Hypoxia tolerant natural killer cells

Abstract

According to the hypoxia-resistant natural killer cell, overexpression of SIRT3 is achieved in an NK cell, the adaptive capacity of the NK cell under the hypoxia condition can be enhanced by overexpressing the SIRT3 in the NK cell, inhibition of the hypoxia environment on the NK cell is reversed, and therefore the killing activity and / or metabolic capacity of the NK cell in the hypoxia environment are / is enhanced; and a new strategy is provided for the treatment of related tumors.

Description

Technical Field

[0001] This application belongs to the field of biomedical technology, and specifically relates to a hypoxia-tolerant natural killer cell. Background Art

[0002] Natural killer cells (NK) are innate immune cells and play a crucial role in tumor surveillance. Existing studies have shown that the impaired anti-tumor activity of NK cells is related to the hypoxic tumor microenvironment (TME) and tumor-derived metabolites therein. For example, the hypoxic microenvironment from tumors impairs the effector function of NK cells and promotes melanoma, pancreatic cancer, and colorectal liver metastases. In addition, the hypoxic TME alters the metabolism of NK cells within liver cancer tumors by inducing mitochondrial fragmentation of NK cells, thereby inhibiting their anti-tumor activity.

[0003] From the existing studies, it can be seen that natural killer cells (NK) play a crucial role in cancer immune surveillance. The hypoxic environment inhibits the metabolism and / or killing ability of NK cells, thereby inhibiting their anti-tumor activity. Therefore, it is very necessary to seek methods to regulate the adaptability of NK cells to the hypoxic environment, reverse the inhibition of NK cell killing by the hypoxic environment, and enhance the metabolism and / or killing ability of NK cells under the hypoxic environment. Summary of the Invention

[0004] In view of this, the primary object of this application is to provide a hypoxia-tolerant natural killer cell. By modifying NK cells and overexpressing SIRT3 in NK cells, the adaptability of NK cells to the hypoxic environment is enhanced, the inhibition of NK cells by the hypoxic environment is reversed, and the metabolism and / or killing ability of NK cells under the hypoxic environment is enhanced, providing a new strategy for the treatment of related tumors.

[0005] To achieve the above object, this application adopts the following technical solutions:

[0006] One aspect of this application discloses a hypoxia-tolerant natural killer cell, which is an NK cell overexpressing SIRT3.

[0007] Another aspect of this application discloses a method for preparing a hypoxia-tolerant natural killer cell, including the following steps:

[0008] Overexpress SIRT3 in NK cells to obtain hypoxia-tolerant natural killer cells.

[0009] Another aspect of this application discloses the use of the hypoxia-tolerant natural killer cell or the hypoxia-tolerant natural killer cell prepared by the method in the preparation of a drug for treating tumors.

[0010] Another aspect of the present application discloses a drug for treating tumors, comprising an effective amount of the hypoxia-tolerant natural killer cells described above or the hypoxia-tolerant natural killer cells prepared by the method described above.

[0011] Advantages of the present application:

[0012] In the present application, by modifying NK cells and overexpressing SIRT3 in NK cells, the adaptability of NK cells to the hypoxic environment is enhanced, the inhibition of NK cells by the hypoxic environment is reversed, and the metabolism and / or killing ability of NK cells in the hypoxic environment is enhanced, providing a new strategy for the treatment of tumors related to NK cell therapy. Description of the drawings

[0013] Figure 1 It is the WB effect diagram after overexpressing SIRT3 and SIRT1 in NK92MI cells in Example 1.

[0014] Figure 2 It is the flow cytometry experimental result of killing primary AML blasts after in vitro treatment of NK92MI cells in Example 1. Among them, Figure 2 a is Annexin V + Flow cytometry analysis diagram and statistical chart of the percentage of primary AML blasts, CD107a + NK cells and IFN-γ + Flow cytometry analysis diagram and statistical chart of the percentage of NK cells in the total NK92MI cells; Figure 2 b is the flow cytometry analysis diagram of the expression of Granzyme B on NK92MI cells; Figure 2 c is the statistical chart of the mean fluorescence intensity MFI of the expression of Granzyme B on NK92MI cells.

[0015] Figure 3 It is the flow cytometry experimental result of killing K562 blasts after in vitro treatment of NK92MI cells in Example 1. Among them, Figure 3 a is Annexin V + Flow cytometry analysis diagram and statistical chart of the percentage of K562 blasts, CD107a + NK cells and IFN-γ + Flow cytometry analysis diagram and statistical chart of the percentage of NK cells in the total NK92MI cells; Figure 3 b is the flow cytometry analysis diagram of the expression of Granzyme B on NK92MI cells; Figure 3 c is the statistical chart of the mean fluorescence intensity MFI of the expression of Granzyme B on NK92MI cells.

[0016] Figure 4Flow cytometry analysis and statistical graphs of the percentage of primary AML blasts after in vitro treatment of NK92MI cells with different experimental groups in Example 1, Annexin V + Flow cytometry analysis and statistical graphs of the percentage of primary AML blasts after in vitro treatment of NK92MI cells with different experimental groups in Example 1

[0017] Figure 5 Flow cytometry results of the killing function after in vitro treatment of bone marrow NK (BMNK) cells in Example 2. Among them, Figure 5 a is the flow cytometry analysis graph of the percentage of primary AML blasts and the expression of NKG2D, CD38, and CD160 on BMNK cells of AML relapse patients, Annexin V + Flow cytometry analysis graph of the percentage of primary AML blasts and the expression of NKG2D, CD38, and CD160 on BMNK cells of AML relapse patients Figure 5 b is the statistical graph of the percentage of primary AML blasts, Annexin V + Statistical graph of the percentage of primary AML blasts and the mean fluorescence intensity (MFI) statistical graph of the expression of NKG2D, CD38, and CD160 on BMNK cells of AML relapse patients Figure 5 c is CD107a + NK cells and Granzyme B + Statistical graph of the percentage of NK cells in total BMNK cells of AML relapse patients Figure 5 d is the flow cytometry analysis graph of the percentage of K562 cells, AnnexinV + Flow cytometry analysis graph of the percentage of K562 cells Figure 5 e is the flow cytometry analysis graph of the expression of NKG2D, CD38, and CD160 on BMNK cells of AML relapse patients Figure 5 f is the statistical graph of the percentage of K562 cells, Annexin V + Statistical graph of the percentage of K562 cells and the mean fluorescence intensity (MFI) statistical graph of the expression of NKG2D, CD38, and CD160 on BMNK cells of AML relapse patients Figure 5 g is CD107a + NK cells and Granzyme B + Statistical graph of the percentage of NK cells in total BMNK cells of AML relapse patients

[0018] Figure 6 Experimental results of studying the effect of SIRT3 overexpression on leukemia cells in a leukemia mouse xenograft model in Example 3. Among them, Figure 6 a is the schematic diagram of the experimental procedure Figure 6 b is the average value of the AML burden quantified as the total flux (p / s) and the Kaplan–Meier survival curve of HL60 tumor-bearing mice Figure 6 c is the bioluminescence imaging of the AML burden Detailed implementation methods

[0019] The embodiments of the present application will be clearly and completely described below. The technical solutions in the described embodiments are exemplary and only possible technical implementations of the present application, not all possible implementations. Those skilled in the art can fully combine the embodiments of the present application to obtain other embodiments without creative work, and these embodiments are also within the protection scope of the present application.

[0020] The first aspect of the present application discloses a hypoxia-resistant natural killer cell, which is an NK cell overexpressing SIRT3.

[0021] It can be understood that in the present application, SIRT3 can refer to the SIRT3 gene or the SIRT3 protein. The overexpression refers to an increase in the expression level or an enhancement of the expression activity of the SIRT3 gene or the SIRT3 protein.

[0022] SIRT3 (Surtuin-3, deacetylase 3) belongs to the sirtuin family. The sirtuin family includes a variety of deacetylases that rely on NAD + to catalyze reactions and are widely involved in regulating key life activities such as glycolipid metabolism, aging, and DNA repair. Among them, SIRT3 is mainly distributed in mitochondria in cells and participates in regulating mitochondrial functions and metabolic processes. SIRT3 is not only located in mitochondria but also in the nucleus. Existing studies have shown that full-length SIRT3 is a nuclear protein, but it translocates from the nucleus to mitochondria under cellular stress, SIRT3 overexpression, or co-expression of SIRT3 and SIRT5. It has now been confirmed that SIRT3 has deacetylation activity, fatty acylation activity, and demethylation activity, etc., but its role in immune cells has been rarely studied.

[0023] Hypoxia can inhibit the killing function of NK cells by disrupting mitochondria. And SIRT3 is mainly distributed in mitochondria in cells and participates in regulating mitochondrial functions and metabolic processes. The expression of SIRT3 is closely related to mitochondrial integrity and function, indicating that SIRT3 may play a key role in restoring the functions of NK cells inhibited by hypoxia. Based on this, the present application is proposed.

[0024] The present application verifies through a series of experiments that the expression of SIRT3 plays a key role in restoring the functions of NK cells inhibited by hypoxia. By overexpressing SIRT3 in NK cells, the inhibition of the killing activity and / or metabolic ability of NK cells under a hypoxic environment can be reversed, and the killing activity and metabolic ability of NK cells under hypoxic conditions can be enhanced. Thus, a new solution is provided for NK cell-based immunotherapy.

[0025] In the present application, there are no special requirements for the NK cells, which are of types well-known in the art and can be derived from peripheral blood cells, umbilical cord blood cells, induced pluripotent stem cells or NK cell lines. In some examples, the NK cells are derived from an NK cell line, and specific examples include but are not limited to at least one of NK92 cells, NK92MI cells, KHYG-1 cells, YT cells, CIML-NK cells, NKG cells, NKL cells, NK-YS cells, SNK-6 cells, IMC-1 cells, PB-NK cells, iPSC-NK cells, UCB-NK cells or CAR-NK cells. Preferably, the NK cells are NK92MI cells or CAR-NK cells.

[0026] In the present application, the hypoxia mentioned refers to an O2 concentration not exceeding 10%, preferably in the range of 0.1% to 10%; in some examples, the hypoxia refers to an O2 concentration of 5%.

[0027] The second aspect of the present application discloses a method for preparing hypoxia-tolerant natural killer cells, comprising the following steps:

[0028] Overexpress SIRT3 in NK cells to obtain hypoxia-tolerant natural killer cells.

[0029] In the present application, any well-known method in the art can be used to overexpress SIRT3 in NK cells, preferably gene regulation means. In some examples, the gene regulation means is lentiviral transfection.

[0030] Specifically, in some examples of the present application, the overexpression of SIRT3 is achieved by lentiviral transfection, including the following steps:

[0031] Based on a lentiviral expression vector, construct a lentiviral overexpression plasmid containing the target gene SIRT3;

[0032] Transfect the lentiviral overexpression plasmid into packaging cells to obtain a SIRT3 overexpression lentiviral supernatant;

[0033] Pretreat NK cells with the SIRT3 overexpression lentiviral supernatant, and then culture the NK cells in a cell culture medium supplemented with the SIRT3 overexpression lentiviral supernatant.

[0034] Among them, there are no specific limitations on the type of the lentiviral expression vector, and any conventional type in the art can be used. Specific examples include one of pLVX-IRES-Puro, pLKO.1, pLenti-CMV-GFP, pLVX-Puro, pCDH, but are not limited thereto. In some examples, the lentiviral expression vector used is pLVX-IRES-Puro.

[0035] There is no particular limitation on the method of constructing a lentiviral overexpression plasmid containing the target gene SIRT3. Using a lentiviral expression vector as the backbone vector, based on well-known methods such as PCR amplification in the art, the target gene SIRT3 is inserted into the lentiviral expression vector to obtain a lentiviral overexpression plasmid containing the target gene SIRT3.

[0036] Then, the SIRT3 overexpressing lentiviral supernatant is obtained by means of lentiviral packaging. Specifically, the lentiviral overexpression plasmid and the packaging plasmid are co-transfected into packaging cells, so that the target gene SIRT3 is stably expressed in the packaging cells, and the SIRT3 overexpressing lentiviral supernatant is obtained. Among them, the packaging plasmid and the packaging cells can both be of common types in the art. In some examples, the packaging plasmids are ps.pAX2 and pMD.2G, and the packaging cells are 293T. Among them, the ratio of the lentiviral overexpression plasmid to the packaging plasmid can be determined by experimental methods, so there is no particular limitation.

[0037] Finally, after the NK cells are pretreated in the SIRT3 overexpressing lentiviral supernatant for a period of time and then cultured in a cell culture medium containing the SIRT3 overexpressing lentiviral supernatant for a period of time, NK cells overexpressing SIRT3 can be obtained. It can be understood that there is no particular requirement for the cell culture medium, and any medium that can be used for culturing NK cells in the art can be used. Specific examples include RPMI 1640 medium, Alpha MEM medium, etc., but are not limited thereto. Among them, the dosage of the SIRT3 overexpressing lentiviral supernatant can be determined by experimental methods, as long as it can achieve an increase in the expression of SIRT3 in NK cells. In some examples, based on 2×10 6 NK cells, the addition amount of the SIRT3 overexpressing lentiviral supernatant is 1 mL - 3 mL, preferably 2 mL. The specific culture time can be determined according to actual needs or by experimental means. In some examples, the pretreatment time is 4 - 8 h, preferably 6 h; the culture time after pretreatment is 24 - 42 h, preferably 42 h. Through the overexpression method in the present application, the transfection efficiency of the plasmid in NK cells can be significantly improved, and a better transfection effect can be obtained.

[0038] The third aspect of the present application provides the use of the hypoxia-resistant natural killer cells in the preparation of a drug for treating tumors.

[0039] The fourth aspect of the present application discloses a drug for treating tumors, containing an effective amount of the hypoxia-resistant natural killer cells or the hypoxia-resistant natural killer cells prepared by the method.

[0040] In the present application, the drug has any one or more of the following effects:

[0041] a: Reverse the inhibition of the killing and / or metabolic ability of NK cells by the hypoxic environment;

[0042] b: Enhance the metabolic and / or killing ability of NK cells under hypoxic conditions;

[0043] c: Inhibit the growth of tumor cells;

[0044] d: Promote the apoptosis of tumor cells.

[0045] Specifically, overexpression of SIRT3 is used to reverse the inhibition of NK cells by the hypoxic environment, thereby enhancing the killing activity and / or metabolic ability of NK cells under hypoxic conditions, and thus increasing the degree of growth, apoptosis, and killing of tumor cells by NK cells under hypoxic conditions.

[0046] In the present application, the effective amount refers to the lowest dose or dose range of hypoxia-tolerant natural killer cells required to achieve a therapeutic effect, at which dose or dose range, it should be able to effectively reverse the inhibition of the killing and / or metabolic ability of NK cells by the hypoxic environment; or effectively enhance the metabolic and / or killing ability of NK cells under hypoxic conditions; or effectively inhibit the growth of tumor cells; or effectively promote the apoptosis of tumor cells.

[0047] In the present application, the tumor refers to various types of malignant and benign tumors that can be recognized by natural killer cells, preferably various hematological tumors and / or solid tumors with a hypoxic tumor microenvironment. Specific examples include, but are not limited to, lung cancer, breast cancer, colorectal cancer, liver cancer, brain cancer, bone cancer, esophageal cancer, gastric cancer, nasopharyngeal cancer, thyroid cancer, pancreatic cancer, endometrial cancer, ovarian cancer, cervical cancer, renal cell carcinoma, colorectal cancer, prostate cancer, bladder cancer, pancreatic cancer, glioblastoma, melanoma, leukemia, lymphoma, myeloma, etc. In some examples, the tumor is leukemia, especially acute myeloid leukemia.

[0048] It can be understood that the drug for treating tumors contains, in addition to hypoxia-tolerant natural killer cells, at least any one pharmaceutically acceptable excipient and / or carrier, and these excipients and / or carriers include, but are not limited to, at least one of diluents, binders, surfactants, adsorption carriers, lubricants, fillers, disintegrants.

[0049] Among them, in some specific examples of the present application, the diluent can be, for example, lactose, sodium chloride, glucose, urea, starch, water, etc., but is not limited thereto. The binder can be, for example, starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, ethylcellulose, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, alginic acid and alginates, xanthan gum, hydroxypropylcellulose, hydroxypropylmethylcellulose, etc., but is not limited thereto. The surfactant can be, for example: polyoxyethylene sorbitan fatty acid ester, sodium dodecyl sulfate, monoglyceride stearate, cetyl alcohol, etc., but is not limited thereto. The adsorption carrier can be, for example, starch, lactose, bentonite, silica gel, kaolin, saponite, etc. The lubricant can be, for example, zinc stearate, glycerol monostearate, polyethylene glycol, talc powder, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, sucrose monolaurate, sodium lauryl sulfate, magnesium lauryl sulfate, sodium dodecyl sulfate, etc., but is not limited thereto. The filler can be, for example, mannitol, xylitol, sorbitol, maltose, erythritol, microcrystalline cellulose, polymeric sugar, coupled sugar, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, sodium bicarbonate, etc., but is not limited thereto. The disintegrant can be, for example, cross-linked vinylpyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropylmethyl, cross-linked sodium carboxymethyl cellulose, soybean polysaccharide, etc.

[0050] In addition, in the present application, the excipient and / or carrier can also be at least one of a stabilizer, a buffer, an isotonic agent, a pH regulator or a chelating agent.

[0051] The selection of specific excipients and / or carriers can be carried out according to the dosage form of the drug. When specifically selecting, it should be adaptable to the active substance, or can effectively improve the stability and solubility of the active ingredient contained in the drug, or can change the release rate and absorption rate of the active substance, so as to ensure or enhance the administration effect of the active ingredient. In the present application, the dosage form of the drug is not particularly limited, and any dosage form known in the art that is beneficial to administration can be adopted, for example, it can be: aqueous solution injection, powder for injection, pill, powder, tablet, granule, capsule, etc. In some specific implementation cases of the present invention, the powder or injection is preferred. The so-called beneficial to administration herein means that it can improve the therapeutic effect, or improve the bioavailability, or reduce the toxic and side effects, or improve the patient's adaptability, etc.

[0052] Based on the hypoxia-tolerant natural killer cells in the present application, a treatment method based on NK cells can be provided, especially a treatment method of CAR-NK cells. That is, before transmitting CAR-NK cells into a tumor patient, the CAR-NK cells are pretreated by the gene regulation method described above to achieve overexpression of SIRT3 in the CAR-NK cells, and then the CAR-NK cells are transmitted into the tumor patient to improve the treatment effect of the tumor.

[0053] Generally speaking, the present application enhances the adaptation of NK cells to the hypoxic environment through overexpression of SIRT3 in NK cells, reverses the inhibition of NK cells by the hypoxic environment, improves the metabolism and killing ability of NK cells under hypoxic conditions, and thus can inhibit the growth of tumor cells and promote the apoptosis of tumor cells, ultimately exerting the effect of treating tumors.

[0054] The following are specific embodiments of the present application. It should be noted that the following specific embodiments are only for the purpose of illustration and do not limit the scope of the present application in any way.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0056] In addition, unless otherwise specified, the methods without specific conditions or steps recorded are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0057] Example 1 Overexpression of SIRT3 Enhances the Adaptability of NK92MI to the Hypoxic Environment and Improves the Killing Function of NK Cells

[0058] In this example, a plasmid with overexpression of SIRT3 was constructed through a lentiviral vector, and the supernatant of the lentivirus with overexpression of SIRT3 was obtained. The NK92MI cells were treated with the supernatant of the lentivirus with overexpression of SIRT3 to obtain NK cells with overexpression of SIRT3.

[0059] 1.1 Construction of the Plasmid with Overexpression of SIRT3

[0060] (1) Provide the lentiviral vector pLVX-IRES-Puro (P0249, Miaoling Company), and cut the lentiviral vector with the restriction enzymes XhoⅠ (FD0694, Thermo) and BamHⅠ (FD0054, Thermo). The double digestion system of the lentiviral vector is shown in the following table:

[0061]

[0062] Mix well according to the above double digestion system and digest overnight at 37°C. Recover the digested product using a kit (SanPrep Column PCR Product Purification Kit) and measure the concentration.

[0063] (2) Provide the pCMV-SIRT3(human)-3×HA-Neo plasmid (P70777, Miaoling Bio). Amplify the target SIRT3 fragment by PCR. The primer information designed is shown in the following table:

[0064] Primer Name Sequence Information Forward Primer CCGCTCGAGATGGCGTTCTGGGGTTGG Reverse Primer CGCGGATCCTCATTTGTCTGGTCCATCAAGC

[0065] The PCR reaction system is shown in the following table:

[0066]

[0067]

[0068] The PCR program is shown in the following table:

[0069]

[0070] Ligate the above SIRT3 fragment and the pLVX-IRES-Puro digested with the restriction enzyme using a complex enzyme (C112-01 / 02, Novoprotein) to construct the pLVX-SIRT3-IRES-Puro lentiviral overexpression vector, and prove successful construction by sequencing.

[0071] 1.2. Obtaining the supernatant of the SIRT3 overexpressing lentivirus

[0072] Inoculate 293T cells (Cellcook, SCSP-502) in the exponential growth phase into a 6-well plate and culture overnight until the cells grow to about 70%. Prepare sterile EP tubes and add 100 μL of Opti-MEM medium (Gibco, 31985070) to each EP tube. Mix the target plasmid (pLVX-SIRT3-IRES-Puro) and the two packaging plasmids ps.pAX2 (Addgene) and pMD.2G (Addgene) in a mass ratio of 4:3:1 in the above medium, and let it stand for 5 min. The specific transfection system is shown in the following table:

[0073]

[0074] Add PEI according to the mass ratio of the target plasmid to PEI (polyethyleneimine) of 1:4, vortex and mix well, and let it stand for 20 min. Slowly drop the mixture into the 293T cells, and culture the cells in a 5% CO2, 37°C incubator for 24 h.

[0075] Remove the 293T cell culture medium, add fresh complete DMEM medium (Hyclone, 11965092), and continue culturing for 24 h. Then collect the cell culture supernatant containing the virus. Centrifuge at 3000 rpm at 4 °C for 10 min to remove cell debris; filter the supernatant through a 0.45-μm filter; centrifuge the virus supernatant at high speed at 60000 g at 4 °C for 2 h, discard the supernatant, and resuspend the virus pellet with PBS. Store it at -80 °C in the refrigerator for later use.

[0076] In addition, in this example, an overexpression plasmid of SIRT1 was constructed, and the overexpression lentiviral supernatant of SIRT1 was obtained as one of the subsequent control experiments. Among them, the construction of the overexpression plasmid of SIRT1 and the obtaining of the overexpression lentiviral supernatant of SIRT1 both refer to the steps of SIRT3. Among them, the template plasmid used for the construction of the overexpression plasmid of SIRT1 is the pCMV-SIRT1 (human)-3×HA-Neo plasmid (P63391, Miaoling Bio), and the primers involved are shown in the following table:

[0077] Primer Name Sequence Information Forward Primer ATTTCCGGTGAATTCCTCGAATGGCGGACGAGGCG Reverse Primer GGAGGGAGAGGGGCGGGATCTCATGATTTGTTTGATGGATAGTTCATGTCTGTTACTT

[0078] 1.3 Detection of overexpression of SIRT3 in NK cells

[0079] Centrifuge NK92MI cells (100 g, Cellcook) for 5 min, remove the supernatant completely, and then treat them with the lentiviral supernatant (2 mL) for 48 h; at the same time, take NK cells not treated with the lentiviral supernatant as a control.

[0080] Use WB to detect the expression levels of SIRT3 / 1 in NK cells. The results are as Figure 1 shown. Compared with the control NK cells, the expression levels of SIRT3 / 1 in the NK cells treated with the overexpression lentiviral supernatant of SIRT3 / 1 are significantly increased, indicating that the NK cells with overexpression of SIRT3 / 1 were successfully constructed.

[0081] 1.4 Overexpression of SIRT3 enhances the adaptability of NK92MI to the hypoxic environment

[0082] 1.4.1 Experimental materials

[0083] The NK92MI cells verified by STR analysis were from Cellcook Biotech Co., Ltd. (Guangzhou, China). The cells were cultured in NK92MI complete medium, which was based on Alpha MEM medium (Cellcook, Cat: CM2003), and supplemented with 12.5% horse serum (Cellcook, Cat: CM1001), 12.5% fetal bovine serum (Gibco, Cat: 10099), 0.2 mM inositol, 0.1 mM mercaptoethanol and 0.02 mM folic acid. The cells were stored in a humidified incubator at 37 °C with 5% CO2.

[0084] The K562 cells were purchased from ShanghaiCellBank (Chinese Academy of Sciences, Shanghai, China).

[0085] Primary AML blasts were collected from the bone marrow of newly diagnosed AML patients. All human samples used were approved by the Ethics Committee of the First Affiliated Hospital of University of Science and Technology of China (2021-N(H)-120; Hefei, China), and written informed consent was obtained from all patients.

[0086] 1.4.2 Experimental methods

[0087] The NK92MI cells (2×10 6 cells / mL) were pretreated in the following 4 experimental groups:

[0088] (1) Control group (normoxia group): The NK92MI cells were cultured in NK92MI complete medium in an incubator at 37 °C, 5% CO2, 20% O2 for 48 h throughout the process.

[0089] (2) Hypoxia group: The NK92MI cells were cultured in NK92MI complete medium in a hypoxic incubator at 37 °C, 5% O2, 5% CO2 for 48 h throughout the process.

[0090] (3) Hypoxia + SIRT3 overexpression group: In a hypoxic incubator at 37 °C, 5% O2, 5% CO2, the NK92MI cells were first treated in the SIRT3 overexpression lentiviral supernatant (2 mL) for 6 h, and then supplemented with the same volume of NK92MI complete medium as the SIRT3 overexpression lentiviral supernatant and continued to be transfected for 48 h.

[0091] (4) Hypoxia + SIRT1 overexpression group: In a hypoxia incubator at 37°C, 5% O2, and 5% CO2, NK92MI cells were first treated in the supernatant of SIRT1 overexpression lentivirus (2 mL) for 6 h, and then supplemented with the same volume of NK92MI complete medium as the supernatant of SIRT1 overexpression lentivirus and continued to be transfected for 48 h.

[0092] After culturing, each experimental group of cells (2×10 6 cells / mL) were respectively inoculated with target cells (4×10 5 cells / mL, primary AML blasts or K562 cells) in NK92MI complete medium and co-cultured in an incubator at 37°C, 5% CO2, and 20% O2 for 4 h. After the cells of each experimental group were co-cultured, they were labeled with flow antibodies, and then flow cytometry was used to detect the killing function of NK cells. The information of the flow antibodies involved is shown in the following table:

[0093]

[0094] 1.4.3 Experimental results

[0095] Please refer to Figures 2 - 4 .

[0096] It can be seen through Figure 2 and Figure 3 that compared with the normoxia group, the toxicity of NK cells in the hypoxia group to primary AML blasts and K562 cells was significantly inhibited, and the degranulation ability of NK cells and the release ability of IFN were inhibited, indicating that the hypoxia environment significantly inhibited the toxicity and killing ability of NK cells. Compared with the hypoxia group, after SIRT3 overexpression treatment, the toxicity of NK cells to primary AML blasts and K562 cells was improved, and at the same time, the proportion of NK cells expressing CD107a + and IFN-γ + increased ( Figure 2 a and Figure 3 a). In addition, after SIRT3 overexpression treatment, the expression level of granzyme B in NK cells was up-regulated ( Figure 2 b- Figure 2 c and Figure 3 b- Figure 3 c).

[0097] In addition, in this example, SIRT1, a member of the SIRT protein family, was used as one of the controls to detect the effect of SIRT1 overexpression on the killing of primary AML blasts by NK cells under hypoxic conditions. The results are shown in Figure 4It can be seen that after overexpression of SIRT1 in NK cells, the improvement of killing activity is not significant. However, overexpression of SIRT3 significantly reverses the inhibition of the killing function of NK92MI cells by hypoxia.

[0098] The above results indicate that overexpression of SIRT3 can enhance the adaptation of NK cells to a hypoxic environment, reverse the inhibition of NK cell toxicity or activity by the hypoxic environment, and restore the killing ability of NK cells.

[0099] Example 2 Overexpression of SIRT3 enhances the adaptation ability of BMNK cells to a hypoxic environment and improves the killing function of NK cells

[0100] In this example, NK cells from patients with relapsed AML were treated with the supernatant of lentivirus overexpressing SIRT3, thereby demonstrating that overexpression of SIRT3 can significantly enhance the activation of NK cells and reverse the damage of the anti-leukemia function of NK cells in patients with relapsed AML. The NK cells of patients with relapsed AML are in a hypoxic tumor microenvironment for a long time. The hypoxia treatment in Example 1 is to mimic the hypoxic microenvironment of AML.

[0101] 2.1 Experimental materials

[0102] NK cells in the bone marrow of patients with acute myeloid leukemia (AML) are derived from bone marrow mononuclear cells (BMMCs). Among them, BMMCs are isolated from residual bone marrow samples of AML patients who have undergone laboratory tests by Ficoll density gradient centrifugation. These patients include those with early relapse after allogeneic hematopoietic stem cell transplantation and those without early relapse. Early relapse is defined as relapse within 6 months after complete remission after allogeneic transplantation. NK cells used in in vivo experiments are purified from the blood of healthy donors: NK cells are purified by a magnetic-activated cell sorting (MACS) kit (Miltenyi Biotec, Cat.#130-092-657). The purity of NK cells is >93% each time they are detected. All human samples used are approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China (2021-N(H)-120; Hefei, China), and written informed consent is obtained from all patients.

[0103] Primary AML blasts, K562 cells, and the flow antibodies used are the same as in Example 1.

[0104] 2.2 Experimental methods

[0105] First, refer to the method in Example 1 to obtain the supernatant of lentivirus overexpressing SIRT3. At the same time, use the blank lentiviral vector plasmid as a control, and refer to the method in Example 1 to obtain the supernatant of lentivirus without the target gene.

[0106] The bone marrow NK cells (2×10 6 cells / mL) of patients with relapsed AML were treated in the following 2 experimental groups:

[0107] (1) SIRT3 overexpression group: In an incubator at 37°C, 5% CO2, and 20% O2, the bone marrow NK cells of patients with relapsed AML were first treated in the SIRT3 overexpression lentiviral supernatant (2 mL) for 6 h, and then supplemented with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as the SIRT3 overexpression lentiviral supernatant and continued to be transfected for 48 h.

[0108] (2) Control group: In an incubator at 37°C, 5% CO2, and 20% O2, the bone marrow NK cells of patients with relapsed AML were first treated in the lentiviral supernatant without the target gene (2 mL) for 6 h, and then supplemented with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as the lentiviral supernatant without the target gene and continued to be transfected for 48 h.

[0109] After the culture was completed, the cells of each experimental group (2×10 6 cells / mL) were respectively inoculated with target cells (4×10 5 cells / mL, primary AML blasts or K562 cells) in complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119), and co-cultured in an incubator at 37°C, 5% CO2, and 20% O2 for 4 h.

[0110] After the cells of each experimental group were co-cultured, they were labeled with flow antibodies, and the killing function of NK cells was detected by flow cytometry. The information of the flow antibodies involved is shown in the following table:

[0111]

[0112] 2.3. Experimental results

[0113] Please refer to Figure 5 .

[0114] It can be seen that after the SIRT3 overexpression treatment, the proportions of primary AML cells and K562 cells positive for Annexin V + were significantly increased ( Figure 5 a and Figure 5 d). CD107a + and Granzyme B +The proportion of BMNK cells significantly increased after SIRT3 overexpression treatment ( Figure 5 c and Figure 5 g). Moreover, the expression levels of CD38, NKG2D, and CD160 (Cat#341208, RRID:AB_2561435) in BMNK cells were significantly upregulated ( Figure 5 a - 5b and Figure 5 d - 5f).

[0115] The above results indicate that the effector functions of BMNK cells from relapsed AML patients against primary AML blasts and AML cell lines were significantly improved after SIRT3 overexpression. Specifically, lentiviral overexpression of SIRT3 in vitro could restore the degranulation and cytokine secretion capabilities of NK cells isolated from these AML patients. In addition, this pretreatment significantly enhanced NK cell activation.

[0116] Example 3 Overexpression of SIRT3 can significantly inhibit the growth of leukemia cells in a leukemia mouse xenograft model

[0117] 3.1 Experimental materials

[0118] 6 - week - old female NOD / ShiLtJGpt - Prkdc em26Cd52 IL - 2rg em26Cd22 / Gpt (NCG) mice, purchased from GemPharmatech. All animals were housed under specific pathogen - free conditions. All experiments involving mice were conducted in accordance with the regulations of the "National Guidelines for Animal Usage in Research" in China and approved by the Ethics Committee of the University of Science and Technology of China (USTC ACUC2).

[0119] HL60 cells were purchased from Shanghai Cell Bank.

[0120] IL - 2 (50000 U, Jiangsu Kingsley Pharmaceuticals).

[0121] NK cells were purchased from Miaoshun (Shanghai) Biotechnology Co., Ltd.

[0122] 3.2 Experimental methods (see Figure 6 a)

[0123] a. Construction of the animal model

[0124] Luciferase - labeled HL60 (2.5×10 4The leukemia cells (at a dose of 1×10⁶ cells / g) were intravenously injected into NCG mice, and tumor growth was monitored by bioluminescence imaging using an IVIS Spectrum imaging system (PerkinElmer) to confirm successful transplantation of the leukemia cells.

[0125] b. Pre-treat the NK cells

[0126] The NK cells (2×10⁶ cells / mL) were treated in the following 3 experimental groups: 6 :

[0127] (1) Normoxia group: The NK cells were cultured in complete RPMI 1640 medium in an incubator at 37°C, 5% CO₂, and 20% O₂ for 48 h throughout the process.

[0128] (2) Hypoxia group: The NK cells were cultured in complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) in an incubator at 37°C, 5% CO₂, and 5% O₂ for 48 h throughout the process.

[0129] (3) Hypoxia + SIRT3 overexpression group: In an incubator at 37°C, 5% CO₂, and 5% O₂, the NK cells were first treated with the supernatant of the SIRT3 overexpressing lentivirus (2 mL) for 6 h, and then supplemented with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as the SIRT3 lentivirus overexpression supernatant and continued to be transfected for 48 h.

[0130] c. On the 7th day after the mice were inoculated with tumors, the NK cells treated in each experimental group in step b (5.0×10⁶ cells / g) were adoptively transferred into the mice (5 mice per group). To support the in vivo survival of the NK cells, IL-2 (50000 U / mouse) was intraperitoneally injected into the mice once every 2 days. 4

[0131] d. At the specified time points (7 d, 14 d, 28 d, and 35 d), the AML burden was monitored by bioluminescence imaging using an IVIS Spectrum imaging system (PerkinElmer). Living image Software (PerkinElmer) was used to analyze the quantitative image data.

[0132] Throughout the entire experimental process, the feeding conditions of the mice were all standard full-nutrition feeding.

[0133] 3.3 Experimental results

[0134] The results can be seen in Figure 6, compared with the normoxia group, the growth of HL60 cells and tumors in mice of the hypoxia group was significantly accelerated. However, the growth of HL60 cells and tumors in mice receiving NK cells with overexpressed SIRT3 was significantly inhibited ( Figure 6 b and 6c).

[0135] The above results indicate that, compared with the normoxia group, the AML burden in mice of the hypoxia group was heavier and the survival time was significantly shortened; mice receiving NK cells treated with overexpressed SIRT3 showed significantly lower AML burden and longer survival time. These results clearly show that NK cells effectively restored the anti-leukemia response of hypoxia-damaged NK cells through SIRT3 overexpression.

[0136] It can be understood that in the embodiments of the present application, acute myeloid leukemia cells were taken as an example to verify the function of NK cells with overexpressed SIRT3. However, it does not mean that only the treatment of leukemia can be achieved in the present application. The same or similar effects can be achieved for any tumor with a hypoxic tumor microenvironment in the art.

[0137] Based on the results of the above embodiments, it can be seen that SIRT3 overexpression can enhance the adaptability of NK cells to the hypoxic environment, reverse the inhibition of NK cells by the hypoxic environment, thereby enhancing the metabolism and killing functions of NK cells under hypoxic conditions, and further enhancing the killing of tumor cells by NK cells in vivo and in vitro. By targeting NK cells to hypoxia, tumor cell apoptosis was promoted and tumor progression was inhibited. It shows that targeting the adaptation of NK cells to the hypoxic environment can enhance the metabolism and killing ability of NK cells and promote the treatment of tumors.

[0138] It should be noted that the present application is not limited to the above embodiments. The above embodiments are only examples, and embodiments with the same structure and the same function and effect as the technical idea within the technical solution scope of the present application are all included in the technical scope of the present application. In addition, within the scope of not departing from the gist of the present application, various modifications that those skilled in the art can think of to the embodiments, and other ways constructed by combining some constituent elements of the embodiments are also included in the scope of the present application.

Claims

1. A natural killer cell resistant to hypoxia, characterized in that, It is an NK cell overexpressing SIRT3.

2. A method for preparing the hypoxia-resistant natural killer cells according to claim 1, characterized in that, It includes the following steps: Overexpress SIRT3 in NK cells to obtain hypoxia-tolerant natural killer cells.

3. The method according to claim 2, wherein The overexpression of SIRT3 is achieved by lentiviral transfection, including the following steps: Based on the lentiviral expression vector, construct a lentiviral overexpression plasmid containing the target gene SIRT3; Transfect the lentiviral overexpression plasmid into packaging cells to obtain the SIRT3 overexpression lentiviral supernatant; Pretreat NK cells with the SIRT3 overexpression lentiviral supernatant, and then culture the NK cells in a cell culture medium supplemented with the SIRT3 overexpression lentiviral supernatant.

4. The method according to claim 3, wherein The lentiviral expression vector is one of pLVX-IRES-Puro, pLKO.1, pLenti-CMV-GFP, pLVX-Puro, pCDH.

5. The method according to claim 3, wherein The packaging cells are mammalian cells.

6. The method according to claim 3, characterized in that, Taking 2×10 6 NK cells as an example, the addition amount of the lentivirus supernatant with overexpressed SIRT3 is 1 mL - 3 mL.

7. Use of the hypoxia-tolerant natural killer cells according to claim 1 or the hypoxia-tolerant natural killer cells prepared by the method according to any one of claims 2-6 in the preparation of a drug for treating tumors.

8. A drug for treating tumors, characterized in that, Containing an effective amount of the hypoxia-tolerant natural killer cells according to claim 1 or the hypoxia-tolerant natural killer cells prepared by the method according to any one of claims 2-6.

9. The drug according to claim 8, characterized in that, The drug has any of the following effects at least: a: Reverse the inhibition of the killing and / or metabolic ability of NK cells by the hypoxic environment; b: Enhance the metabolic and / or killing ability of NK cells under hypoxic conditions; c: Inhibit the growth of tumor cells; d: Promote the apoptosis of tumor cells.

10. The drug according to claim 9, characterized in that, The drug also includes at least any pharmaceutically acceptable excipient and / or carrier.

Images