Soybean leaf specific promoter Pcaab1 and application thereof

By cloning and verifying the soybean leaf-specific promoter Pcab1, the metabolic load and heterologous protein accumulation caused by constitutive promoters are solved, specific gene expression in soybean leaves are achieved, and the ecological safety and production efficiency of transgenic soybeans are improved.

CN120330190AActive Publication Date: 2025-07-18JILIN ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510566184.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-18
Estimated Expiration
2045-04-30

AI Technical Summary

Technical Problem

In the existing soybean transgenic technology, the metabolic load caused by constitutive promoters, the accumulation of heterologous proteins in non-target tissues and the high frequency of transgene silencing. The lack of effective leaf-specific promoters leads to ecological risks and low production efficiency.

Method used

The soybean leaf-specific promoter Pcab1 is provided. By designing specific primers to amplify and clone the promoter, the expression vector containing Pcab1 is constructed, and the soybean explant is transformed using Agrobacterium to achieve specific expression of the red fluorescent protein DsRed in soybean leaves to verify the specific expression of the promoter in the leaves.

Benefits of technology

It has achieved specific gene expression in soybean leaves, reduced ecological risks, improved the ecological security and production efficiency of genetically modified soybeans, and promoted crop improvement to enter the intelligent breeding stage of tissue-specific-metabolic orientation-dynamic regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330190A_ABST
    Figure CN120330190A_ABST
Patent Text Reader

Abstract

The invention provides a soybean leaf specific promoter Pcaab1 and application thereof, and belongs to the technical field of plant biological breeding. The nucleotide sequence of the soybean leaf specific promoter Pcaab1 provided by the invention is as shown in SEQ ID NO.4. Specific expression of a target gene driven by the promoter in soybean leaves can be realized, and a core molecular component is provided for improvement of photosynthetic efficiency of crops and construction of a plant factory efficient biosynthesis system; the method has a high application value in research on regulation of plant gene expression and improvement of soybean varieties by using gene engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant biological breeding, and particularly relates to a soybean leaf-specific promoter Pcab1 and its application. Background Art

[0002] Soybean is an important food and oil crop in the world. In recent years, genetically modified soybeans have been successfully commercialized. While bringing benefits, their potential ecological risks and possible environmental problems have attracted much attention. As the core organ of photosynthesis, the leaf-specific promoter can achieve spatio-temporal specific expression of foreign genes in the chloroplasts of mesophyll cells, avoiding problems such as root growth inhibition or abnormal reproductive growth caused by constitutive promoters.

[0003] With the breakthrough of genetic transformation technology, as the core element of gene expression regulation, the engineering application value of promoters has become increasingly prominent. In the crop transgenic system, constitutive strong promoters drive the continuous expression of foreign genes throughout the whole domain, which easily causes multiple negative effects: ① continuously activating foreign genes leads to an increase in metabolic load; ② the accumulation of heterologous proteins in non-target tissues interferes with the endogenous signal pathway; ③ the frequency of transgene silencing increases. In contrast, tissue-specific promoters can not only achieve efficient enrichment of target products in specific organs by precisely positioning the spatio-temporal pattern of gene expression, but also maintain the basic metabolic homeostasis of plants, showing unique advantages in applications such as the directional expression of C4 metabolic enzymes in photosynthetic tissues.

[0004] Therefore, providing a soybean leaf-specific promoter provides a new strategy for soybean-specific expression regulation, reduces ecological risks, improves the ecological safety and production efficiency of genetically modified soybeans, and promotes the sustainable development of agriculture. Summary of the Invention

[0005] The purpose of the present invention is to provide a soybean leaf-specific promoter Pcab1, and the target gene driven by this promoter can be specifically expressed in soybean leaf tissues, overcoming the current lack of endogenous specific promoters in soybeans.

[0006] The present invention provides a soybean leaf-specific promoter Pcab1, and the nucleotide sequence of the soybean leaf-specific promoter Pcab1 is as shown in SEQ ID NO.4.

[0007] Preferably, the primer group for amplifying the soybean leaf-specific promoter Pcab1 is Pcab1-F1 and Pcab1-R1. The sequence of Pcab1-F1 is as shown in SEQ ID NO.5, and the sequence of Pcab1-R1 is as shown in SEQ ID NO.6.

[0008] The present invention also provides an expression cassette containing the promoter Pcab1.

[0009] The present invention also provides an application of the promoter Pcab1 or the expression cassette in transgenic soybeans.

[0010] Preferably, the construction method of the transgenic soybeans comprises the following steps:

[0011] (1) Construct an expression vector containing the soybean leaf-specific promoter Pcab1 and a target gene;

[0012] (2) Transform the expression vector of step (1) into Agrobacterium tumefaciens;

[0013] (3) Infect soybean explants with the Agrobacterium tumefaciens of step (2), and cultivate to take root to obtain transgenic soybean plants.

[0014] Preferably, the backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

[0015] The present invention clones the soybean leaf-specific promoter Pcab1 from the soybean variety Williams 82, fuses it with the red fluorescent protein DsRed gene and transfers it into soybeans. By observing the color development of the red fluorescent protein in transgenic soybean plants, it is found that the color only appears in soybean leaves, indicating that the promoter is specifically expressed only in soybean leaf tissues. Compared with the prior art, the present invention overcomes the current shortage of endogenous specific promoters in soybeans and has important application value in analyzing gene functions and directional genetic improvement, promoting crop improvement into a new stage of intelligent breeding of "tissue-specific - metabolism-directed - dynamic regulation". Description of the Drawings

[0016] Figure 1 Shows the relative expression levels of the Glyma.08G082900.1 gene in different parts in Example 1;

[0017] Figure 2 Shows the PCR gel electrophoresis results of cloning the promoter Pcab1 in Example 2;

[0018] Figure 3 Shows the cis-acting elements of the promoter Pcab1 sequence in Example 3;

[0019] Figure 4 Shows the map of the pCAMBIA3300-Pcab1-DsRed recombinant expression vector in Example 4;

[0020] Figure 5 Shows the color development results of the Pcab1-promoted red fluorescent protein in the leaf part in Example 5. Detailed Embodiments

[0021] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0022] The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0023] Example 1 verified the transcriptional levels of the Glyma.08G082900.1 gene in different tissues

[0024] Based on transcriptome data analysis, one gene, Glyma.08G082900.1, which was strongly expressed in soybean leaves, was selected. Further, the expression levels of the candidate gene Glyma.08G082900.1 in different tissues and organs of soybean were verified by real-time quantitative PCR. The specific method was as follows: Total RNA was extracted from tissue samples such as roots, leaves, stems, pods, and seeds of soybean plants at the mature stage. Real-time quantitative PCR detection was performed using specific primers Glyma.08G082900.1-F1 and Glyma.08G082900.1-R1. The detection instrument was ABIPRISM 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected by the 2 –ΔΔCT (Livak) method. The RT-qPCR system was 10 μL of SYBR Green PCR Master Mix, 2 μL of cDNA, 0.2 μL of forward primer, 0.2 μL of reverse primer, and supplemented with ddH2O to 20 μL. The RT-qPCR program was as follows: 94°C for 10 min; (94°C for 45 s; 60°C for 45 s; 72°C for 30 s) for 35 cycles; 72°C for 10 min. The results are as Figure 1 shown.

[0025] The sequence of Glyma.08G082900.1 is shown in SEQ ID NO.1, and the specific sequence is as follows:

[0026] ATGGCAGCAGCTTCTTCCATGGCTCTCTCATCCCCATCCTTGGCTGGCAAGGCCGTGAAGCTGGGCCCATCAGCCCCAGAAGTGGGAAGGGTGAGCATGAGGAAGACCGTCACCAAGCAGGTCTCCTCAGGAAGCCCATGGTACGGCCCAGACCGAGTCAAGTACTTGGGCCCATTCTCTGGCGAGCCCCCGTCCTACCTAACCGGTGAGTTCCCAGGCGACTACGGCTGGGACACTGCTGGGCTTTCCGCAGACCCAGAAACCTTCGCCAAGAACCGTGAACTCGAAGTGATCCACTCCAGGTGGGCCATGCTCGGAGCCTTGGGCTGCGTCTTCCCGGAGTTGCTGTCCCGCAACGGGGTGAAGTTCGGAGAAGCCGTGTGGTTCAAGGCCGGGTCCCAGATCTTCAGCGAGGGTGGGCTCGACTACTTGGGCAACCCAAGCCTGATCCACGCCCAGAGCATCCTCGCCATCTGGGCCACACAAGTTATCCTAATGGGTGCCGTTGAAGGTTACCGTATTGCTGGTGGCCCCCTCGGTGAGGTCACTGACCCAATCTACCCAGGTGGCAGCTTCGACCCATTGGGCCTTGCTGATGACCCAGAGGCTTTTGCTGAGCTTAAGGTGAAGGAACTCAAGAACGGACGATTGGCCATGTTCTCTATGTTTGGCTTCTTTGTTCAGGCCATTGTCACCGGAAAGGGTCCATTGGAGAACCTCGCCGATCACCTTGCTGACCCTGTCAACAACAACGCCTGGGCCTATGCCACCAACTTCGTCCCCGGAAAGTGA;

[0027] The sequence of the specific primer Glyma.08G082900.1-F1 is shown in SEQ ID NO.2, and the specific sequence is: AACCGTGAACTCGAAGTGATCC;

[0028] The sequence of the specific primer Glyma.08G082900.1-F1 is shown in SEQ ID NO.3, and the specific sequence is: GGATAACTTGTGTGGCCCAGAT.

[0029] As can be seen from Figure 1 , the expression level of the Glyma.08G082900.1 gene is the highest in leaves, and almost no expression can be detected in other tissues such as stems and seeds, which confirms the tissue-specific expression characteristics of the Glyma.08G082900.1 gene in leaf tissues.

[0030] Example 2: Cloning of promoter Pcab1

[0031] Specific primers Pcab1-F1 and Pcab1-R1 were designed according to the genomic promoter sequence of Glyma.08G082900.1 in soybean for PCR amplification. The amplified products were electrophoretically separated on a 1% agarose gel (as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from TransGen Biotech Co., Ltd., Beijing). It was then transformed into competent cells (DH5α), and positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was confirmed to be 1642 bp by sequencing. After the sequence comparison was correct, this sequence fragment was named the leaf-specific promoter Pcab1.

[0032] The nucleotide sequence of the leaf-specific promoter Pcab1 is shown in SEQ ID NO.4, and the specific sequence is:

[0033]

[0034] The above primer Pcab1-F1 is shown in SEQ ID NO.5, and the specific sequence is:

[0035] 5'-GGCCCTAGAATCAAACTTTCC-3';

[0036] The above primer Pcab1-R1 is shown in SEQ ID NO.6, and the specific sequence is:

[0037] 5'-TTTTTAACTCAAGGATGAGCTTTGC-3'.

[0038] The PCR amplification system is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.

[0039] The PCR amplification program of the present invention is: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min; ) 30 cycles; 72°C, 10 min.

[0040] Example 3 Analysis of cis-acting elements of promoter Pgj4

[0041] The online software PlantPAN 4.0 was used to analyze the cis-acting elements of the promoter Pcab1 sequence cloned in Example 2, and the results are as Figure 3 shown.

[0042] It was found that the promoter sequence contains elements such as circadian (AAAATATCT), LTR (CCGAAA), G-box (CACGTG), TATA-box (TATAWAW), TC-rich (ATTTTCTT), TATC-box (TATCCAC), CAT-box (GCCACT), etc.

[0043] Example 4 Obtaining of transgenic soybeans containing the pCAMBIA3300-Pcab1-DsRed expression vector

[0044] After the pCAMBIA3300-GUS vector (purchased from Beijing TransGen Biotech Co., Ltd.) was digested with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein DsRed gene to optimize and obtain pCAMBIA3300-DsRed.

[0045] The promoter Pcab1 fragment cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pcab1-DsRed recombinant expression vector (asFigure 4 As shown in the figure, the recombinant expression vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain recombinant Agrobacterium tumefaciens. The variety for transformation was Jiyu 86, and the specific transformation process was as follows:

[0046] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (50 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP) until the OD 600nm reaches 0.6. After centrifuging the cells at 3000 rpm for 10 min, resuspend them in liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellic acid (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and adjust the OD 600nm to 0.5 for later use.

[0047] (2) Agrobacterium tumefaciens infection

[0048] Use a scalpel to cut open the soybean leaf along the hilum of the soybean seed, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in the resuspended Agrobacterium tumefaciens for 30 min. Transfer the infected explants to co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4), and culture them in the dark at 23 °C for 4 d.

[0049] (3) Induction of adventitious buds

[0050] After 4 d of co-culture of the explants, transfer the explants to induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledon node and hypocotyl parts of the explants need to be inserted into the medium with the adaxial surface facing up and at a 45° angle to the horizontal plane, and culture them under the conditions of 25 °C and a 16 / 8 h light / dark cycle for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium and continue to culture them for 2 weeks under the same culture conditions.

[0051] (4) Bud elongation

[0052] The induced cluster buds (with cotyledon tissues removed) were transferred to a bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions were 25°C with a 16 / 8 h light / dark cycle. Subculture was performed every 2 weeks.

[0053] (5) Rooting

[0054] When the resistant buds grew to about 4 cm in length, they were cut off, soaked in IBA (1 mg / L) for 30 s, and then transferred to a rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. When strong roots grew, they were transplanted to the greenhouse for growth and fruiting.

[0055] Using the specific primers of promoter Pcab1, PCR detection was performed on the T1 generation transgenic soybeans. After obtaining the pCAMBIA3300-Pcab1-DsRed transgenic soybean plants by combining herbicide screening, red fluorescence was observed.

[0056] Example 5

[0057] Using the LUYOR-3415RG dual-wavelength fluorescence imaging system, tissue-specific expression analysis was performed on the T1 generation pCAMBIA3300-Pcab1-DsRed transgenic soybean plants. The results were as Figure 5 shown:

[0058] It was found that red fluorescence was present in the leaves of the transgenic soybean plants, but not in other parts, further verifying the tissue-specific expression of promoter Pcab1 in leaf tissues.

[0059] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A soybean leaf-specific promoter Pcab1, characterized in that, The nucleotide sequence of the soybean leaf-specific promoter Pcab1 is shown in SEQ ID NO.

4.

2. The soybean leaf-specific promoter Pcab1 according to claim 1, characterized in that, The primer pair for amplifying the soybean leaf-specific promoter Pcab1 is Pcab1-F1 and Pcab1-R1. The sequence of Pcab1-F1 is shown in SEQ ID NO.5, and the sequence of Pcab1-R1 is shown in SEQ ID NO.

6.

3. An expression cassette containing the promoter Pcab1 as claimed in claim 1 or 2.

4. The use of the promoter Pcab1 as claimed in claim 1 or 2 or the expression cassette as claimed in claim 3 in transgenic soybeans.

5. The application according to claim 4, characterized in that, The construction method of the transgenic soybeans comprises the following steps: (1) Construct an expression vector containing the soybean leaf-specific promoter Pcab1 and a target gene; (2) Transform the expression vector of step (1) into Agrobacterium; (3) Infect soybean explants with the Agrobacterium of step (2), and after culturing to take root, obtain transgenic soybean plants.

6. The application according to claim 5, characterized in that, The backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

Citation Information

Patent Citations

  • Specific promoter of leguminous plant leaf tissues and application of specific promoter

    CN105985958A