for sequencing.

[0025] In this invention, 25 miRNA vector plasmids were successfully constructed. After plasmid amplification, endotoxin removal was carried out, and then they were transfected into PANC-1 human pancreatic cancer cells. After incubation for 36 h, total cellular RNA was extracted, reverse transcribed into cDNA, and finally qRT-PCR experiments were performed. The results showed that after miR-108 and miR-049 were transfected into PANC-1 cells, the expression of the KRAS gene could be downregulated, and the remaining 23 miRNAs all showed an upregulating effect (see Figure 2 , Figure 2 the data above and below are from the same group).

[0026] The nucleotide sequence (24 bp) of the said miR-108 is shown in SEQ ID No.1: gaaggacgcgaagauggaggcgca; The nucleotide sequence of miR-049 (22 bp) is shown in SEQ ID No. 2: ucaggacccucaggacccucag.

[0027] The present invention verifies the efficacy of the screened miR-108 and miR-049.

[0028] CCK-8 cell proliferation assay Create a standard curve of absorbance at 450nm for different cell numbers The PANC-1 cell line was used and cell counts were performed after passage until it was stable. Cells were plated in a 96-well plate and 6 concentrations were set, namely 3*10 3 , 5*10 3 , 1*10 4 , 4*10 4 , 6*10 4 ,8*10 4 After preparing the cell suspension of each concentration, inoculate 100μL per well in a 96-well plate, with 6 parallel wells for each concentration. After inoculating the cells, put them in a cell culture incubator and culture for 4h (to allow the cells to adhere to the wall) before taking them out. 10μL of CCK-8 needs to be added to each well. In order to ensure the uniformity of adding CCK-8, mix the culture medium first and then add it uniformly. First discard the cell culture medium in the 96-well plate, then wash it with PBS and discard it. Then, add 5 mL DMEM basal culture medium + 500μL CCK-8, mix well, add 110μL to each well, then put it in a cell culture incubator and incubate for 45 min, then take it out and measure the absorbance at 450 nm with an enzyme marker.

[0029] First, the cells were plated, and the initial concentration of the cells was about 8,000 cells per well. Five 96-well plates were plated in parallel. After plating, the plates needed to be placed in an incubator overnight to allow the cells to fully adhere to the wall. Grouping: Group a was transfected with mimics0001, group b was transfected with mimics0002, and group c was transfected with mimics0000.

[0030] Prepare transfection complexes: 1) Place the transfection reagent GP at room temperature and shake gently before use; 2) 2 mL basal medium + 200 μL GP, mix well, and let stand for 5 min; 3) 350 μL basal medium + 35 μL mimics (20 uM), mix well, and let stand for 5 min; 4) Take 385 μL of 2) and add dropwise to 3), mix well, and let stand for 20 min.

[0031] While the cells are static, change the cell medium. First, wash the cells once with PBS, and then add 80 μL of basal medium. After standing, perform transfection. Add the transfection complex to a 96-well plate, 22 μL per well, with 6 parallel wells for each group. After transfection, place the plate in an incubator. After 6 h, change to the medium supplemented with serum. Subsequently, at five time points of 0 h, 24 h, 48 h, 72 h, and 96 h after transfection, measure CCK-8 once at each time point according to the method described in 4.3.1.1.

[0032] The results showed that in the CCK-8 cell proliferation assay, the cells were transfected with mimics 108, mimics 049, and mimics NC, respectively. The results showed that mimics 108 and mimics 049 inhibited the proliferation of PANC-1 cells (see Figure 3 , Figure 3 a indicates that the absorbance at 450 nm increased with the increase in the number of cells. The linear regression equation was y = 0.03539x + 0.1183, and r 2 = 0.9992, indicating a good linear relationship within the range of 3×10 3 - 8×10 4 ; Figure 3 b shows the cell proliferation of PANC-1 cells transfected with mimics0000, mimics0001, and mimics0002).

[0033] Subcutaneous tumorigenesis experiment in nude mice The principle of the subcutaneous tumorigenesis experiment in nude mice is based on the malignant proliferation characteristics of tumor cells. By injecting a suspension of tumor cells subcutaneously into nude mice, the growth process of tumors in the human body can be simulated. First, select healthy and disease-free nude mice, 6 weeks old, with a body weight between 20 - 25 g, and acclimatize them in an SPF environment for 1 week in advance. First, prepare PANC-1 human pancreatic cancer cells in the logarithmic growth phase with a cell density of about 80 - 90%. Replace the fresh medium the night before collecting the cells. Digest the cells with trypsin, add complete medium to terminate the digestion, then centrifuge, and subsequently add PBS to make a cell suspension. Resuspend the cells with PBS to a final concentration of 3.2×10^7 cells / mL. Place the cells on ice for later use. Subsequently, add high-concentration Matrigel at a volume ratio of 1:1, mix well, and keep the whole process on ice. Finally, inject each nude mouse subcutaneously in the abdomen, 200 μL per nude mouse, and a total of 60 nude mice are modeled. Observe the tumorigenesis of the nude mice. When the tumor volume of most nude mice grows to 60 - 100 mm 3 , start administering the drug.

[0034] The results showed that in the in vivo tumorigenesis experiment in nude mice, 14 days after administration, the tumor volumes of the mimics 108 group, mimics 049 group, and gemcitabine group were significantly smaller than those of the mimics NC group and normal saline group (see Figure 4 a).

[0035] Experiment on the inhibitory effect of mimics0001 and mimics0002 on pancreatic cancer tumors After tumorigenesis in nude mice, grouping was carried out first. Nude mice with relatively uniform tumor formation were selected for random grouping and administration. Here, it was divided into 5 groups, namely mimics0001, mimics0002, mimics0000, gemcitabine group, and normal saline group. There were 6 mice in each group. The three groups of Mimics0001, mimics0002, and mimics0000 were given intratumoral injection, with each nude mouse injected with 1 OD each time, configured into 50 μL, and injected once every 3 days. The gemcitabine group was given intraperitoneal injection at a dose of 50 mg / kg, and administered twice a week. The nude mice in the normal saline group were given normal saline according to the administration method and frequency of mimics for a total of two weeks. The body weight and tumor volume data of the nude mice were collected every day within two weeks. After two weeks, the nude mice were dissected, and the organs were taken for weighing. Subsequently, the organ index was statistically analyzed, and finally all nude mice were sacrificed. The calculation formula for tumor volume is (a*b 2 ), where a represents the length of the tumor and b represents the width of the tumor. The calculation formula for the organ index is organ weight / corresponding nude mouse body weight. Finally, the tumor inhibition rate was calculated, and the formula is (average tumor volume of the normal saline group on the 14th day - tumor volume of the experimental group on the 14th day) / average tumor volume of the normal saline group on the 14th day.

[0036] The results showed that the tumor inhibition rate of the mimics NC group was 29.94%, while the tumor inhibition rates of the mimics 108 group, mimics 049 group, and gemcitabine group were 87.90%, 81.69%, and 80.99% respectively, and there were significant statistical differences compared with the mimics NC group (P<0.01). It shows that mimics 108 and mimics 049 play an obvious role in inhibiting pancreatic cancer tumors (see Figure 4 b).

[0037] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. miRNA, characterized in that, The miRNA is miR-108 or miR-049; The nucleotide sequence of the miR-108 is shown as SEQ ID No.1; The nucleotide sequence of the miR-049 is shown as SEQ ID No.

2.

2. A recombinant vector containing the coding gene of the miRNA described in claim 1, characterized in that, The miRNA is miR-108 or miR-049.

3. Use of the miRNA according to claim 1 or the recombinant vector according to claim 2 in the preparation of a medicament for treating human pancreatic cancer.

Images