Soybean seed specific promoter Pxbcp3 and application thereof
By screening and cloning the soybean seed-specific promoter Pxbcp3, the specific expression of soybean seeds is achieved, and physiological disorders caused by non-selective activation of promoters in the prior art are solved, and the efficiency of oil synthesis and storage protein regulation is improved.
Patent Information
- Application Number
- CN202510566200.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-07-18
AI Technical Summary
In the prior art, non-selective activation of constitutive promoters such as CaMV 35S leads to continuous high expression of various organs in soybean plants, causing physical disorders, lack of seed-specific promoter resources, making it difficult to achieve precise regulation of oil synthesis and storage protein genes.
By screening and cloning the promoter Pxbcp3, which specifically expresses the gene Glyma.08G116300, the Pxbcp3-DsRed fusion expression vector was constructed and transferred to the soybean plant to achieve seed-specific expression.
The promoter Pxbcp3 shows significant specific expression in soybean seeds, effectively improving the regulation efficiency of the oil and fat synthesis pathway, improving the oleic acid content and storage protein composition of seeds, and solving the problem of shortage of endogenous promoter resources.
Smart Images

Figure CN120330192A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a soybean seed-specific promoter Pxbcp3 and its application. Background Art
[0002] As an important global crop for both oil and food, soybean seeds are not only the core sources of vegetable oil and plant protein, but also the key target organs for molecular design breeding. The discovery and functional analysis of seed-specific promoters provide precise molecular switches for directional regulation of seed development processes and optimization of storage substance synthesis pathways, and have strategic significance in quality breeding such as increasing seed oil content and improving storage protein components.
[0003] The research on the regulatory mechanism of promoters is the cornerstone of crop genetic improvement. Currently widely used constitutive promoters such as CaMV 35S have significant defects: their non-selective activation characteristics lead to continuous high expression of foreign genes in various organs of the plant, causing physiological disorders such as abnormal consumption of photosynthetic products and imbalance of endogenous hormone homeostasis, and ultimately resulting in deterioration of agronomic traits such as dwarf plant type and decreased biomass. In contrast, tissue-specific promoters can achieve three-dimensional control (timing, localization, quantification) of gene expression through precise spatio-temporal expression regulation, enabling the accumulation of foreign proteins to increase by 3 - 5 times in target organs while the expression level in non-target organs is reduced below the detection limit. Especially seed-specific promoters, with their unique endosperm / cotyledon-directed expression characteristics, can precisely regulate the expression intensity of key enzymes for oil synthesis or storage protein genes, showing unique advantages in increasing the oleic acid content of seeds or optimizing amino acid composition. The application of such promoters improves the efficiency of metabolic engineering transformation by more than 40%, providing an innovative technical path for the cultivation of "high-quality and special-purpose" crop varieties.
[0004] Therefore, it is necessary to provide a new seed-specific promoter to provide new genetic resources for molecular improvement of plants or production of transgenic plants with special uses. Summary of the Invention
[0005] The purpose of the present invention is to provide a soybean seed-specific promoter Pxbcp3 and its application.
[0006] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:
[0007] In the first aspect, the present invention provides a soybean seed-specific promoter Pxbcp3, and the nucleotide sequence of the promoter Pxbcp3 is as shown in SEQ ID NO.1.
[0008]
[0009] In a second aspect, the present invention provides amplification primers for the promoter Pxbcp3. The nucleotide sequence of the forward primer Pxbcp3-F1 is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer Pxbcp3-R1 is as shown in SEQ ID NO.3.
[0010] In a third aspect, the present invention provides a chimeric gene, which comprises a target gene and the promoter Pxbcp3 operably linked to the target gene sequence.
[0011] In a fourth aspect, the present invention provides an expression cassette, which contains the promoter Pxbcp3 or the chimeric gene.
[0012] In a fifth aspect, the present invention provides a recombinant vector, which contains the promoter Pxbcp3 or the chimeric gene.
[0013] In a sixth aspect, the present invention provides a host bacterium, which contains the recombinant vector.
[0014] In a seventh aspect, the present invention provides the use of the promoter Pxbcp3, or the primer, or the chimeric gene, or the expression cassette, or the recombinant vector, or the host bacterium in cultivating transgenic plants.
[0015] Preferably, the plant is soybean.
[0016] In an eighth aspect, the present invention provides a method for cultivating transgenic soybean plants. The target gene to be expressed is linked to the promoter Pxbcp3 to obtain a chimeric gene; a recombinant vector containing the chimeric gene is constructed and transferred into soybean plant tissues to obtain transgenic soybean plants that specifically express the target gene in soybean seeds.
[0017] In a ninth aspect, the present invention provides the use of the promoter Pxbcp3 or the primer in soybean gene function research and gene expression regulation research.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] Based on the combined analysis of comparative transcriptome sequencing and soybean genome, the seed-specifically expressed gene Glyma.08G116300 was screened and obtained. By amplifying the genomic DNA of soybean variety Williams 82, a 1379bp DNA sequence upstream of the start codon of this gene was successfully cloned as the promoter Pxbcp3. qRT-PCR detection showed that the expression abundance of Glyma.08G116300 in seeds was significantly higher than that in other tissues. By constructing a Pxbcp3-DsRed fusion expression vector and transferring it into soybeans, tissue-specific expression analysis of transgenic plants showed that the DsRed red fluorescence signal was specifically enriched in mature seeds, and no significant expression was observed in vegetative organs such as roots, stems, and leaves. It can be seen that the promoter Pxbcp3 has seed tissue specificity, effectively alleviating the shortage of soybean endogenous tissue-specific promoter resources, and providing a new regulatory element for analyzing the molecular mechanism of seed development and carrying out molecular breeding of the oil synthesis pathway.
[0020] The promoter Pxbcp3 provided by the present invention has strong specificity in soybean seed tissues. After binding the target gene to be expressed with the promoter Pxbcp3 and introducing it into soybean plants, it can be used to improve the quality of transgenic soybean seeds and cultivate new varieties of transgenic soybeans. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.
[0022] Figure 1 It is the detection result of the relative expression level of the Glyma.08G116300 gene in different tissues of soybeans in Example 1;
[0023] Figure 2 It is the electrophoresis separation result of the amplification product on an agarose gel in Example 2;
[0024] Figure 3 It is the analysis result of the cis-acting elements of the promoter Pxbcp3 sequence in Example 3;
[0025] Figure 4 It is the structural diagram of the pCAMBIA3300-Pxbcp3-DsRed recombinant vector in Example 4;
[0026] Figure 5 It is the detection result of the red fluorescence in wild-type soybean seeds and transgenic soybean seeds in Example 5. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] The technical solution provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention. The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).
[0028] Example 1 Transcription levels of the Glyma.08G116300 gene in different tissues
[0029] Based on transcriptome data analysis, one gene Glyma.08G116300 (SEQ ID NO.4) that is strongly expressed in soybean seeds was selected, and further, the expression levels of the candidate gene Glyma.08G116300 in different tissues and organs of soybean were verified by real-time quantitative PCR. The specific method is as follows:
[0030] Total RNA was extracted from the root, leaf, stem, flower, pod, and seed tissue samples of soybean plants at the mature stage, and real-time quantitative PCR was performed using the designed specific primers Glyma.08G116300-F1 (SEQ ID NO.5) and Glyma.08G116300-R1 (SEQ ID NO.6). The detection instrument was ABIPRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected by 2–ΔΔCT (Livak) method.
[0031] The sequences of the quantitative primers are as follows:
[0032] Glyma.08G116300-F1: ACTGTGTGGAAGAAAGCGAAGG
[0033] Glyma.08G116300-R1: GAACGCTTGCTCTGTCTCTGAT
[0034] The RT-qPCR system was: 10 μL of SYBR Green PCR MasterMix, 2 μL of cDNA template, 0.2 μL of forward primer, 0.2 μL of reverse primer, and made up to 20 μL with ddH2O.
[0035] The RT-qPCR program was: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min.
[0036] The detection results are as Figure 1 shown. It can be seen that the expression level of the Glyma.08G116300 gene is the highest in seeds and very low in other tissues such as leaves and stems, indicating the seed-specific expression characteristics of the Glyma.08G116300 gene.
[0037] Example 2 Cloning of the Glyma.08G116300 promoter
[0038] Specific primers Pxbcp3-F1 (SEQ ID NO.2) and Pxbcp3-R1 (SEQ ID NO.3) were designed according to the genomic promoter sequence of soybean Glyma.08G116300 for PCR amplification. The amplified products were electrophoretically separated on a 1% agarose gel (the electrophoresis results are as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit, and cloned onto the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.), transformed into competent cells (DH5α), and positive clones were obtained through antibiotic screening. After verification by colony PCR, the length of the inserted DNA fragment was confirmed to be 1379 bp by sequencing. After the sequence comparison was correct, it was named the soybean seed-specific promoter Pxbcp3 (SEQ ID NO.1).
[0039] The amplification primers for the promoter Pxbcp3 are:
[0040] Pxbcp3-F1: 5'-GAGTTGTTTCAGGTTCCATTGC-3'
[0041] Pxbcp3-R1: 5'-AACTTGGTGGAAGAATTTTATGAT-3'
[0042] The PCR amplification system is: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.
[0043] The PCR amplification program is: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min) for 30 cycles; 72°C, 10 min.
[0044] Example 3 Analysis of cis-acting elements of the promoter Pxbcp3
[0045] The PlantPAN 4.0 was used to analyze the cis-acting elements of the promoter Pxbcp3 sequence obtained in Example 2.
[0046] The results are as Figure 3 shown. It can be seen that the promoter sequence contains elements such as ABRE (ACGTGGC), O2-site (TCCACGTAGA, SEQ ID NO.7), G-box (CACGTG), GCN4_motif (ATGACTCAT), TGA-element (TGACGTCA), CAT-box (GCCACT), GATA-motif (AGATAG), P-box (TGTACAGGATGTTCT, SEQ ID NO.8), ERE (AGCCGCC), etc. Among them, GCN4_motif is an element expressed in the endosperm, and O2-site is an element related to the regulation of zein metabolism, which may be related to seed formation and metabolism. Other elements regulate hormones such as auxin and abscisic acid, which contribute to seed formation, and these play a key role in its specific expression in seeds.
[0047] Obtaining transgenic soybeans of pCAMBIA3300-Pxbcp3-DsRed
[0048] After double digestion of the pCAMBIA3300 vector (purchased from Beijing TransGen Biotech Co., Ltd.) with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein reporter gene DsRed, and pCAMBIA3300-DsRed was optimized. The promoter Pxbcp3 fragment of Glyma.08G116300 cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the above-obtained pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pxbcp3-DsRed recombinant vector ( Figure 4 ).
[0049] The pCAMBIA3300-Pxbcp3-DsRed recombinant vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The transformation was carried out by the Agrobacterium-mediated method, and the soybean variety used for transformation was Jiyu 86. The specific transformation process is as follows:
[0050] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (80 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28°C. The next day, expand the culture (50 mL of YEP liquid medium) to OD 600nmIt is 0.6 to 0.8. After the bacterial cells were centrifuged at 3000 rpm for 10 min, they were resuspended in the liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellic acid (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and the OD 600nm was adjusted to 0.5 for standby.
[0051] (2) Agrobacterium infection
[0052] Use a scalpel to cut open the soybean seeds along the hilum of the soybean seeds, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in the resuspended Agrobacterium for 30 min. Transfer the infected explants to the co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4), and culture them in the dark at 23 °C for 4 d.
[0053] (3) Adventitious bud induction
[0054] After the explants were co-cultured for 4 d, transfer the explants to the induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5.5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledon node and hypocotyl parts of the explants need to be inserted into the medium with the adaxial surface facing up and at a 45° angle to the horizontal plane, and cultured at 25 °C under a 16 / 8 h light / dark condition for 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium and continue to culture for 2 weeks under the same culture conditions.
[0055] (4) Bud elongation
[0056] Transfer the induced cluster buds (removing the cotyledon part of the tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, indoleacetic acid (IAA) 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5.5 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions are 25°C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.
[0057] (5) Rooting
[0058] When the resistant buds grow to 3 - 5 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, indolebutyric acid (IBA) 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continuous culture. After strong roots grow, transplant them to the greenhouse for growth and fruiting.
[0059] Use the promoter Pxbcp3 specific primers Pxbcp3-F1 and Pxbcp3-R1 to perform PCR detection on the T1 generation transgenic soybeans. Combine with herbicide screening. After obtaining the transgenic soybeans containing pCAMBIA3300-Pxbcp3-DsRed, observe the red fluorescence.
[0060] Example 5 Observe the red fluorescence in different parts of the pCAMBIA3300-Pxbcp3-DsRed transgenic soybean plants
[0061] Use the LUYOR-3415RG dual-wavelength fluorescence imaging system to perform tissue-specific expression analysis on the T1 generation pCAMBIA3300-Pxbcp3-DsRed transgenic soybean plants. The results are as Figure 5 shown (the left picture is the seed of the wild-type soybean plant, and the right picture is the seed of the transgenic soybean plant). There is red fluorescence in the seeds of the transgenic soybean plants (the red fluorescence can only be seen after being irradiated with a specific flashlight and wearing specific glasses (the lens is orange). When taking pictures, the red fluorescence can only be captured through the glasses, so the color after taking pictures is orange), further verifying the tissue-specific expression of the promoter Pxbcp3 in the seeds.
[0062] As can be seen from the above embodiments, the present invention screens out the soybean seed-specific expression gene Glyma.08G116300 by integrating comparative transcriptome sequencing data and soybean genomic information, and successfully clones its promoter Pxbcp3 for functional verification. The experimental results show that: real-time fluorescence quantitative PCR analysis indicates that the Glyma.08G116300 gene exhibits significant high-expression characteristics in seed tissues. By constructing a recombinant plasmid containing Pxbcp3-DsRed and performing soybean genetic transformation, it is found that the DsRed reporter gene driven by this promoter in transgenic plants detects red fluorescence signals only in seed tissues, and no obvious expression is seen in other tissues. This result shows that the promoter Pxbcp3 has seed tissue-specific expression characteristics, providing an important molecular tool for the study of soybean seed-specific gene regulation.
[0063] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A soybean seed-specific promoter Pxbcp3, characterized in that, The nucleotide sequence of the promoter Pxbcp3 is shown in SEQ ID NO.
1.
2. An amplification primer for the promoter Pxbcp3 described in claim 1, characterized in that, The nucleotide sequence of the forward primer Pxbcp3-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer Pxbcp3-R1 is shown in SEQ ID NO.
3.
3. A chimeric gene, characterized in that, The chimeric gene comprises a target gene and the promoter Pxbcp3 as claimed in claim 1, which is operably linked to the target gene sequence.
4. An expression cassette, characterized in that, The expression cassette contains the promoter Pxbcp3 as claimed in claim 1, or contains the chimeric gene as claimed in claim 3.
5. A recombinant vector, characterized in that, The recombinant vector contains the promoter Pxbcp3 as claimed in claim 1, or contains the chimeric gene as claimed in claim 3.
6. A host bacterium, characterized in that, The host bacterium contains the recombinant vector as claimed in claim 5.
7. Use of the promoter Pxbcp3 as claimed in claim 1, or the primer as claimed in claim 2, or the chimeric gene as claimed in claim 3, or the expression cassette as claimed in claim 4, or the recombinant vector as claimed in claim 5, or the host bacterium as claimed in claim 6 in cultivating transgenic plants.
8. The application according to claim 7, characterized in that, The plant is soybean.
9. A method for cultivating transgenic soybean plants, characterized in that, Link the target gene to be expressed with the promoter Pxbcp3 as claimed in claim 1 to obtain a chimeric gene; construct a recombinant vector containing the chimeric gene and transfer it into soybean plant tissues to obtain a transgenic soybean plant that specifically expresses the target gene in soybean seeds.
10. Use of the promoter Pxbcp3 as claimed in claim 1, or the primer as claimed in claim 2 in soybean gene function research and gene expression regulation research.