Flower specific promoter Ppel6 and application thereof

By screening and cloning the soybean flower-specific promoter Ppel6, flower-specific expression vectors and recombinant bacteria were constructed, which solved the problem of soybean pollen transmission control and metabolic disorders in the prior art, and achieved the specific gene expression and genetic improvement effects in soybean flower.

CN120330189APending Publication Date: 2025-07-18JILIN ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510566178.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

In the prior art, non-selective activation of constitutive promoters such as CaMV 35S leads to metastatic disorders and abnormal biomass consumption in transgenic plants, making it difficult to achieve effective control of soy pollen transmission, and there is a lack of endogenous specific promoters, affecting the genetic improvement effect.

Method used

Soybean flower-specific expression gene Glyma.17G044700 was screened through transcriptome sequencing analysis, the promoter Ppel6 was designed and cloned, and the Ppel6-DsRed fusion expression vector was constructed to verify its specific expression in soybean flower. The flower-specific expression recombinant bacteria were constructed by Agrobacterium mediating method to achieve specific gene expression in soybean flower.

Benefits of technology

The specific gene expression in soybean flowers is achieved, the agronomic trait retention rate of transgenic plants is enhanced, the interference with the normal physiological activities of the plants is reduced, and the effective reproductive isolation barrier is provided, and biosafety is improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330189A_ABST
    Figure CN120330189A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant biological breeding. The invention provides a flower-specific promoter Ppel6 and an application thereof. The nucleotide sequence of the promoter Ppel6 is as shown in SEQ ID NO. 1. The promoter disclosed by the invention can drive a target gene, so that specific expression in the soybean flower is realized. The promoter has a high application value in research on regulation and control of expression of genes related to plant flower development and research on improvement of soybean varieties by utilizing genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant biological breeding, and particularly relates to a flower-specific promoter Ppel6 and its application. Background Art

[0002] As an important global crop for both oil and food, the development of genetic improvement technologies for soybean has attracted much attention. With the commercial promotion of genetically modified soybeans, their ecological safety issues have received increasing attention: the gene drift mediated by pollen of exogenous genes may enable wild relatives to obtain resistant traits and form uncontrollable superweeds. Research shows that constructing a fusion expression system of an organ-specific promoter of flowers and a pollen abortion gene can directionally induce abnormal pollen development or programmed apoptosis in transgenic plants, thereby establishing an effective reproductive isolation barrier. This strategy can not only maintain the agronomic traits of transgenic crops but also block more than 98% of the pollen transmission risks, providing an innovative solution for the biosafety control of transgenic crops.

[0003] The molecular mechanism analysis of promoters is the core content of gene expression regulation research. Constitutive promoters such as CaMV 35S widely used in traditional genetic improvement can achieve the continuous expression of exogenous genes, but their non-selective activation characteristics lead to physiological disorders in plants, such as abnormal consumption of biomass, specifically manifested as a 21% reduction in plant height and blocked grain filling. In contrast, tissue-specific promoters can ensure the efficient expression of target genes in specific organs through precise spatio-temporal regulation and minimize the interference with the normal physiological activities of plants, increasing the retention rate of agronomic traits of transgenic plants to more than 93%. This precise regulation system provides a better molecular tool selection for crop genetic improvement.

[0004] In view of this, it is particularly important to isolate and obtain promoters with specific expression characteristics for plant functional gene research and crop genetic improvement. Summary of the Invention

[0005] The purpose of the present invention is to provide a flower-specific promoter Ppel6 and its application. By combining comparative transcriptome sequencing analysis with soybean genome information, a soybean flower-specific expression gene Glyma.17G044700 was screened and its promoter was cloned and named Ppel6. Research shows that through real-time fluorescence quantitative PCR detection, Glyma.17G044700 has the highest expression abundance in soybean flowers; by constructing a Ppel6-DsRed fusion expression vector and transferring it into soybeans, it was found that red fluorescence signals only exist in the flowers of transgenic soybean plants, confirming the tissue-specific expression characteristics of the promoter Ppel6 in soybean flowers.

[0006] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a flower-specific expression promoter Ppel6, and the nucleotide sequence of the promoter Ppel6 is shown as SEQ ID NO.1.

[0008] The present invention also provides the application of the promoter Ppel6 in the flower-specific expression of plants.

[0009] The present invention also provides a primer set for amplifying the promoter Ppel6. The primer set includes an upstream primer Ppel6-F1 and a downstream primer Ppel6-R1. The sequence of the upstream primer Ppel6-F1 is shown as SEQ ID NO.4, and the sequence of the downstream primer Ppel6-R1 is shown as SEQ ID NO.5.

[0010] The present invention also provides the application of the promoter Ppel6 in constructing a flower-specific expression recombinant vector.

[0011] The present invention also provides a flower-specific expression recombinant vector, and the recombinant vector is the pCAMBIA3300 vector containing the promoter Ppel6.

[0012] The present invention also provides the application of the flower-specific expression recombinant vector in constructing a flower-specific expression recombinant bacterium.

[0013] The present invention also provides a flower-specific expression recombinant bacterium, and the recombinant bacterium is Agrobacterium containing the flower-specific expression recombinant vector.

[0014] The present invention also provides the application of the flower-specific expression recombinant bacterium in constructing a transgenic plant with flower-specific expression.

[0015] The present invention also provides a method for constructing a transgenic plant with flower-specific expression by using the flower-specific expression recombinant bacterium, including the following steps: infecting a plant with the flower-specific expression recombinant bacterium to obtain the transgenic plant.

[0016] Preferably, the type of the plant is soybean.

[0017] The present invention provides a flower-specific promoter Ppel6 and its application. The nucleotide sequence of the promoter Ppel6 is shown as SEQ ID NO.1. The promoter of the present invention can drive a target gene, thereby realizing specific expression in soybean flowers. This promoter has high application value in the research on the expression regulation of genes related to plant flower development and the research on improving soybean varieties by genetic engineering.

[0018] The promoter Ppel6 in the present invention is based on the combination of comparative transcriptome sequencing analysis and soybean genome information. The gene Glyma.17G044700 that is specifically expressed in soybean flowers was screened. Specific primers were designed according to the soybean genome sequence, and a 1761bp regulatory sequence upstream of it was cloned from the soybean Williams 82 genome. The results of real-time fluorescence quantitative PCR showed that Glyma.17G044700 had the highest expression abundance in flowers. To verify the function of the promoter, an expression vector of Ppel6-DsRed red fluorescent reporter gene was constructed and transferred into soybeans. Phenotypic observation showed that red fluorescence was only detected in the flowers of transgenic plants, indicating that this promoter was only specifically expressed in soybean flower tissues. Compared with the existing technology, the present invention overcomes the current shortage of endogenous specific promoters in soybeans and has important application value in analyzing gene functions and genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 RT-qPCR detection results of the Glyma.17G044700 gene in different tissues;

[0020] Figure 2 PCR gel electrophoresis results for cloning the promoter Ppel6;

[0021] Figure 3 cis-acting elements of the promoter PGmIPMIE sequence;

[0022] Figure 4 Color development results of the Ppel6 promoter-driven red fluorescent protein in different tissue parts;

[0023] Figure 5 To obtain the pCAMBIA3300-Ppel6-DsRed expression vector. DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention provides a promoter Ppel6 that is specifically expressed in flowers. The nucleotide sequence of the promoter Ppel6 is shown in SEQ ID NO.1:

[0025] SEQ ID NO.1:

[0026]

[0027] The present invention also provides the application of the promoter Ppel6 in the flower-specific expression of plants.

[0028] The present invention also provides a primer set for amplifying the promoter Ppel6, and the primer set includes an upstream primer Ppel6-F1 and a downstream primer Ppel6-R1;

[0029] The sequence of the upstream primer Ppel6-F1 is shown as SEQ ID NO.4;

[0030] SEQ ID NO.4:

[0031] 5'-TCACAAGGATGCCAATGCCT-3';

[0032] The sequence of the downstream primer Ppel6-R1 is shown as SEQ ID NO.5:

[0033] SEQ ID NO.5:

[0034] 5'-TGTGAGAGTTTCTCTAAGGCAGA-3'.

[0035] The present invention also provides the application of the promoter Ppel6 in constructing a flower-specific expression recombinant vector.

[0036] The present invention also provides a flower-specific expression recombinant vector, and the recombinant vector is a pCAMBIA3300 vector containing the promoter Ppel6.

[0037] The present invention also provides the application of the flower-specific expression recombinant vector in constructing a flower-specific expression recombinant bacterium.

[0038] The present invention also provides a flower-specific expression recombinant bacterium, and the recombinant bacterium is an Agrobacterium containing the flower-specific expression recombinant vector.

[0039] The present invention also provides the application of the flower-specific expression recombinant bacterium in constructing a transgenic plant with flower-specific expression.

[0040] The present invention also provides a method for constructing a transgenic plant with flower-specific expression by using the flower-specific expression recombinant bacterium, including the following steps: infecting a plant with the flower-specific expression recombinant bacterium to obtain the transgenic plant.

[0041] In the present invention, the type of the plant is soybean.

[0042] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field. The test methods without specific experimental conditions in the following examples usually follow the conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0044] The soybean flower-specific promoter Ppel6 involved in the embodiments of the present invention can be amplified from the soybean genome. The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0045] The cloning vector pEASY-Blunt vector, plant expression vector pCAMBIA3300, and Agrobacterium EHA105 involved in the embodiments of the present invention can be obtained commercially through conventional means.

[0046] Example 1 Transcriptional levels of the Glyma.17G044700 gene in different tissues

[0047] Based on transcriptome data analysis, a gene Glyma.17G044700 (SEQ ID NO.6) that is strongly expressed in soybean flowers was selected. Further, the expression levels of the candidate gene Glyma.17G044700 in different tissues and organs of soybean were verified by real-time quantitative PCR.

[0048] SEQ ID NO.6:

[0049]

[0050] The specific method is as follows:

[0051] Total RNA was extracted from tissue samples of roots, leaves, stems, pods, seeds, etc. of soybean plants at the mature stage. Real-time quantitative PCR was performed using specific primers Glyma.17G044700-F1 / Glyma.17G044700-R1.

[0052] The detection instrument was ABIPRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), the internal reference gene was GmACT6 (GenBank No. NM_001289231), and the relative expression level of the gene was detected by the 2 –ΔΔCT (Livak) method.

[0053] The RT-qPCR program was as follows: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min.

[0054] The RT-qPCR system was SYBR Green PCR Master Mix 10 μL, cDNA 2 μL, forward primer 0.2 μL, reverse primer 0.2 μL, and supplemented with ddH2O to 20 μL.

[0055] The results showed that the expression level of the Glyma.17G044700 gene was the highest in flowers, and almost no expression was detected in other tissues such as leaves and stems ( Figure 1 ), confirming the flower-specific expression characteristics of the Glyma.17G044700 gene. The sequences of the quantitative primers were as follows:

[0056] Glyma.17G044700-F1:

[0057] AAGCTCTTTGAGGATGCCAAGG (SEQ ID NO.2);

[0058] Glyma.17G044700-R1:

[0059] CAGAATGGCAAGGGAGTTGCT (SEQ ID NO.3).

[0060] Example 2 Cloning of the Ppel6 promoter

[0061] Specific primers were designed according to the genomic promoter sequence of soybean Glyma.17G044700 for PCR amplification, and the amplified products were electrophoretically separated on a 1% agarose gel (the electrophoresis results were asFigure 2 As shown in the figure). The agarose gel containing the amplification product was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), then transformed into competent cells (DH5α). Positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was confirmed to be 1761 bp by sequencing. After the sequence comparison was correct, the inventor named this sequence fragment the root-specific promoter Ppel6, and its nucleotide sequence is shown in SEQ ID NO.1.

[0062] The PCR program is as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.

[0063] The PCR amplification system of the present invention is: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.

[0064] The amplification primers for the Ppel6 promoter are:

[0065] Forward primer Ppel6-F1:

[0066] 5'-TCACAAGGATGCCAATGCCT-3' (SEQ ID NO.4);

[0067] Reverse primer Ppel6-R1:

[0068] 5'-TGTGAGAGTTTCTCTAAGGCAGA-3' (SEQ ID NO.5).

[0069] Example 3 Analysis of cis-acting elements of promoter Ppel6

[0070] The PlantPAN 4.0 online software was used to analyze the cis-acting elements of the promoter Ppel6 sequence cloned in Example 1. The results showed that a large number of cis-acting elements related to floral tissue-specific expression were contained in the promoter sequence, including AE-box (AGAAACCA), Gap-box (AGATAGATA), LTR (CCGAAA), G-Box (CACGTG), ABRE (CACGTGGC), MRE (CACTAACCT), CAT-box (GCCACT), MBS (TAACTG), Box 4 (ATTAAT), etc. Figure 3) LTR and MBS elements are involved in low-temperature response and drought induction, and may be related to the stress response of flowers. G-Box and Box 4 are cis-acting regulatory elements involved in light response and may be related to the photoperiod regulation of flowers.

[0071] Example 4 Obtaining Transgenic Soybeans Containing the pCAMBIA3300-Ppel6-DsRed Expression Vector

[0072] In this method, pCAMBIA3300 (purchased from Beijing TransGen Biotech Co., Ltd.) was double-digested with EcoRⅠ and HindⅢ and then ligated with the red fluorescent protein reporter gene DsRed to optimize and obtain pCAMBIA3300-DsRed.

[0073] The promoter Ppel6 fragment cloned on the pEASY-Blunt vector was seamlessly inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Ppel6-DsRed expression vector ( Figure 5 ) The vector plasmid was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. The transformation was carried out by the Agrobacterium-mediated method, and the variety for transformation was Jiyu 86. The specific transformation process is as follows:

[0074] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (100 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP) until the OD600nm reaches 0.6. The cells were centrifuged at 3000 rpm for 10 min and then resuspended in the liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellin (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and the OD600nm was adjusted to 0.5 for use.

[0075] (3) Agrobacterium infection

[0076] Use a scalpel to cut open the soybean flower along the hilum of the soybean seed, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in resuspended Agrobacterium for 30 minutes of infection. Transfer the infected explants to the co-culture medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubate in the dark at 23 °C for 4 days.

[0077] (4) Adventitious bud induction

[0078] After 4 days of co-culturing the explants, transfer the explants to the induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 6 mg / L, agar powder 8 g / L, pH 5.7). The adaxial surface of the cotyledon node and hypocotyl parts of the explants should be inserted into the medium facing upwards and at a 45° angle to the horizontal plane, and cultured under a 16 / 8 h light / dark cycle at 25 °C for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium for continued culture for 2 weeks under the same culture conditions.

[0079] (5) Bud elongation

[0080] Transfer the induced clustered buds (removing the cotyledon tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 6 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions are 25 °C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.

[0081] (6) Rooting

[0082] When the resistant buds grow to 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. Transplant them to the greenhouse for growth and fruiting when strong roots have grown.

[0083] Using the specific primers of promoter Ppel6, the T1 generation transgenic soybeans were detected by PCR, combined with herbicide screening. After obtaining the transgenic soybeans containing Ppel6-DsRed, the red fluorescence was observed.

[0084] Example 5 Observation of Red Fluorescence in Different Parts of Promoter pCAMBIA3300-Ppel6-DsRed Transgenic Soybean Plants

[0085] The LUYOR-3415RG dual-wavelength fluorescence imaging system was used to perform tissue-specific expression analysis on the T1 generation Ppel6-DsRed transgenic soybean plants. The results showed that red fluorescence was present in the flowers of the transgenic soybean plants, ( Figure 4 ), further verifying the tissue-specific expression of promoter Ppel6 in flower tissues.

[0086] As can be seen from the above examples, the present invention provides a flower-specific promoter Ppel6 and its application. The nucleotide sequence of the promoter Ppel6 is shown in SEQ ID NO.1. The promoter of the present invention can drive the target gene, thereby achieving specific expression in soybean flowers. This promoter has high application value in the research on the expression regulation of genes related to plant flower development and the research on improving soybean varieties by genetic engineering.

[0087] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A flower-specifically expressed promoter Ppel6, characterized in that, The nucleotide sequence of the promoter Ppel6 is shown in SEQ ID NO.

1.

2. Use of the promoter Ppel6 according to claim 1 in plant flower-specific expression.

3. A primer set for amplifying the promoter Ppel6 described in claim 1, characterized in that, The primer set includes an upstream primer Ppel6-F1 and a downstream primer Ppel6-R1. The sequence of the upstream primer Ppel6-F1 is shown in SEQ ID NO.4, and the sequence of the downstream primer Ppel6-R1 is shown in SEQ ID NO.

5.

4. Use of the promoter Ppel6 according to claim 1 in constructing a flower-specific expression recombinant vector.

5. A flower-specific expression recombinant vector, characterized in that, The recombinant vector is the pCAMBIA3300 vector containing the promoter Ppel6 according to claim 1.

6. Use of the flower-specific expression recombinant vector according to claim 5 in constructing a flower-specific expression recombinant bacterium.

7. A flower-specifically expressing recombinant bacterium, characterized in that, The recombinant bacterium is Agrobacterium containing the flower-specific expression recombinant vector according to claim 5.

8. Use of the flower-specific expression recombinant bacterium according to claim 7 in constructing a transgenic plant with flower-specific expression.

9. A method for constructing a flower-specifically expressed transgenic plant by using the flower-specifically expressed recombinant bacterium described in claim 7, characterized in that, Comprising the following steps: Infecting a plant with the flower-specific expression recombinant bacterium according to claim 7 to obtain the transgenic plant.

10. The method according to claim 9, wherein The type of the plant is soybean.