Soybean seed specific promoter Pz2 and application thereof
By screening and cloning the soybean seed-specific promoter Pz2, the problem of high expression of constitutive promoters in non-target tissues is solved, soybean seed-specific gene expression is achieved, and the controllability of genetic improvement and the effect of oil and fat metabolism engineering is improved.
Patent Information
- Application Number
- CN202510566169.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, constitutively strong promoters lead to continuous high expression of exogenous genes in non-target tissues in crops, resulting in energy metabolism imbalance and physiological disturbances, and lack of effective seed-specific promoters for soybean oil metabolism engineering improvement.
By comparing transcriptome sequencing analysis with soybean genome information, the seed-specific expression gene Glyma.13G288100 was screened out, and a specific primer was designed to clone the promoter Pz2 of 1632bp upstream, construct a recombinant vector fusion with the red fluorescent protein DsRed gene, and introduced it into soybean for expression verification.
The specific expression of soybean seed tissue is achieved, gene expression of non-target tissue is avoided, the controllability of genetic operations is improved, and new tools are provided for genetic improvement of soybean oil.
Smart Images

Figure CN120330187A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a soybean seed-specific promoter Pz2 and its application. Background Art
[0002] Soybean (Glycine max), as an important global economic crop, is a core source of high-quality vegetable oil and dietary protein. In the field of crop genetic improvement, the isolation and functional analysis of seed-specific promoters have crucial scientific value - they not only provide core elements for analyzing the molecular regulatory network of seed development, but also lay a foundation for precisely regulating the seed development process and quality traits through synthetic biology strategies. Particularly importantly, such promoter elements exhibit unique advantages in achieving spatio-temporal specific expression of foreign genes, providing important technical support for the development of soybean oil metabolic engineering improvement and seed bioreactors.
[0003] As a core element of gene expression regulation, the analysis of the structural characteristics and spatio-temporal expression patterns of promoters is an important basis for elucidating the transcriptional regulation mechanism. The current crop genetic improvement system mainly relies on constitutive strong promoters (such as CaMV35S). However, its continuous high-expression characteristics are prone to cause significant metabolic burdens: on the one hand, it leads to continuous high expression of foreign genes in non-target tissues, resulting in energy metabolism imbalance; on the other hand, it causes unexpected physiological disturbances, ultimately leading to deterioration of agronomic traits such as a decrease in the biomass of transgenic plants and a delay in the growth period. In contrast, tissue-specific promoters can effectively avoid the abnormal accumulation of heterologous proteins in non-target tissues by precisely regulating the spatio-temporal pattern of gene expression, achieving three-dimensional precise regulation of the "time-space-quantity" of target genes, and significantly improving the controllability of genetic manipulation. Of particular concern is the seed-specific promoter, which has shown unique advantages in metabolic engineering such as enhancing oil synthesis (such as ω-3 fatty acid biosynthesis) and optimizing the components of storage proteins by directing the specific expression of key enzyme genes in metabolic pathways in the endosperm or cotyledons, while maintaining the basic metabolic homeostasis of plants to the greatest extent. Therefore, exploring new promoter resources with tissue specificity and adjustable expression intensity has become a key breakthrough point in the construction of plant synthetic biology and precision molecular breeding technology systems. Summary of the Invention
[0004] The purpose of the present invention is to provide a soybean seed-specific promoter Pz2 and its application.
[0005] To achieve the above invention purpose, the present invention provides the following technical solutions:
[0006] In the first aspect, the present invention provides a soybean seed-specific promoter Pz2, and the nucleotide sequence of the promoter Pz2 is as shown in SEQ ID NO.1.
[0007]
[0008] In a second aspect, the present invention provides amplification primers for the promoter Pz2. The nucleotide sequence of the forward primer Pz2-F1 is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer Pz2-R1 is as shown in SEQ ID NO.3.
[0009] In a third aspect, the present invention provides a chimeric gene, which comprises a target gene and the promoter Pz2 operably linked to the target gene sequence.
[0010] In a fourth aspect, the present invention provides an expression cassette, which contains the promoter Pz2 or contains the chimeric gene.
[0011] In a fifth aspect, the present invention provides a recombinant vector, which contains the promoter Pz2 or contains the chimeric gene.
[0012] In a sixth aspect, the present invention provides a host bacterium, which contains the recombinant vector.
[0013] In a seventh aspect, the present invention provides the use of the promoter Pz2, or the primer, or the chimeric gene, or the expression cassette, or the recombinant vector, or the host bacterium in cultivating transgenic plants.
[0014] Preferably, the plant is soybean.
[0015] In an eighth aspect, the present invention provides a method for cultivating transgenic soybean plants. The target gene to be expressed is linked to the promoter Pz2 to obtain a chimeric gene; a recombinant vector containing the chimeric gene is constructed and transferred into soybean plant tissues to obtain transgenic soybean plants that specifically express the target gene in soybean seeds.
[0016] In a ninth aspect, the present invention provides the use of the promoter Pz2, or the primer in soybean gene function research and gene expression regulation research.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] The promoter Pz2 in the present invention is based on the combination of comparative transcriptome sequencing analysis and soybean genome information. The gene Glyma.13G288100 that is specifically expressed in soybean seeds was screened. Specific primers were designed according to the soybean genome sequence, and a 1632bp promoter DNA fragment upstream of it was cloned from the soybean Williams 82 genome. The results of real-time fluorescence quantitative PCR showed that the Glyma.13G288100 gene had the highest expression abundance in seeds. After fusing the promoter with the red fluorescent protein DsRed gene and transferring it into soybeans, it was observed that the red fluorescent protein in the transgenic soybeans showed color only in the soybean seeds, indicating that this promoter was specifically expressed only in soybean seed tissues. The present invention provides a new promoter for the current lack of endogenous specific promoters in soybeans, and has important application value in analyzing gene functions and genetic improvement of oil.
[0019] The promoter Pz2 provided by the present invention has strong specificity in soybean seed tissues. After binding the target gene to be expressed with the promoter Pz2 and introducing it into soybean plants, it can be used to improve the quality of transgenic soybean seeds and cultivate new varieties of transgenic soybeans. Brief Description of the Drawings
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on the provided drawings.
[0021] Figure 1 It is the detection result of the relative expression levels of the Glyma.13G288100 gene in different tissues of soybeans in Example 1;
[0022] Figure 2 It is the electrophoretic separation result of the amplification products on an agarose gel in Example 2;
[0023] Figure 3 It is the analysis result of the cis-acting elements of the promoter Pz2 sequence in Example 3;
[0024] Figure 4 It is the structural diagram of the pCAMBIA3300-pz2-DsRed recombinant vector in Example 4;
[0025] Figure 5 It is the detection result of the red fluorescence in wild-type soybean seeds and transgenic soybean seeds in Example 5. Detailed Embodiments
[0026] The technical solution provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention. The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).
[0027] Example 1 Transcription levels of the Glyma.13G288100 gene in different tissues
[0028] Based on transcriptome data analysis, one gene Glyma.13G288100 (SEQ ID NO.4) that is strongly expressed in soybean seeds was selected. Further, the expression levels of the candidate gene Glyma.13G288100 in different tissues and organs of soybean were verified by real-time quantitative PCR. The specific method is as follows:
[0029] Total RNA was extracted from the root, leaf, stem, flower, pod, and seed tissue samples of soybean plants at the mature stage. Real-time quantitative PCR was performed using the designed specific primers Glyma.13G288100-F1 (SEQ ID NO.5) and Glyma.13G288100-R1 (SEQ ID NO.6). The detection instrument was ABIPRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected by 2–ΔΔCT (Livak) method.
[0030] The sequences of the quantitative primers are as follows:
[0031] Glyma.13G288100-F1: AGCAAGATAGCTGCCGCAAG
[0032] Glyma.13G288100-R1: CTCGCTCATTTCTGTGCAGCA
[0033] The RT-qPCR system was: 10 μL of SYBR Green PCR MasterMix, 2 μL of cDNA template, 0.2 μL of forward primer, 0.2 μL of reverse primer, and made up to 20 μL with ddH2O.
[0034] The RT-qPCR program was: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min.
[0035] The detection results are asFigure 1 As shown, it can be seen that the expression level of the Glyma.13G288100 gene is the highest in seeds and very low in other tissues such as leaves and stems, indicating the seed-specific expression characteristics of the Glyma.13G288100 gene.
[0036] Example 2 Cloning of the Glyma.13G288100 Promoter
[0037] Specific primers Pz2-F1 (SEQ ID NO.2) and Pz2-R1 (SEQ ID NO.3) were designed according to the genomic promoter sequence of soybean Glyma.13G288100 for PCR amplification. The amplified products were electrophoretically separated on a 1% agarose gel (the electrophoresis results are as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), transformed into competent cells (DH5α), and positive clones were obtained through antibiotic screening. After verification by colony PCR, the length of the inserted DNA fragment was confirmed to be 1632 bp by sequencing. After correct sequence alignment, it was named the soybean seed-specific promoter Pz2 (SEQ ID NO.1).
[0038] The amplification primers for promoter Pz2 are:
[0039] Pz2-F1: 5'-GCCTAAACACACAAAGATCACC-3'
[0040] Pz2-R1: 5'-GATCAAACAATCCGACATGGAC-3'
[0041] The PCR amplification system is: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.
[0042] The PCR amplification program is: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min) for 30 cycles; 72°C, 10 min.
[0043] Example 3 Analysis of Cis-Elements Acting on Promoter Pz2
[0044] The PlantPAN 4.0 was used to analyze the cis-elements acting on the promoter Pz2 sequence obtained in Example 2.
[0045] The results are as Figure 3As shown, it can be seen that the promoter sequence contains elements such as ABRE (ACGTGGC), O2-site (TCCACGTAGA, SEQ ID NO.7), G-box (CACGTG), GCN4_motif (ATGACTCAT), TGA-element (TGACGTCA), CAT-box (GCCACT), GATA-motif (AGATAG), P-box (TGTACAGGATGTTCT, SEQ ID NO.8), ERE (AGCCGCC), etc. Among them, GCN4_motif is an element expressed in the endosperm, and O2-site is an element related to the regulation of zein metabolism, which may be related to seed formation and metabolism. Other elements regulate hormones such as auxin and abscisic acid, which contribute to seed formation, and these play a key role in its specific expression in seeds.
[0046] Example 4 Obtaining Transgenic Soybeans of pCAMBIA3300-Pz2-DsRed
[0047] After double digestion of the pCAMBIA3300 vector (purchased from Beijing TransGen Biotech Co., Ltd.) with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein reporter gene DsRed, and pCAMBIA3300-DsRed was optimized. The promoter Pz2 fragment of Glyma.13G288100 cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the above-obtained pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-pz2-DsRed recombinant vector ( Figure 4 ).
[0048] The pCAMBIA3300-pz2-DsRed recombinant vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The Agrobacterium-mediated method was used for transformation, and the soybean variety used for transformation was Jiyu 86. The specific transformation process is as follows:
[0049] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (80 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP liquid medium) to OD 600nmis 0.6 - 0.8. After centrifuging the bacterial cells at 3000 rpm for 10 min, they were resuspended in the liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellic acid (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and the OD 600nm was adjusted to 0.5 for later use.
[0050] (2) Agrobacterium infection
[0051] The soybean seeds were cut open along the hilum with a scalpel, peeled, and slightly scratched at the cotyledon node position. Then the prepared explants were placed in the resuspended Agrobacterium for 30 min. The infected explants were transferred to the co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4), and cultured in the dark at 23°C for 4 d.
[0052] (3) Adventitious bud induction
[0053] After 4 d of co-culturing the explants, the explants were transferred to the induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5.5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledon node and hypocotyl parts of the explants needed to be inserted into the medium with the adaxial surface facing up and at a 45° angle to the horizontal plane, and cultured at 25°C under a 16 / 8 h light / dark condition for 2 weeks. The explants were taken out, the excess hypocotyl parts were excised, leaving only 5 mm, and then the explants were transferred to fresh induction medium and cultured for another 2 weeks under the same culture conditions.
[0054] (4) Bud elongation
[0055] Transfer the induced cluster buds (removing the cotyledon tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, indoleacetic acid (IAA) 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5.5 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions are 25°C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.
[0056] (5) Rooting
[0057] When the resistant buds grow to 3 - 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, indolebutyric acid (IBA) 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. After strong roots grow, transplant them to the greenhouse for growth and fruiting.
[0058] Use the promoter pz2 specific primers pz2-F1 and pz2-R1 to perform PCR detection on the T1 generation transgenic soybeans. Combine with herbicide screening. After obtaining the transgenic soybeans containing pCAMBIA3300-pz2-DsRed, observe the red fluorescence.
[0059] Example 5 Observe the red fluorescence in different parts of the transgenic soybean plants containing pCAMBIA3300-Pz2-DsRed
[0060] Use the LUYOR-3415RG dual-wavelength fluorescence imaging system to perform tissue-specific expression analysis on the T1 generation pCAMBIA3300-pz2-DsRed transgenic soybean plants. The results are as Figure 5 shown (the left figure is the seed of the wild-type soybean plant, and the right figure is the seed of the transgenic soybean plant). There is red fluorescence in the seeds of the transgenic soybean plants (the red fluorescence can only be seen after being irradiated with a specific flashlight and wearing specific glasses (the lens is orange). When taking pictures, the red fluorescence can only be captured through the glasses, so the color after taking pictures is orange). This further verifies the tissue-specific expression of the promoter Pz2 in the seed tissue.
[0061] As can be seen from the above embodiments, the present invention combines comparative transcriptome sequencing analysis with soybean genome information to screen and obtain the soybean seed-specific expression gene Glyma.13G288100 gene, and clone its promoter Pz2 for functional verification. RT-qPCR detection found that the Glyma.13G288100 gene was significantly highly expressed in soybean seeds; by constructing a recombinant plasmid containing Pz2-DsRed and performing soybean genetic transformation, it was found that the DsRed reporter gene driven by this promoter in transgenic plants was detected with red fluorescence signals only in seed tissues, and no obvious expression was observed in other tissues. This result indicates that the Pz2 promoter has the characteristic of seed tissue-specific expression, providing an important molecular tool for the study of soybean seed-specific gene regulation.
[0062] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A soybean seed-specific promoter Pz2, characterized in that, The nucleotide sequence of the promoter Pz2 is shown in SEQ ID NO.
1.
2. An amplification primer for the promoter Pz2 described in claim 1, characterized in that, The nucleotide sequence of the forward primer Pz2-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer Pz2-R1 is shown in SEQ ID NO.
3.
3. A chimeric gene, characterized in that, The chimeric gene comprises a target gene, and the promoter Pz2 as claimed in claim 1 which is operably linked to the target gene sequence.
4. An expression cassette, characterized in that, The expression cassette comprises the promoter Pz2 as claimed in claim 1, or comprises the chimeric gene as claimed in claim 3.
5. A recombinant vector, characterized in that, The recombinant vector comprises the promoter Pz2 as claimed in claim 1, or comprises the chimeric gene as claimed in claim 3.
6. A host bacterium, characterized in that, The host bacterium comprises the recombinant vector as claimed in claim 5.
7. Use of the promoter Pz2 as claimed in claim 1, or the primer as claimed in claim 2, or the chimeric gene as claimed in claim 3, or the expression cassette as claimed in claim 4, or the recombinant vector as claimed in claim 5, or the host bacterium as claimed in claim 6 in cultivating transgenic plants.
8. The application according to claim 7, wherein The plant is soybean.
9. A method for cultivating transgenic soybean plants, characterized in that, The target gene to be expressed is linked to the promoter Pz2 as claimed in claim 1 to obtain a chimeric gene; a recombinant vector containing the chimeric gene is constructed and transferred into soybean plant tissues to obtain a transgenic soybean plant that specifically expresses the target gene in soybean seeds.
10. Use of the promoter Pz2 as claimed in claim 1, or the primer as claimed in claim 2 in soybean gene function research and gene expression regulation research.
Citation Information
Patent Citations
Seed-specific promoter separated from soybean and applications thereof
CN102140472A
Specific promoter Glyma12g02240 of soybean root tissue and application of specific promoter Glyma12g02240
CN112813068A
Method for producing alpha-amylase by using transgenic soybean and expression vector
CN113584075A
Method for improving hemoglobin expression quantity of soybean seeds
CN117187298A