Sinorhizobium sp. Y18, fungicide, coating agent and application of sinorhizobium sp. Y18

By screening and applying the Y18 strain of Rhizobia in China, the problem of insufficient application of rhizobia agents in soybean production areas in Huanghuai and Haiti was solved, and the number and growth of soybean nodules were significantly improved, achieving the effect of reducing the use of chemical fertilizers and increasing yield.

CN120330104AActive Publication Date: 2025-07-18SANYA INST OF HENAN UNIV

Patent Information

Application Number
CN202510703875.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-07-18
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

The existing rhizobia agents are low in soybean production areas in Huanghuai and Haiti. This is mainly due to the lack of efficient fast-growing rhizobia strains, which lead to problems such as soil crumbing, nitrogen fertilizer loss and water eutrophication, which hinder the sustainable development of agriculture.

Method used

The Y18 strain of Rhizobacterium Chinese was screened and isolated, with broad-spectrum nodding characteristics and high nitrogen fixation ability. The bacterial agent was prepared through fermentation and culture and used for soybean seed coating to promote symbiotic nitrogen fixation between soybeans and rhizobacterium.

Benefits of technology

Significantly increase the number and growth of soybean nodules, reduce the use of chemical fertilizers, and achieve the effect of increasing soybean production and weight loss, which has good practical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330104A_ABST
    Figure CN120330104A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of agriculture, and relates to microorganisms, in particular to a sinorhizobium sp. Y18, a fungicide, a coating agent and application of the sinorhizobium sp. Y18. The strain is preserved in Guangdong Microbial Culture Collection Center on April 7, 2025, the preservation number is GDMCC No: 66071, and the preservation address is Institute of Microbiology, Guangdong Academy of Sciences, 5, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City. The strain has a broad-spectrum nodulation characteristic and an effect of effectively promoting nodulation and growth of soybeans, so that the strain has a good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture, relates to microorganisms, and particularly refers to soybean rhizobia. Background Art

[0002] In contemporary agricultural production, nitrogen fertilizer is one of the most important production materials. The production of nitrogen fertilizer will release a large amount of greenhouse gases, exacerbating the phenomenon of global warming. In addition, the excessive application of nitrogen fertilizer leads to an increase in soil compaction, making the soil lose its original air permeability and water permeability, thus affecting the growth and development of crops. At the same time, a large amount of nitrogen fertilizer flowing into water bodies will cause eutrophication of water bodies, leading to a large number of algae blooms and ultimately destroying the balance of the water ecosystem. The existence of these problems seriously hinders the sustainable development of agriculture.

[0003] Soybean is an important crop in China that can be used as food, oil, and feed. It can symbiotically form root nodules with rhizobia in the soil, converting nitrogen in the air into ammonia. Its global annual nitrogen production reaches 16.44 million tons, ranking first in the leguminous plant symbiotic nitrogen fixation system in the agricultural ecosystem. The nitrogen fixed by the symbiosis of soybean and rhizobia can not only meet the growth needs of itself, but also be absorbed and utilized by the next crop, occupying an irreplaceable important position in green agriculture, ecological agriculture, and the sustainable development of agriculture. Currently, the main soybean-producing countries are the United States, Canada, Argentina, Brazil, and China. Among them, in the first four countries, most soybean plantings are inoculated with microbial inoculants mainly based on rhizobia to replace most of the chemical nitrogen fertilizers. Among them, more than 50% of the soybean planting areas in the United States are inoculated with rhizobia, and the effect is equivalent to reducing the application of chemical nitrogen fertilizer by 6.19 million tons per year. In Brazil, the utilization rate of soybean rhizobia is close to 100%, and the application of nitrogen fertilizer can be reduced by about $2.5 billion per year on average. However, the inoculation rate of soybean rhizobia inoculants in China is less than 3%, and it is mainly concentrated in the Northeast. In recent years, China has also paid more and more attention to the application of rhizobia inoculants. Promoting soybean rhizobia inoculants is regarded as one of the main technologies for expanding soybean oilseeds and reducing chemical fertilizers while increasing efficiency. A national seminar on the promotion and application of soybean rhizobia inoculants was specially organized, and relevant promotion and application work was arranged and deployed. However, most of the rhizobia registered in China at present are slow-growing rhizobia. In the alkaline soil of the soybean production area in the Huang-Huai-Hai region, fast-growing rhizobia are the main effective rhizobia. However, the existing rhizobia inoculants still lack highly efficient fast-growing rhizobia strains, which is also the main reason for the low application level of rhizobia in the local area, restricting the development of China's soybean industry. In order to give full play to the symbiotic nitrogen fixation effect of soybean-rhizobia, it is necessary to screen out broad-spectrum rhizobia strains with strong nodulation performance and excellent nitrogen fixation performance. Summary of the Invention

[0004] To solve the above technical problems, the present invention provides a Sinorhizobium sp. Y18, an inoculant, a coating agent, and their applications.

[0005] The technical solution of the present invention is realized as follows: The present invention separates, purifies and screens soybean nodules from the main soybean producing areas of Huanghuaihai in my country, and identifies them as Sinorhizobium through 16srDNA sequence, which is classified as Sinorhizobium sp. , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 7, 2025, with the deposit number GDMCC No: 66071. The deposit address is Building 59, No. 100, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

[0006] The isolated rhizobium Y18 strain forms round or approximately round, sticky, smooth, moist milky white colonies on the HM medium.

[0007] The invention provides a Sinorhizobium with broad-spectrum nodulation characteristics and its application in soybean planting.

[0008] Furthermore, the present invention provides a method for culturing the above-mentioned Sinorhizobium Y18, which comprises inoculating the Sinorhizobium Y18 into a fermentation medium for culturing.

[0009] Furthermore, the present invention provides a liquid bacterial agent, which includes the bacterial liquid obtained after fermentation and culture of the above-mentioned Sinorhizobium Y18.

[0010] Furthermore, the present invention provides a soybean rhizobium agent for soybean seed coating, wherein the preparation method of the soybean rhizobium agent comprises the Sinorhizobium Y18, fermentation medium and adhesive described in the above technical scheme, and the number of viable bacteria of Sinorhizobium Y18 in the soybean rhizobium agent is not less than 2×10 9 CFU / ml. The adhesive is 0.5%-2% arabinose solution.

[0011] Furthermore, under greenhouse or field conditions, inoculating the above-mentioned Sinorhizobium Y18 and soybean rhizobium agents into multiple soybean varieties can significantly increase soybean nodulation and promote soybean growth.

[0012] The present invention has the following beneficial effects: The present invention separates and screens the nodulation rhizobium strain from the soybean producing areas of Huanghuaihai. The strain has the characteristics of broad spectrum of nodulation, high nodulation rate and strong nitrogen fixation ability, and provides a new microbial resource for soybean planting in the soybean producing areas of Huanghuaihai. The soybean rhizobium agent can significantly increase the number of soybean nodules, above-ground and underground biomass under greenhouse potted conditions; in field experiments in the soybean producing areas of Huanghuaihai, the strain can effectively promote the number of nodules, plant growth and yield of the main soybean varieties in Huanghuaihai, achieving the purpose of promoting soybean production and weight loss, and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the description of the embodiments or the prior art. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0014] Figure 1 It is the colony morphology diagram of Sinorhizobium sp. Y18 in different pH and salt concentration media in Example 1 of the present invention.

[0015] Figure 2 It is the effect diagram of re-inoculating Sinorhizobium sp. Y18 and other candidate strains in Example 1 of the present invention.

[0016] Figure 3 It is the phylogenetic tree of 16S rDNA sequence analysis of Sinorhizobium sp. Y18 in Example 1 of the present invention.

[0017] Figure 4 It is the influence of inoculating Sinorhizobium sp. Y18 and the control strain Sinorhizobium sp. SMH12 on symbiotic nitrogen fixation and growth of soybeans in greenhouse pot experiments in Example 2 of the present invention.

[0018] Figure 5 It is the influence of inoculating Sinorhizobium sp. Y18 on symbiotic nitrogen fixation and growth of soybeans at the full-bloom stage in field experiments in Example 3 of the present invention.

[0019] Figure 6 It is the influence of inoculating Sinorhizobium sp. Y18 on the yield of soybeans in field experiments in Example 3 of the present invention.

[0020] Figure 7 It is the effect diagram of the influence of inoculating Sinorhizobium sp. Y18 on the yield of soybeans in field experiments in Example 3 of the present invention. Detailed implementation manners

[0021] The following will clearly and completely describe the technical solutions of the present invention in combination with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0022] Unless otherwise specified, the test methods used in the following experimental examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.

[0023] The used formula is as follows: HM medium formula: Na2HPO4 0.125 g / L, Na2SO4 0.125 g / L, NH4Cl 0.125 g / L, MgSO4·7H2O 0.18 g / L, yeast extract 0.25 g / L, D - Arbinose 1 g / L, Sodium Gluconate 1 g, FeCl3 0.004 g, CaCl2 0.013 g, HEPES 1.30 g, MES 1.30 g, adjust the pH to 6.6 - 7.0 with NaOH.

[0024] Low - nitrogen Hoagland's nutrient solution formula: Na2HPO4·12H2O 300.00 mg / L, KH2PO4 100 mg / L, MgSO4·7H2O 120 mg / L, EDTAFe·Na2 9.36 mg / L, KNO3 202 mg / L, KCl 111.68 mg / L, CaCl2 75.50 mg / L, MnSO4·H2O 1.540 mg / L, H3BO3 2.860 mg / L, ZnSO4·7H2O 0.220 mg / L, CuSO4·5H2O 0.080 mg / L, Na2MoO4·2H2O 0.130 mg / L.

[0025] Example 1: Sinorhizobium Sinorhizobium Isolation and identification of Y18 Take the soil from the 0 - 10 cm soil layer from the surface to underground of a soybean planting field in Pingyuan New Area, Xinxiang City, Henan Province in the Huang - Huai - Hai soybean production area and put it into a sterile sealed bag, then immediately bring it back to the laboratory. Select 10 soybean strains from soybeans in the Huang - Huai - Hai region, northern region, and Yangtze River Basin. Take moderately sized and structurally complete soybean seeds from each strain, sterilize them with chlorine gas, and plant them in a sterile plug tray containing 500 g of the retrieved soil sample. Subsequently, regularly pour sterile water to keep the soil moist.

[0026] After the soybean plants enter the flowering stage, wash out all the roots with sterile water, and use sterile forceps to peel off the root nodules. Treat them with 3.5% sodium hypochlorite solution for 5 min, 75% ethanol for 4 min, and wash with sterile water 3 - 5 times. In the laminar flow hood, use a sterile grinding rod to grind the root nodules into root nodule slurry, dip a sterile inoculation needle into the root nodule slurry and streak it on the HM medium, then incubate at 28°C until colonies appear.

[0027] Pick all the single colonies that have grown and streak - purify them 3 times on a new HM medium respectively, then transfer them to an HM medium containing 0.01% bromothymol blue (BTB), invert and incubate at 28°C for 5 days. The strains that turn the medium yellow are regarded as candidate fast - growing rhizobia ( Figure 1 ) Through the soybean re - inoculation experiment, a highly efficient nodulating rhizobium was screened and named Y18 (Figure 2 ).

[0028] The 16S rRNA gene was amplified using the bacterial universal primers 27F and 1429R. The total volume of the PCR reaction system was 50 μL, with 2 μL of the Y18 bacterial solution as the template, 25 μL of KAPA HiFi HotStart ReadyMix, 4 μL of 10 μM primers (2 μL for each of primers 27F and 1429R), and ddH2O (sterile deionized water) was added to make up to 50 μL. The reaction conditions were pre-denaturation at 95°C for 3 min: denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 1 min 30 s, with 30 cycles of amplification; compensatory extension at 72°C for 5 min. After the amplified products were detected by agarose gel electrophoresis, the amplified products were sequenced bidirectionally and assembled by Beijing Tsingke Biotechnology Co., Ltd., and the obtained sequence was the 16S rRNA gene sequence SEQ ID No.1 of Y18.

[0029] The universal primers are as follows: 27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT; The 16S rRNA gene sequence of Y18 was BLAST-aligned in the National Center for Biotechnology Information (NCBI) in the United States. Thirteen reference strain sequences were selected, and MEGA11 was used to analyze the 16S rRNA sequences of strain Y18 and the reference strains, and a phylogenetic tree of strain Y18 and the reference strains was constructed ( Figure 3 ), and it was found through analysis that strain Y18 was Rhizobium sinense Sinorhizobium sp. , and it was preserved.

[0030] The taxonomic name of the Rhizobium sinense strain is Sinorhizobium. , the preservation number is GDMCC No: 66071, the preservation time is April 7, 2025, and the preservation unit is the Guangdong Provincial Microbial Culture Collection Center.

[0031] Observed on HM medium Sinorhizobium sp. The colony characteristics of Y18 were viscous, smooth surface, moist, and milky white colonies with neat edges.

[0032] To detect its survival ability in alkaline soil, solid media with different pH values (7 - 11) and solid media with different NaCl concentrations (0% - 4%) were prepared. The same concentration of bacterial solution was inoculated on the solid media, and the growth of colonies on the plates was observed after 48 h.

[0033] The results showed that strain Y18 could still grow well on the plate with pH 10 and still grow well at a NaCl concentration of 4%.

[0034] Example 2: Greenhouse pot experiment 1. Preparation of liquid inoculant: Take the strains preserved in the cryotubes at -80°C. Use a sterile inoculation loop to pick up a small amount of bacterial liquid and then inoculate it on the HM solid medium for streaking and activation. Grow it in a biochemical incubator at 25°C for 48 h until obvious colonies appear. Further, pick a single colony from the plate and inoculate it into a triangular flask containing 50 mL of HM liquid medium. Place the triangular flask on a shaker at 28°C with a rotation speed of 200 rpm / min and shake culture for 48 hours. Measure the OD600 of the bacterial liquid and adjust it to OD600 = 0.3 to obtain the liquid inoculant for the greenhouse pot experiment.

[0035] 2. Sterilization treatment Materials such as vermiculite, plug trays, and beakers required for the experiment were sterilized by high temperature and high pressure at 121°C for 30 min. The soybean seeds used in this experiment were all sterilized with chlorine gas. The specific operation is as follows: Spread the soybean seeds evenly in a petri dish, place it in a glass desiccator, quickly add 100 mL of sodium hypochlorite solution and 4.2 mL of concentrated hydrochloric acid to the beaker in sequence, then close the glass desiccator and sterilize for 12 h; after the sterilization is completed, place the petri dish with the spread soybean seeds in the laminar flow hood and blow it for more than 2 h, then close the petri dish for standby.

[0036] 3. Inoculation of inoculant Five soybean varieties (Williams 82, Zhonghuang 13, Jidou 12, Jidou 17, Qihuang 34) were selected in this experiment. Take an appropriate amount of soybean seeds of the above varieties for chlorine gas sterilization, and sow them evenly on the surface of the sterilized vermiculite at a planting density of 2 seeds per square centimeter. Then cover it with sterilized vermiculite with a thickness of about 1 cm; add 2 liters of low-nitrogen Hoagland's nutrient solution to the sterilized vermiculite until the vermiculite is fully swollen.

[0037] Cultivate the soybeans in this experiment in a greenhouse (temperature: 25°C, photoperiod: day / night = 14 h / 10 h). When the soybeans grow to 4 days old, suck 8 mL of the prepared inoculant and add it around the soybean roots along the root-stem junction. At the same time, set a blank control (CK) that only adds sterilized ddH2O, and inoculate the fast-growing rhizobia Sinorhizobium fredii SMH12 was used as the control strain treatment. Each treatment was set with 12 replicates. When the soybeans grew to 25 days old, phenotypic indexes such as the number of soybean nodules, single nodule weight, nitrogenase activity, aboveground dry weight, and underground dry weight were investigated.

[0038] There was no nodulation phenomenon in the blank control (CK). Figure 4The results showed that under sterilized vermiculite pot conditions, the control strain SMH12 could form nodules with 5 soybean varieties, among which the maximum number of nodules with Jidou 12 and Jidou 17 was 52 on average, and the average number of nodules with 5 varieties was 46. Compared with SMH12, Y18 could also form nodules with 5 soybean varieties, among which the maximum number of nodules with Qihuang 34 was 194, and the average number of nodules with 5 soybean varieties was 147, which was significantly better than the control strain SMH12. In addition, the phenotypes of single nodule weight and single plant enzyme activity were investigated. The average single nodule weight of Y18 with 5 soybean varieties was 14.02 mg, and the single plant enzyme activity was 4.01 μmol / h, which was significantly better than the control strain SMH12. This shows that Y18 rhizobium has a broad-spectrum nodulation characteristic and high nitrogen fixation efficiency, and has better application prospects.

[0039] Example 3: Field inoculation experiment 1. Preparation of adhesive: Weigh 20 g of gum arabic and slowly add it into 1 L of water, and stir again to prepare 2% gum arabic adhesive for later use.

[0040] 2. Preparation of field microbial agent: Take the strains stored in -80℃ cryopreservation tubes, use a sterile inoculation loop to pick up a small amount of bacterial solution, and then inoculate it on HM solid culture medium for streaking activation, and grow in a biochemical incubator at 25℃ for 48 hours until obvious colonies grow. Further, pick a single colony from the plate and inoculate it into a triangular flask containing 50 mL HM liquid culture medium, place the triangular flask in a 28℃ shaker at a speed of 200 rpm / min, shake and culture for 18 hours, take 10 ml of culture solution and inoculate it into 1 liter of HM liquid culture medium at a ratio of 1:100, expand the culture to the logarithmic phase to obtain Y18 bacterial fermentation liquid, and measure the culture liquid OD600 to be 1.0. The fermentation liquid is fully mixed with 2% adhesive at a volume ratio of 1:1 to prepare a seed coating agent.

[0041] 3. Field experiment: This experiment was conducted at the biological breeding base of Henan University in Yuanyang County, Xinxiang City, Henan Province. The local soil is tidal soil with basic physical and chemical properties: pH 7.94, organic matter content 2.42%, total nitrogen content 0.6 mg / g, alkaline nitrogen content 108.6 mg / kg, total phosphorus content 0.7 mg / g, available phosphorus 9.7 mg / kg, and medium soil fertility.

[0042] This experiment set up three fertilization levels: ①. No fertilization. ②. Full fertilization: 25 kg of 15-15-15% (NPK) compound fertilizer per mu. ③. Half fertilization: 12.5 kg of 15-15-15% (NPK) compound fertilizer per mu. Fertilizers were applied in a uniform standard as base fertilizer. Soybean seeds were treated with or without rhizobium agent coating at two fertilization levels 1 and 2.

[0043] This experiment was set up with 3 replications in plot trials. The mainstream soybean varieties in the Huang-Huai-Hai region (Zhonghuang 13, Jidou 12, Jidou 17, Qihuang 34) were selected. In each plot, manual line sowing was adopted, with 2 seeds per hole, and the row and plant spacing configuration was (40 cm × 13 cm); thinning was carried out at the seedling stage, with 1 plant per hole; if there was a seedling shortage, one adjacent hole to the seedling-deficient hole was kept with 2 plants. The field management of all plots was the same, and measures such as fertilization, sowing, intertillage, and weeding were completed within one day. During this period, drip irrigation was used for watering.

[0044] 4. Field phenotypic investigation: Field investigations were carried out at the full flowering stage and the mature harvest stage of soybeans to examine phenotypes such as the number of nodules, plant height, above-ground biomass, below-ground biomass, and yield per plant of soybeans.

[0045] Field phenotypes were investigated at the full flowering stage by Figure 5 It can be seen that under the treatments of no fertilization and half fertilization, the number of nodules of the 4 soybean varieties inoculated with Y18 was significantly more than that of the non-inoculated treatment of the same variety. The average number of nodules of the 4 soybean varieties inoculated with Y18 was 46, and the average number of nodules of the non-inoculated treatment was 23, an increase of 1 fold. The above-ground fresh weight per plant of the 4 soybean varieties inoculated with Y18 was higher than that of the non-inoculated treatment. Among them, under the condition of no fertilization, the above-ground fresh weight of Zhonghuang 13, Jidou 12, and Jidou 17 increased significantly compared with the control after inoculation with Y18. Under the condition of half fertilization, Jidou 12 and Qihuang 34 showed that the above-ground fresh weight after inoculation with Y18 was significantly higher than that of the non-inoculated treatment. As Figure 6 、 Figure 7 shown, the yield of soybeans was investigated at the mature harvest stage. Generally speaking, at the same fertilization level of no fertilization and half fertilization, inoculation with Y18 had a significant effect on the number of pods of soybeans compared with the non-inoculated treatment. Compared with the treatment of no fertilization and non-inoculation, inoculation with Y18 under no fertilization could significantly increase the number of pods, with an increase rate of 22.8%. In terms of yield, compared with the treatment of no fertilization and non-inoculation, inoculation with Y18 under no fertilization could significantly increase the yield per plant, with an increase rate of 35%; the yield per plant of inoculation with Y18 under the conditions of no fertilization and half fertilization still increased by 2.3% compared with the yield of full fertilization, indicating that inoculation with Y18 could achieve the effect of reducing fertilizer and increasing yield.

[0046] This experimental study shows that under the conditions of no fertilization and half fertilization, the rhizobium Y18 can symbiotically nodulate with the mainstream soybean varieties in the Huang-Huai-Hai region, and has an obvious yield-increasing effect on soybeans, and can be used for large-scale popularization and application.

[0047] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A strain of Sinorhizobium sp. Y18, whose taxonomic name is Sinorhizobium sp. , was deposited at the Guangdong Provincial Culture Collection of Microorganisms on April 7, 2025, with the deposit number GDMCC No: 66071, and the deposit address is Room 5, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

2. The cultivation method of Sinorhizobium sp. Y18 according to claim 1, characterized in that: Inoculate Sinorhizobium sp. Y18 onto the fermentation medium and culture it at 25°C - 28°C.

3. A bacterial agent containing Sinorhizobium sp. Y18 as claimed in claim 1.

4. The microbial agent according to claim 3, characterized in that: The viable count of the Sinorhizobium chinense Y18 is not less than 2×10 9 CFU / ml.

5. A seed coating agent, characterized in that: It contains Sinorhizobium sp. Y18 as claimed in claim 1.

6. The seed coating agent according to claim 5, wherein: It further contains an adhesive.

7. The seed coating agent according to claim 6, characterized in that: The adhesive is a 0.5% - 2% arabinose solution.

8. Use of Sinorhizobium chinense Y18 according to claim 1, or the microbial inoculum according to any one of claims 3-4, or the seed coating agent according to any one of claims 5-7, characterized in that, The application is selected from any one of the following: (1) Promote the growth of leguminous plants; (2) Promote nodulation of leguminous plants.

9. The application according to claim 8, characterized in that: The leguminous plant is fresh edible soybean or edamame.

10. The application according to claim 9, wherein: The growth soil of the leguminous plant is alkaline soil.

Citation Information

Patent Citations

  • Sinorhizobium SCAUs65 and application thereof

    CN104277994A

  • Sinorhizobium sp. and its application

    CN105349456A

  • Sinorhizobium nitrogen-fixing strain H6 and application thereof

    CN108841748A

  • Mutant of rhizobium japonicum SMH12 and application of mutant

    CN111286513A

  • Rhizobium japonicum and application thereof

    CN114480171A

Cited By

  • Compound microbial agent for promoting crop growth and improving soil and application thereof

    CN121065018A