Flower specific promoter Ppel5 and application thereof

By screening and cloning the soybean flower-specific promoter Ppel5, the energy loss problem caused by constitutive promoters is solved, specific gene expression in soybean flower is achieved, and accurate molecular tools are provided for reproductive development regulation and color improvement.

CN120330188APending Publication Date: 2025-07-18JILIN ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510566177.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

In the prior art, the general expression characteristics of constitutive promoters such as the cauliflower mosaic virus 35S promoter (CaMV 35S) lead to a decrease in flower vitality and an increase in fernishing rate of soybean transgenic lines, lack of tissue-specific regulatory elements, making it difficult to achieve precise regulation of reproductive development.

Method used

By screening and cloning the upstream 1643bp regulatory sequence of the soybean flower-specific highly expressed gene Glyma.15G183700, named Ppel5, we constructed a flower-specific recombinant vector and recombinant bacteria to achieve specific activation of the target gene in soybean flower, and verified its specificity by using the Ppel5 promoter to drive the expression of the DsRed fluorescent reporter gene.

Benefits of technology

The specific gene expression in soybean flowers is achieved, energy consumption of non-target tissue is avoided, and accurate molecular tools are provided for the analysis of soybean flowers' development mechanism and the directional improvement of color traits, reducing the risk of gene flow mediated by transgenic flowers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330188A_ABST
    Figure CN120330188A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant biological breeding. The invention provides a flower specific promoter Ppel5 and an application thereof. The nucleotide sequence of the promoter Ppel5 is shown as SEQ ID NO. 1. The promoter can realize specific activation of a target gene in the soybean flower through a spatio-temporal expression regulation mechanism. The promoter element has dual application values in crop reproductive development basic research and precise molecular breeding technology development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant biological breeding, and particularly relates to a flower-specific promoter Ppel5 and its application. Background Art

[0002] During the sexual reproduction process of soybean, flower development involves precise biological processes such as meiotic recombination and gametophyte differentiation. Isolating and identifying flower-specific expression regulatory elements has dual value: at the basic research level, it can analyze the dynamic regulation network of inositol phosphate metabolism enzymes; at the application level, it can construct a biosafety barrier - by precisely editing germ cells through a spatio-temporally specific expression system, effectively avoiding the risk of gene flow mediated by transgenic flowers, and providing an innovative solution for creating ecologically safe male sterile lines.

[0003] In the gene expression regulation system, the molecular characteristics of the promoter determine the accuracy of genetic manipulation. The current crop improvement system overly relies on constitutive promoters (such as the cauliflower mosaic virus 35S promoter, CaMV 35S), and its pan-expression characteristics lead to dual physiological stresses: ① continuously activating exogenous genes causes abnormal ATP consumption; ② the accumulation of heterologous proteins in non-target tissues interferes with endogenous signal transduction, typically manifested as a decrease in flower vitality and an increase in the abortion rate of siliques in transgenic lines. This highlights the urgency of developing tissue-specific regulatory elements, especially in precise regulation fields such as reproductive development.

[0004] In view of this, isolating and obtaining promoters with specific expression characteristics is particularly important for plant functional gene research and crop genetic improvement. Summary of the Invention

[0005] The purpose of the present invention is to provide a flower-specific promoter Ppel5 and its application. By combining comparative transcriptome sequencing analysis with soybean genome information, a candidate gene Glyma.15G183700 specifically expressed in flower organs was screened, and a 1643bp regulatory sequence upstream of this gene was cloned and named Ppel5. qRT-PCR expression profile analysis showed that Glyma.15G183700 had the highest expression abundance in soybean flowers; the Ppel5-DsRed recombinant plasmid was transferred into soybean to obtain transgenic soybean plants, and further by observing the red fluorescence produced by the promoter Ppel5 initiating DsRed, the red fluorescence was only present in flowers, confirming the tissue-specific expression characteristics of the promoter Ppel5 in soybean flowers.

[0006] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a flower-specific expression promoter Ppel5, and the nucleotide sequence of the promoter Ppel5 is as shown in SEQ ID NO.1.

[0008] The present invention also provides the application of the promoter Ppel5 in the flower-specific expression of plants.

[0009] The present invention also provides a primer group for amplifying the promoter Ppel5. The primer group includes an upstream primer Ppel5-F1 and a downstream primer Ppel5-R1. The sequence of the upstream primer Ppel5-F1 is as shown in SEQ ID NO.4, and the sequence of the downstream primer Ppel5-R1 is as shown in SEQ ID NO.5.

[0010] The present invention also provides the application of the promoter Ppel5 in constructing a flower-specific expression recombinant vector.

[0011] The present invention also provides a flower-specific expression recombinant vector, which is the pCAMBIA3300 vector containing the promoter Ppel5.

[0012] The present invention also provides the application of the flower-specific expression recombinant vector in constructing a flower-specific expression recombinant bacterium.

[0013] The present invention also provides a flower-specific expression recombinant bacterium, which is Agrobacterium containing the flower-specific expression recombinant vector.

[0014] The present invention also provides the application of the flower-specific expression recombinant bacterium in constructing a transgenic plant with flower-specific expression.

[0015] The present invention also provides a method for constructing a transgenic plant with flower-specific expression by using the flower-specific expression recombinant bacterium, including the following steps: infecting a plant with the flower-specific expression recombinant bacterium to obtain the transgenic plant.

[0016] Preferably, the type of the plant is soybean.

[0017] The present invention provides a flower-specific promoter Ppel5 and its application. The nucleotide sequence of the promoter Ppel5 is shown as SEQ ID NO.1. Based on the combined analysis of soybean comparative transcriptome sequencing data and genomic information, the present invention screened and obtained a gene Glyma.15G183700 with high expression in flowers. A 1643bp regulatory sequence upstream of this gene was successfully cloned from the soybean variety Williams 82. qRT-PCR expression profile analysis showed that the expression abundance of Glyma.15G183700 in flowers was significantly higher than that in other tissues. To verify the promoter function, an expression vector driven by Ppel5 for the DsRed red fluorescent reporter gene was constructed and transformed into soybeans. Phenotypic observation showed that specific fluorescent signals were only observed in the flowers of transgenic plants, and no expression was seen in vegetative organs such as roots, stems, and leaves. The innovation of the present invention lies in the identification of the soybean flower-specific promoter Ppel5, which overcomes the problem of energy consumption in non-target tissues caused by traditional constitutive promoters, provides a precise molecular tool for analyzing the mechanism of soybean flower development and studying the gene network of flowering period regulation, and has important application value in genetic engineering breeding for resistance to flower rot and targeted improvement of flower color traits. Description of the Drawings

[0018] Figure 1 RT-qPCR detection results of the Glyma.15G183700 gene in different tissues;

[0019] Figure 2 PCR gel electrophoresis results for cloning the promoter Ppel5;

[0020] Figure 3 Cis-acting elements of the promoter Ppel5 sequence;

[0021] Figure 4 Color development results of the Ppel5-promoted red fluorescent protein in different tissue parts;

[0022] Figure 5 To obtain the pCAMBIA3300-Ppel5-DsRed expression vector. Detailed Implementation Modes

[0023] The present invention provides a flower-specific expression promoter Ppel5. The nucleotide sequence of the promoter Ppel5 is shown as SEQ ID NO.1:

[0024] SEQ ID NO.1:

[0025] GCACCATGATATTTGATGGGATGGAGTAAAATGTAAGAATAAACTCTCATTTTTGTCTCTAAGAGTGTGTTTGGATGGAGAAATTTAAAATTTTGAGAAATTTTAAATTCTAAGAATTTTAAATACTTGAATTGAAATTCTTTTATTTTCAAAATTTTGTATTTGGATAAAAAAAATTAAACTTATGAGATGAAAAAAATGAATTAAAAAAAAAGAAAATATGGTTGGTGTATTAGTTATACGTGTTCCTCTATGCTCACACCCAATCGATATTTTAGAAGCTCAGACGGTATTATTTTCTTGAAGAAGATTGTAAGAAGAGAATTTCAATTTATCACCTTTTAGAAGGAAATTGAAATTTCAAATTTTTAGTTGTTTAAAATTTTATTTTAAAATTTCAAAATTTTAAATTTTTCATAAAAAAGTATCTAAACAATGAATTCTAAATTACAGAAATTCAAATTTTATAATAAATTACTTTCCTCAATTAAAATTCTTTATCTAAACGCACACTAAAAGATATTGGTGATTGCAATTTAATTCCTAAAACATCTTTAGAAACAAAATAGTTCTTGAAAACTTTTCTATTGAACACTTATTAAGTCCTTCCGTCATGTGTCATTCAATAATTATATAATTGGTAAATTAGCCCCATACAATACATAAATACAGGAAAATAAGTCCCTAAAAGAATTATGCATTTAATTGAATTACTCCTTCAATTTAAAATTATGTATAATATTATTGACAAATTAGTCCCCTAGAAGTACAACGTGCCCTTTGGTCTAATTTTGTTGTCTTGACACGGGACTTCATTCTTTGAAACCGGCTAAAGATGTATGGATAATGTTATTTGACACTTTGAGAAAGAAAAAGAAACATTGGTATGATATATTATATGATTCCATAGGAAGAGAACAATAGAAAAAAATATCAAATAATTAAGTGTTTATTAATATATAAATATCCATTTATCATTACCGAAATACATATAATACAAGCTGAAAAATGAAGTATAATGTGAAAAACGATACTAAAAACTTAATAATTAAAATTACGAAAAAAATAATTAATTGCATGTTAAATAATTTACATAATTATTACATTATCAACCATAAATTTTTTAATTATTAGTCATTATTCCAAACCTTGTAATTTAAAATGACTGTATTAGCTGGAAGATCGAGTGAATCATAATGACCAAACTAGCAAAGCTGGTACTTGTCATACATGTTTCTACTTATAATTTTATTACCACAAGTGTTGTCTTATTTTTGGAAATGGACAGAACATATTTAGAAAAGAGTTTTCAAACCTGATCTGAGTATGAGAGAAGTTGACAACAAATGAATAACTACCTCACATCACCGTATTATTCCTTGCAGGTCCTTAACCAACTTCCAAAAATAGAAACACCTGAAACATCTCTCGTCCACACGTGCATGCCCAAACAATGATAAAATCCCAAACGCTCATGCAAGAAAGCAAAGGGGAAAGAGCCTAACATTAAACCAAGCAACGCTCGGTTCTCTTTTCTCTTTCACCATATCCATTGTCCCTTAAGTCTAAGGCAGAGTCTCCCCTCTGCCTTAGACACACCAATAATTTGCCAAGAAACCGAACCCAACCCAACCGCAACAACA。

[0026] The present invention also provides the application of the promoter Ppel5 in the flower-specific expression of plants.

[0027] The present invention also provides a primer set for amplifying the promoter Ppel5, and the primer set includes an upstream primer Ppel5-F1 and a downstream primer Ppel5-R1;

[0028] The sequence of the upstream primer Ppel5-F1 is as shown in SEQ ID NO.4;

[0029] SEQ ID NO.4:

[0030] Ppel5-F1: 5'-GCACCATGATATTTGATGGGATGG-3'

[0031] The sequence of the downstream primer Ppel5-R1 is as shown in SEQ ID NO.5:

[0032] SEQ ID NO.5:

[0033] Ppel5-R1: 5'-TGTTGTTGCGGTTGGGTTG-3'.

[0034] The present invention also provides the application of the promoter Ppel5 in constructing a flower-specific expression recombinant vector.

[0035] The present invention also provides a flower-specific expression recombinant vector, and the recombinant vector is a pCAMBIA3300 vector containing the promoter Ppel5.

[0036] The present invention also provides the application of the flower-specific expression recombinant vector in constructing a flower-specific expression recombinant bacterium.

[0037] The present invention also provides a flower-specific expression recombinant bacterium, and the recombinant bacterium is an Agrobacterium containing the flower-specific expression recombinant vector.

[0038] The present invention also provides the application of the flower-specific expression recombinant bacterium in constructing a transgenic plant with flower-specific expression.

[0039] The present invention also provides a method for constructing a transgenic plant with flower-specific expression by using the flower-specific expression recombinant bacterium, including the following steps: infecting a plant with the flower-specific expression recombinant bacterium to obtain the transgenic plant.

[0040] In the present invention, the type of the plant is soybean.

[0041] The technical solutions provided by the present invention are described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0042] Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. For the test methods without specific experimental conditions noted in the following examples, they are generally carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.

[0043] The soybean flower-specific promoter Ppel5 involved in the examples of the present invention can be amplified from the soybean genome. The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0044] The cloning vector pEASY-Blunt vector, the plant expression vector pCAMBIA3300, and the Agrobacterium tumefaciens EHA105 involved in the examples of the present invention are commercially available through conventional channels.

[0045] Example 1 Transcription levels of the Glyma.15G183700 gene in different tissues

[0046] Based on transcriptome data analysis, a gene Glyma.15G183700 (SEQ ID NO.6) that is strongly expressed in soybean flowers was selected. Further, the expression levels of the candidate gene Glyma.15G183700 in different tissues and organs of soybeans were verified by real-time quantitative PCR.

[0047] SEQ ID NO.6:

[0048] ATGCTGCATTACCCTTCCGCAGAAATGATGAGTGCTCCATCTTCTCAAGAATCACCAAAGAAACAACCTCAACAAGAAGCCCAATTGCAAGATCCTGCTGGTTCTGGCGATGGCAAAGAATCTGATACTAGAAATGTAGTTGGGGCTCAGCTTGACCAGAAAAAACAGCTAATTAAACCCAATCAATATAGGGAGTCCTCATCCACAATACCTGTGTCACAAGCAGTTACTCTCACTCGATCACCACAGAAGGGTAAGGAGCCTTTCTATCAGTCACCAAATCTCAATCGATCGTCATCTGAGAAACATCCTCAGAGGGATATTGGTTCAGAAGAAATTGCAATTTTGTTTGGCTCAGAAAAAAAGGAAGCCCTGACAAGTAATCTGATACAACCTAATCTAGAGCAAGGTGGTATACAGTATTCTGAGAAGAGGACCTCACTGGGGAGAATTCCCAGTAATGTGAAGAAAATGATAAGTGCCTTTGAAGGTGGATTGGCTCAGGATAAGAGACCTCAGATTAAACCACCTCCAACAAAACAACAAGAAAGTTCAATTGAAAGAAGAGATTCTTCCAAGACTCAGCTTTTGGAGCAAGATAAGTCAAAGAACACAGAACCAGCAGACTTGCATGAAAGGGTGAAAAGAGCCTCCCTGAATGAAGCAAATGCTGGAACTGGAACTGAGGAGGGCGAGTATGAAAAGATACGGGAAACTAAAGAATCAAAGCCCAAGACTTCTGATAATAATGGAGATGAAAATTCTGGAGGACCATTTAATCAGGTAGTAAAAGTTGCAATCATTATAGGATTTGGATTACTTGTTCTCCTAACCAGACAAAGAAAAAGAAGTAATGGCGAGGGGCAAAAGGATGTATTTAACTTTCTGAATTTACCAGAATG。

[0049] The specific method is as follows:

[0050] Total RNA was extracted from root, leaf, stem, pod, seed and other tissue samples of soybean plants at the mature stage. Real-time quantitative PCR was performed using specific primers Glyma.15G183700-F1 / Glyma.15G183700-R1.

[0051] The detection instrument was ABIPRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA). The internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression level of the gene was detected by the 2 –ΔΔCT (Livak) method.

[0052] The RT-qPCR program was as follows: 94 °C for 10 min; (94 °C for 45 s, 60 °C for 45 s, 72 °C for 30 s) for 35 cycles; 72 °C for 10 min.

[0053] The RT-qPCR system was SYBR Green PCR Master Mix 10 μL, cDNA 2 μL, forward primer 0.2 μL, reverse primer 0.2 μL, and supplemented with ddH2O to 20 μL.

[0054] The results showed that the expression level of the Glyma.15G183700 gene was the highest in flowers, and almost no expression was detected in other tissues such as leaves and stems ( Figure 1 ), confirming the flower-specific expression characteristics of the Glyma.15G183700 gene. The sequences of the quantitative primers were as follows:

[0055] Glyma.15G183700-F1:

[0056] TTGCCTGCTGGTTCAATTCCTG (SEQ ID NO.2);

[0057] Glyma.15G183700-R1:

[0058] CACGGTCTCATCGTACACTCCT (SEQ ID NO.3).

[0059] Example 2 Cloning of the Ppel5 promoter

[0060] Specific primers were designed according to the genomic promoter sequence of soybean Glyma.15G183700 for PCR amplification. The amplified products were electrophoretically separated on 1% agarose gel (the electrophoresis results were as Figure 2As shown). The agarose gel containing the amplification product was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), then transformed into competent cells (DH5α). Positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was confirmed to be 1643 bp by sequencing. After the sequence comparison was correct, the inventor named this sequence fragment as the root-specific promoter Ppel5, and its nucleotide sequence is shown in SEQ ID NO.1.

[0061] The PCR program was as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.

[0062] The PCR amplification system of the present invention was: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.

[0063] The amplification primers for the Ppel5 promoter were:

[0064] Forward primer Ppel5-F1:

[0065] 5'-GCACCATGATATTTGATGGGATGG-3' (SEQ ID NO.4);

[0066] Reverse primer Ppel5-R1:

[0067] 5'-TGTTGTTGCGGTTGGGTTG-3' (SEQ ID NO.5).

[0068] Example 3 Analysis of cis-acting elements of promoter Ppel5

[0069] The PlantPAN 4.0 online software was used to analyze the cis-acting elements of the promoter Ppel5 sequence cloned in Example 1. The results showed that there were a large number of cis-acting elements related to floral tissue-specific expression on the promoter sequence, including AE-box (AGAAACCA), Gap-box (AGATAGATA), LTR (CCGAAA), G-Box (CACGTG), ABRE (CACGTGGC), MRE (CACTAACCT), CAT-box (GCCACT), MBS (TAACTG), Box 4 (ATTAAT), etc. Figure 3) LTR and MBS elements are involved in low-temperature response and drought induction, and may be related to the stress response of flowers. G-Box and Box 4 are cis-acting regulatory elements involved in light response and may be related to the photoperiod regulation of flowers.

[0070] Example 4 Obtaining of Transgenic Soybeans Containing pCAMBIA3300-Ppel5-DsRed Expression Vector

[0071] In this method, pCAMBIA3300 (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) was double-digested with EcoRⅠ and HindⅢ and then ligated with the red fluorescent protein reporter gene DsRed to optimize and obtain pCAMBIA3300-DsRed.

[0072] The promoter Ppel5 fragment cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Ppel5-DsRed expression vector ( Figure 5 ) The vector plasmid was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. Agrobacterium-mediated transformation was used, and the variety for transformation was Jiyu 86. The specific transformation process is as follows:

[0073] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (100 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP) until the OD600nm reaches 0.6. The bacterial cells were centrifuged at 3000 rpm for 10 min and then resuspended in the liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellin (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and the OD600nm was adjusted to 0.5 for use.

[0074] (2) Agrobacterium infection

[0075] Use a scalpel to cut open the soybean flower along the hilum of the soybean seed, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in resuspended Agrobacterium for 30 min. Transfer the infected explants to the co-culture medium (B5 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubate them in the dark at 23 °C for 4 d.

[0076] (3) Adventitious bud induction

[0077] After 4 d of co-culturing the explants, transfer the explants to the induction medium (B5 salts 3.21 g / L, B5 vitamins, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 6 mg / L, agar powder 8 g / L, pH 5.7). The adaxial surface of the cotyledon node and hypocotyl parts of the explants should be inserted into the medium upward and at a 45° angle to the horizontal plane, and cultured at 25 °C under a 16 / 8 h light / dark cycle for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium and continue to culture for 2 weeks under the same culture conditions.

[0078] (4) Bud elongation

[0079] Transfer the induced multiple buds (removing the cotyledon tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 6 mg / L, agar powder 8 g / L, pH 5.7) for culture, and the culture conditions are 25 °C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.

[0080] (5) Rooting

[0081] When the resistant buds grow to 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. Transplant them to the greenhouse to grow and set seeds when strong roots have grown.

[0082] Using the specific primers of promoter Ppel5, PCR detection was performed on the T1 generation transgenic soybeans. Combined with herbicide screening, after obtaining the transgenic soybeans containing Ppel5-DsRed, the red fluorescence was observed.

[0083] Example 5 Observation of Red Fluorescence in Different Parts of Promoter pCAMBIA3300-Ppel5-DsRed Transgenic Soybean Plants

[0084] The LUYOR-3415RG dual-wavelength fluorescence imaging system was used to perform tissue-specific expression analysis on the T1 generation Ppel5-DsRed transgenic soybean plants. The results showed that red fluorescence was present in the middle flowers of the transgenic soybean plants ( Figure 4 ), further verifying the tissue-specific expression of promoter Ppel5 in flower tissues.

[0085] From the above examples, it can be seen that the present invention provides a flower-specific promoter Ppel5 and its application. The nucleotide sequence of the promoter Ppel5 is shown in SEQ ID NO.1. Through the spatio-temporal expression regulation mechanism, this promoter can specifically activate the target gene in soybean flowers. This promoter element has dual application values in the basic research of crop reproductive development and the development of precision molecular breeding technologies.

[0086] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A flower-specifically expressed promoter Ppel5, characterized in that, The nucleotide sequence of the promoter Ppel5 is shown as SEQ ID NO.

1.

2. Use of the promoter Ppel5 described in claim 1 in the flower-specific expression of plants.

3. A primer set for amplifying the promoter Ppel5 described in claim 1, characterized in that, The primer set includes an upstream primer Ppel5-F1 and a downstream primer Ppel5-R1. The sequence of the upstream primer Ppel5-F1 is shown as SEQ ID NO.4, and the sequence of the downstream primer Ppel5-R1 is shown as SEQ ID NO.

5.

4. Use of the promoter Ppel5 described in claim 1 in the construction of a flower-specific expression recombinant vector.

5. A flower-specific expression recombinant vector, characterized in that, The recombinant vector is the pCAMBIA3300 vector containing the promoter Ppel5 described in claim 1.

6. Use of the flower-specific expression recombinant vector described in claim 5 in the construction of a flower-specific expression recombinant bacterium.

7. A flower-specific expression recombinant bacterium, characterized in that, The recombinant bacterium is Agrobacterium containing the flower-specific expression recombinant vector described in claim 5.

8. Use of the flower-specific expression recombinant bacterium described in claim 7 in the construction of a transgenic plant with flower-specific expression.

9. A method for constructing a flower-specifically expressing transgenic plant using the flower-specifically expressing recombinant bacterium described in claim 7, characterized in that, Comprising the following steps: Infecting a plant with the flower-specific expression recombinant bacterium described in claim 7 to obtain the transgenic plant.

10. The method according to claim 9, wherein The plant species is soybean.