Root specific expression promoter Pgj1 and application thereof

Abstract

The invention relates to the technical field of plant breeding. The invention provides a promoter Pgj1 for root specific expression and application of the promoter Pgj1. The nucleotide sequence of the promoter Pgj1 is as shown in SEQ ID NO. 1. The promoter Pgj1 provided by the invention can be specifically expressed in the soybean root, and the specific expression of a target gene driven by the promoter in the soybean root can be realized. The promoter has high application value in plant gene expression regulation and control research and soybean breeding improvement.

Description

Technical Field

[0001] The present invention relates to the technical field of plant breeding, and in particular to a root-specific expression promoter Pgj1 and its application. Background Art

[0002] The root is an important organ for plant growth and development. The isolation and identification of root-specific promoters are of great significance for improving crop root morphology, nutrient absorption, abiotic stresses such as salt and drought, and root pests and diseases by using engineering techniques.

[0003] The upstream promoter of a gene, as an important element for gene expression regulation, controls the expression of the gene in different spaces, times, and environmental conditions. Highly active promoters have important application prospects in plant gene function research and genetic breeding. Currently, the mainly widely used promoters in the field of plant genetic engineering are constitutive strong promoters, such as the 35S promoter of cauliflower mosaic virus (CaMV) and the maize Ubiquitin promoter. However, exogenous virus promoters have potential biological biosafety issues, and endogenous constitutive promoters in plants often lead to unclear improvement effects or over-accumulation of the target protein in the plant due to the inability to well control the time or space of the target gene expression, thus affecting the normal growth and development of plants. These are all obstacles existing in the current genetic engineering of crops by using constitutive strong promoters to initiate functional genes.

[0004] In view of this, it is particularly important to isolate and obtain promoters with specific expression characteristics for plant functional gene research and crop genetic improvement. Summary of the Invention

[0005] The purpose of the present invention is to provide a root-specific expression promoter Pgj1 and its application, to overcome the lack of existing soybean endogenous specific promoters. The present invention studies soybean transcriptome data, screens the gene Glyma.05G216000.1 that is specifically and highly expressed in roots, and clones the promoter sequence of this gene and names it Pgj1. Research shows that through RT-qPCR detection, the Glyma.05G216000.1 gene has the highest expression abundance in soybean roots. The promoter Pgj1-DsRed recombinant plasmid is transferred into soybeans to obtain transgenic soybean plants. Further, by observing the red fluorescence produced by the promoter Pgj1 initiating DsRed, the root-specific expression characteristic of the promoter Pgj1 in soybean roots is confirmed.

[0006] To achieve the above invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a root-specific expression promoter Pgj1, and the nucleotide sequence of the promoter Pgj1 is as shown in SEQ ID NO.1.

[0008] The present invention also provides the application of the promoter Pgj1 in the root-specific expression of plants.

[0009] The present invention also provides a primer pair for amplifying the promoter Pgj1, the primer pair includes an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1, the sequence of the upstream primer Pgj1-F1 is as shown in SEQ ID NO.4, and the sequence of the downstream primer Pgj1-R1 is as shown in SEQ ID NO.5.

[0010] The present invention also provides the application of the promoter Pgj1 in constructing a root-specific expression recombinant vector.

[0011] The present invention also provides a root-specific expression recombinant vector, and the recombinant vector is the pCAMBIA3300 vector containing the promoter Pgj1.

[0012] The present invention also provides the application of the root-specific expression recombinant vector in constructing a root-specific expression recombinant bacterium.

[0013] The present invention also provides a root-specific expression recombinant bacterium, and the recombinant bacterium is Agrobacterium containing the root-specific expression recombinant vector.

[0014] The present invention also provides the application of the root-specific expression recombinant bacterium in constructing a transgenic plant with root-specific expression.

[0015] The present invention also provides a method for constructing a transgenic plant with root-specific expression by using the root-specific expression recombinant bacterium, including the following steps: infecting a plant with the root-specific expression recombinant bacterium to obtain the transgenic plant.

[0016] Preferably, the type of the plant is soybean.

[0017] The present invention provides a root-specific expression promoter Pgj1 and its application, and the nucleotide sequence of the promoter Pgj1 is as shown in SEQ ID NO.1. The promoter Pgj1 provided by the present invention can be specifically expressed in soybean roots, and the target gene driven by this promoter can achieve specific expression in soybean roots. This promoter has high application value in the research of plant gene expression regulation and soybean breeding improvement.

[0018] The present invention studied soybean transcriptome data, analyzed and screened to obtain the root-specific expression gene Glyma.05G216000.1, and cloned the DNA sequence of 1518 bp upstream of its starting site from the soybean Williams 82 genome by PCR amplification (named promoter Pgj1). qRT-PCR analysis showed that the expression level of this gene in root tissues was significantly higher than that in other tissues. By constructing a Pgj1-DsRed fusion expression vector and transforming soybeans, tissue-specific detection showed that the DsRed red fluorescence signal was specifically enriched in the roots, and no significant expression was detected in organs such as stems and leaves. Compared with the prior art, Pgj1 exhibits root tissue specificity, providing a key regulatory element for analyzing the root development mechanism and breeding for stress-resistant genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 RT-qPCR detection results of the Glyma.05G216000.1 gene in different tissue parts;

[0020] Figure 2 PCR gel electrophoresis results for cloning promoter Pgj1;

[0021] Figure 3 Prediction of cis-acting elements of promoter Pgj1;

[0022] Figure 4 Color development results of Pgj1 promoter red fluorescent protein in different tissue parts;

[0023] Figure 5 To obtain the pCAMBIA3300-Pgj1-DsRed expression vector. DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention provides a root-specific expression promoter Pgj1, and the nucleotide sequence of the promoter Pgj1 is shown in SEQ ID NO.1;

[0025] SEQ ID NO.1:

[0026]

[0027] The present invention also provides the use of the promoter Pgj1 in plant root-specific expression.

[0028] The present invention also provides a primer set for amplifying the promoter Pgj1, which includes an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1.

[0029] The sequence of the upstream primer Pgj1-F1 is as shown in SEQ ID NO.4;

[0030] SEQ ID NO.4:

[0031] 5'-CCCACCATTTTTGTTTCCGC-3'

[0032] The sequence of the downstream primer Pgj1-R1 is as shown in SEQ ID NO.5:

[0033] SEQ ID NO.5:

[0034] 5'-GCTGATAAATTGAAGTGTGTGTTGC-3'.

[0035] The present invention also provides the use of the promoter Pgj1 in constructing a root-specific expression recombinant vector.

[0036] The present invention also provides a root-specific expression recombinant vector, which is the pCAMBIA3300 vector containing the promoter Pgj1.

[0037] The present invention also provides the use of the root-specific expression recombinant vector in constructing a root-specific expression recombinant bacterium.

[0038] The present invention also provides a root-specific expression recombinant bacterium, which is an Agrobacterium containing the root-specific expression recombinant vector.

[0039] The present invention also provides the use of the root-specific expression recombinant bacterium in constructing a transgenic plant with root-specific expression.

[0040] The present invention also provides a method for constructing a transgenic plant with root-specific expression using the root-specific expression recombinant bacterium, including the following steps: infecting a plant with the root-specific expression recombinant bacterium to obtain the transgenic plant.

[0041] In the present invention, the type of the plant is soybean.

[0042] The following is a detailed description of the technical solutions provided by the present invention in conjunction with the examples, but they should not be construed as limiting the protection scope of the present invention.

[0043] Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. For the test methods without specific experimental conditions indicated in the following examples, they are generally carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.

[0044] The soybean root-specific promoter Pgj1 involved in the examples of the present invention can be amplified from the soybean genome. The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0045] The cloning vector pEASY-Blunt vector, the plant expression vector pCAMBIA3300, and the agrobacterium EHA105 involved in the examples of the present invention are commercially available through conventional channels.

[0046] Example 1 Transcription levels of the Glyma.05G216000.1 gene in different tissues

[0047] Based on the analysis of the soybean transcriptome data, a gene Glyma.05G216000.1 (SEQ ID NO.6) that is strongly expressed in soybean roots was selected. The expression levels of the candidate gene Glyma.05G216000.1 in different tissues and organs of soybean were verified by real-time quantitative PCR.

[0048] SEQ ID NO.6:

[0049] ATGGCCTCCGTTCAGTGCCACAAAACCTGCAAAGTGAGCTGCCAACAGGAAAACCAGCACGCCTCGTTTGGGCAGAAAGTTTCTGACTTGTTCAAAGGGCATCAACATAATGACCACAGCTCCAATTATGCCACCCAAACCAAAGTGCTTTCCCAGTCAGGGTCAGGGTTAGGCCCCTTCACCACCAAAACTCAAACACAATGCGGTTGCCCCCAAACACATCTCAGTACCACTCATGGCTCCAACACAAAAGGCCATGGCCATGGCCAAGGGAGAATTAAGAGGGAGCACAAGAGAGGGATGCTGCAGAACATCAAGGATCGCTTATCAGGTGACACCAGCAGCGACAGCGAGAGCGACAACGAAACTTGCCACAAGAGGAAGGACTGA。

[0050] The specific method is as follows:

[0051] Total RNAs were respectively extracted from tissue samples such as roots, leaves, stems, pods, and seeds of soybean plants at the mature stage. Real-time quantitative PCR was performed using the specific primers Glyma.05G216000.1-F1 / Glyma.05G216000.1-R1.

[0052] The detection instrument was ABIPRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), the internal reference gene was GmACT6 (GenBank No. NM_001289231), and the relative expression level of the gene was detected by the 2 –ΔΔCT (Livak) method.

[0053] The RT-qPCR program was as follows: 94 °C, 10 min; (94 °C, 45 s; 60 °C, 45 s; 72 °C, 30 s) for 35 cycles; 72 °C, 10 min.

[0054] The RT-qPCR system was SYBR Green PCR Master Mix 10 μL, cDNA 2 μL, forward primer 0.2 μL, reverse primer 0.2 μL, and supplemented with ddH2O to 20 μL.

[0055] The results showed that the expression level of the Glyma.05G216000.1 gene was the highest in roots, and almost no expression was detected in other tissues such as leaves and stems ( Figure 1), consistent with the transcriptome data, confirmed the root-specific expression characteristics of the Glyma.05G216000.1 gene. The quantitative primer sequences are as follows:

[0056] Glyma.05G216000.1-F1:

[0057] ACCACAGCTCCAATTATGCCAC (SEQ ID NO.2);

[0058] Glyma.05G216000.1-R1:

[0059] CAGCATCCCTCTCTTGTGCT (SEQ ID NO.3).

[0060] Example 2 Cloning of the promoter Pgj1 of the Glyma.05G216000.1 gene

[0061] Specific primers were designed according to the promoter sequence of the soybean Glyma.05G216000.1 gene for PCR amplification. The amplification products were electrophoretically separated on a 1% agarose gel (the electrophoresis results are as Figure 2 shown). The agarose gel containing the amplification products was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), transformed into competent cells (DH5α), and positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was sent for sequencing and confirmed to be 1518 bp. After correct sequence alignment, the inventor named this sequence fragment the root-specific promoter Pgj1, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0062] The PCR program is as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.

[0063] The PCR amplification system of the present invention is: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.

[0064] The amplification primers for the promoter Pgj1 of the Glyma.05G216000.1 gene are:

[0065] Forward primer Pgj1-F1:

[0066] 5'-CCCACCATTTTTGTTTCCGC-3' (SEQ ID NO.4);

[0067] Reverse primer Pgj1-R1:

[0068] 5'-GCTGATAAATTGAAGTGTGTGTTGC-3' (SEQ ID NO.5).

[0069] Example 3 Analysis of cis-elements acting on promoter Pgj1

[0070] The online software PlantPAN 4.0 was used to analyze the cis-elements acting on the promoter Pgj1 sequence cloned in Example 1. It was found that the promoter sequence contains CAT-box (GGCCAATCT), G-box (CACGTG), TATA-box (TATAWA), MYC (CACGTG), etc.( Figure 3 ).

[0071] Example 4 Obtaining transgenic soybeans containing the pCAMBIA3300-Pgj1-DsRed expression vector

[0072] In this method, pCAMBIA3300 (purchased from Beijing TransGen Biotech Co., Ltd.) was double-digested with EcoRⅠ and HindⅢ and then ligated to the red fluorescent protein reporter gene DsRed to optimize and obtain pCAMBIA3300-DsRed.

[0073] The promoter Pgj1 fragment of the Glyma.05G216000.1 gene cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pgj1-DsRed expression vector( Figure 5 ). The vector plasmid was introduced into EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The Agrobacterium-mediated transformation method was used for transformation, and the variety for transformation was Jiyu 86. The specific transformation process is as follows:

[0074] (1) Pick a single colony of Agrobacterium EHA105 and inoculate it into 5 mL of YEP liquid medium (100 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP) until the OD600nm reaches 0.6. The bacterial cells were centrifuged at 3000 rpm for 10 min and then resuspended in the liquid co-culture medium (0.321 g / L of B5 salts, 30 g / L of sucrose, 3.9 g / L of MES, 1.67 mg / L of BAP, 0.25 mg / L of GA3, 400 mg / L of cysteine, 154.2 mg / L of DTT, 200 μmol / L of AS, pH 5.4), and the OD600nm was adjusted to 0.5 for use.

[0075] (3) Agrobacterium infection

[0076] Use a scalpel to cut open the soybean seeds along the hilum part, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in resuspended Agrobacterium for 30 min. Transfer the infected explants to the co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubate in the dark at 23 °C for 4 d.

[0077] (4) Adventitious bud induction

[0078] After 4 d of co-culture of the explants, transfer the explants to the induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The proximal surface of the cotyledon node and hypocotyl parts of the explants should be inserted into the medium facing upwards and at a 45° angle to the horizontal plane, and cultured under a 16 / 8 h light / dark cycle at 25 °C for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium for continued culture for 2 weeks under the same conditions.

[0079] (5) Bud elongation

[0080] Transfer the induced clustered buds (removing the cotyledon tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions are 25 °C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.

[0081] (6) Rooting

[0082] When the resistant buds grow to 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. Transplant them to the greenhouse for growth and fruiting when strong roots have grown.

[0083] Using the specific primers of promoter Pgj1, PCR detection was carried out on the T1 generation transgenic soybeans. Combining with herbicide screening, after obtaining the transgenic soybeans in which promoter Pgj1 drives DsRed, the red fluorescence was observed.

[0084] Example 5 Observation of Red Fluorescence in Different Parts of pCAMBIA3300-Pgj1-DsRed Transgenic Soybean Plants

[0085] Using the LUYOR-3415RG dual-wavelength fluorescence imaging system, root-specific expression analysis was carried out on the T1 generation transgenic soybean plants. The results showed that only the roots of the T1 generation transgenic soybeans had red fluorescence ( Figure 4 ), indicating that promoter Pgj1 is specifically expressed in the roots.

[0086] As can be seen from the above examples, the present invention provides a root-specific promoter Pgj1 and its application, and the nucleotide sequence of the promoter Pgj1 is shown as SEQ ID NO.1. The promoter Pgj1 provided by the present invention can be specifically expressed in soybean roots, and the target gene driven by this promoter can achieve specific expression in soybean roots. This promoter has high application value in plant gene expression regulation research and soybean breeding improvement.

[0087] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A root-specifically expressed promoter Pgj1, characterized in that, The nucleotide sequence of the promoter Pgj1 is shown in SEQ ID NO.

1.

2. Use of the promoter Pgj1 described in claim 1 in plant root-specific expression.

3. A primer set for amplifying the promoter Pgj1 described in claim 1, characterized in that, The primer set includes an upstream primer Pgj1-F1 and a downstream primer Pgj1-R1. The sequence of the upstream primer Pgj1-F1 is shown in SEQ ID NO.4, and the sequence of the downstream primer Pgj1-R1 is shown in SEQ ID NO.

5.

4. Use of the promoter Pgj1 described in claim 1 in constructing a root-specific expression recombinant vector.

5. A root-specific expression recombinant vector, characterized in that, The recombinant vector is the pCAMBIA3300 vector containing the promoter Pgj1 described in claim 1.

6. Use of the root-specific expression recombinant vector described in claim 5 in constructing a root-specific expression recombinant bacterium.

7. A root-specific expression recombinant bacterium, characterized in that, The recombinant bacterium is Agrobacterium containing the root-specific expression recombinant vector described in claim 5.

8. Use of the root-specific expression recombinant bacterium described in claim 7 in constructing a transgenic plant with root-specific expression.

9. A method for constructing a root-specific expression transgenic plant by using the root-specific expression recombinant bacterium described in claim 7, characterized in that, Comprising the following steps: Infecting a plant with the root-specific expression recombinant bacterium described in claim 7 to obtain the transgenic plant.

10. The method according to claim 9, wherein The type of the plant is soybean.

Images