Soybean pod specific expression promoter Pjia and application thereof

Abstract

The invention provides a soybean pod specific expression promoter Pjia and application thereof, and belongs to the technical field of plant biological breeding. The nucleotide sequence of the soybean pod specific expression promoter Pjia provided by the invention is shown as SEQ ID NO.4. A target gene driven by the promoter can realize specific expression in soybean pods, so that a new element is provided for improving the accuracy and safety of genetic engineering breeding; and a foundation is laid for researching specific expression of disease and pest resistant genes in soybean pods.

Description

Technical Field

[0001] The present invention relates to the technical field of plant biological breeding, and particularly relates to a soybean pod-specific expression promoter Pjia and its application. Background Art

[0002] Soybean is an important oil and grain crop. Its pods are vulnerable to pests and diseases such as pod blight and soybean pod borer, which seriously affect the yield and quality of soybeans. To address this production problem, traditional transgenic technologies often use constitutive promoters such as CaMV 35S. Although these promoters can drive global gene expression, they can cause problems such as increased metabolic burden and abnormal growth and development in plants. In contrast, pod-specific promoters can precisely regulate the directional expression of disease-resistant genes in pods, which can not only effectively resist targeted pests such as soybean pod borers but also avoid energy waste in non-target organs. This precise regulation technology provides an efficient solution for improving the disease and pest resistance of soybeans, while ensuring the yield and enhancing the resistance of crops. Summary of the Invention

[0003] The purpose of the present invention is to provide a soybean pod-specific expression promoter Pjia, which can drive the specific expression of a target gene in soybean pods and overcome the lack of existing endogenous soybean specific promoters.

[0004] The present invention provides a soybean pod-specific expression promoter Pjia, and the nucleotide sequence of the soybean pod-specific expression promoter Pjia is as shown in SEQ ID NO.4.

[0005] Preferably, the primer set for amplifying the soybean pod-specific expression promoter Pjia is Pjia-F1 and Pjia-R1. The sequence of Pjia-F1 is as shown in SEQ ID NO.5, and the sequence of Pjia-R1 is as shown in SEQ ID NO.6.

[0006] The present invention also provides an expression cassette containing the soybean pod-specific expression promoter Pjia.

[0007] The present invention also provides an application of the promoter Pjia or the expression cassette in transgenic soybeans.

[0008] Preferably, the construction method of the transgenic soybean includes the following steps:

[0009] (1) Construct an expression vector containing the soybean pod-specific expression promoter Pjia and a target gene;

[0010] (2) Transform the expression vector in step (1) into Agrobacterium.

[0011] (3) Infect soybean explants with the Agrobacterium tumefaciens obtained in step (2), and after culturing and rooting, transgenic soybean plants are obtained.

[0012] Preferably, the backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

[0013] In the present invention, the soybean pod-specific expression promoter Pjia was cloned from the soybean variety Williams 82, fused with the red fluorescent protein DsRed gene and transferred into soybeans. By observing the color development of the red fluorescent protein, it was found that the color only developed in soybean pods, indicating that this promoter is specifically expressed only in soybean pod tissues. Compared with the prior art, the present invention overcomes the shortage of existing soybean endogenous specific promoters and has important application value in analyzing gene functions and genetic improvement. Description of the Drawings

[0014] Figure 1 It is the relative expression levels of the Glyma.12G217300.1 gene in different parts in Example 1;

[0015] Figure 2 It is the PCR gel electrophoresis result of cloning the promoter Pjia in Example 2;

[0016] Figure 3 It is the cis-acting elements of the promoter Pjia sequence in Example 3;

[0017] Figure 4 It is the map of the pCAMBIA3300-Pjia-DsRed recombinant expression vector in Example 4;

[0018] Figure 5 It is the color development result of the Pjia promoter driving the red fluorescent protein in the pod part in Example 5. Detailed Embodiments

[0019] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0020] The soybean variety Williams 82 described in the present invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0021] Example 1 Transcriptional Levels of the Glyma.12G217300.1 Gene in Different Tissues

[0022] Based on transcriptome data analysis, one gene Glyma.12G217300.1 that was strongly expressed in soybean pods was selected. Further, the expression levels of the candidate gene Glyma.12G217300.1 in different tissues and organs of soybeans were verified by real-time quantitative PCR. The specific method was as follows: Total RNA was extracted from tissue samples of roots, leaves, stems, pods, seeds, etc. of soybean plants at the mature stage. Real-time quantitative PCR was performed using specific primers Glyma.12G217300.1-F1 and Glyma.12G217300.1-R1. The detection instrument was ABI PRISM 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). The relative expression levels of the genes were detected by the 2 –ΔΔCT (Livak) method. The RT-qPCR system was 10 μL of SYBR Green PCR Master Mix, 2 μL of cDNA, 0.2 μL of forward primer, 0.2 μL of reverse primer, and made up to 20 μL with ddH2O. The RT-qPCR program was as follows: 94°C, 10 min; (94°C, 45 s; 60°C, 45 s; 72°C, 30 s) for 35 cycles; 72°C, 10 min. The results were as Figure 1 shown.

[0023] The sequence of Glyma.12G217300.1 is shown in SEQ ID NO.1, and the specific sequence is:

[0024] ATGGCACTTCGTTGCTTGGTGATGTCCCTTTCTGTTCTCTTCACTCTTGGTCTTGCGAGAGAAAGCCATGCCAGAGACGAAGATTTTTGGCATGCTGTTTGGCCAAACACTCCCATTCCAAGTTCATTGCGAGATCTTCTAAAGCCTGGCCCTGCAAGTGTTGAAATCGATGATCACCCTATGCAAATTGAAGAAACACAGTACCCGAAAACCTTCTTCTATAAAGAAGACCTTCATCCAGGCAAAACAATGAAAGTACAATTCAGCAAGCCTCCCTTTCAACAACCATGGGGTGTTGGTACATGGTTAAAGGAAATTAAAGACACTACTAAAGAAGGATATAGTTTTGAAGAGCTATGCATCAAGAAAGAAGCCATTGAGGGAGAAGAGAAGTTTTGTGCAAAATCCTTGGGAACAGTAATTGGTTTTGCCATTTCAAAGCTGGGAAAGAACATTCAAGTACTTTCAAGTTCCTTTGTCAATAAGCAAGACCAATACACTGTGGAAGGAGTGCAGAATCTTGGAGACAAAGCAGTGATGTGTCATAGGCTAAATTTCAGAACTGCAGTATTTTACTGCCATGAAGTCCGTGAAACAACAGCTTTCATGGTTCCATTGGTGGCTGGTGATGGAACCAAAACTCAGGCACTTGCTATTTGCCACTCAAATACTTCTGGAATGAATCATCAAATGCTTCATCAACTTATGGGAGTTGATCCTGGAACTAACCCTGTTTGCCATTTCCTTGGAAGCAAGGCCATTTTATGGGTACCCAATTTATCTGTGGACACTGCCTATCAGACCAACATTGTTGCTTAA;

[0025] The sequence of the specific primer Glyma.12G217300.1-F1 is shown in SEQ ID NO.2, and the specific sequence is: AGCCATTGAGGGAGAAGAGAAG;

[0026] The sequence of the specific primer Glyma.12G217300.1-R1 is as shown in SEQ ID NO.3, and the specific sequence is: GTTGTTTCACGGACTTCATGGC.

[0027] It can be seen from Figure 1 that the expression level of the Glyma.12G217300.1 gene is the highest in pods, and almost no expression can be detected in other tissues such as leaves and stems, which confirms the specific expression characteristics of the Glyma.12G217300.1 gene in pod tissues.

[0028] Example 2 Cloning of the promoter Pjia of the Glyma.12G217300.1 gene

[0029] Specific primers Pjia-F1 and Pjia-R1 were designed according to the genomic promoter sequence of Glyma.12G217300.1 in soybean for PCR amplification, and the amplified products were electrophoretically separated on a 1% agarose gel (as Figure 2 shown). The agarose gel containing the target fragment was cut and collected into a centrifuge tube, recovered using the Omega Gel Extraction Kit kit, and cloned onto the pEASY-Blunt vector (purchased from TransGen Biotech Co., Ltd., Beijing), and transformed into competent cells (DH5α). Positive clones were obtained through antibiotic screening. After verification by colony PCR, the inserted DNA fragment was sent for sequencing and confirmed to be 1487 bp. After the sequence comparison was correct, this sequence fragment was named the pod-specific promoter Pjia.

[0030] The nucleotide sequence of the pod-specific promoter Pjia is as shown in SEQ ID NO.4, and the specific sequence is:

[0031]

[0032] The above primer Pjia-F1 is shown in SEQ ID NO.5, and the specific sequence is as follows:

[0033] 5'-AATCCAGTGCTCTCTTGTCAAGG-3';

[0034] The above primer Pjia-R1 is shown in SEQ ID NO.6, and the specific sequence is as follows:

[0035] 5'-TCTTGCAATTAATGAGTGTTAGCG-3'.

[0036] The PCR amplification system is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and supplemented with ddH2O to 50 μL.

[0037] The PCR amplification program of the present invention is as follows: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 2 min;) 30 cycles; 72°C, 10 min.

[0038] Example 3 Analysis of cis-acting elements of promoter Pjia

[0039] The online software PlantPAN 4.0 was used to analyze the cis-acting elements of the promoter Pjia sequence cloned in Example 2, and the results are as Figure 3 shown.

[0040] It was found that the promoter sequence contains elements such as P-box (CCTTTTG), ABRE (CACGTGGC), O2-site (SEQ ID NO.7: TCCACGTAGA), ERE (AGCCGCC), etc.

[0041] Example 4 Obtaining of transgenic soybeans containing the pCAMBIA3300-Pjia-DsRed recombinant expression vector

[0042] After digesting the pCAMBIA33001-GUS vector (purchased from Beijing TransGen Biotech Co., Ltd.) with EcoRⅠ and HindⅢ, it was ligated with the red fluorescent protein DsRed gene, and pCAMBIA33001-DsRed was optimized. The promoter Pjia fragment cloned on the pEASY-Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pjia-DsRed recombinant expression vector (as Figure 4As shown in the figure, the recombinant expression vector was introduced into Agrobacterium tumefaciens EHA105 (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain recombinant Agrobacterium tumefaciens. The variety to be transformed was Jiyu 86, and the specific transformation process was as follows:

[0043] (1) Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it into 5 mL of YEP liquid medium (50 mg / L spectinomycin, 25 mg / L rifampicin), and culture it overnight at 28 °C. The next day, expand the culture (50 mL of YEP) until the OD 600nm reaches 0.6. After centrifuging the bacteria at 3000 rpm for 10 min, resuspend them in the liquid co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, 2-(N-morpholino)ethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellic acid (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetosyringone (AS) 200 μmol / L, pH 5.4), and adjust the OD 600nm to 0.5 for standby.

[0044] (2) Agrobacterium tumefaciens infection

[0045] Use a scalpel to cut open the soybean leaf along the umbilical part of the soybean seed, remove the skin, make a slight scratch at the cotyledon node position, and then place the prepared explants in the resuspended Agrobacterium tumefaciens for 30 min. Transfer the infected explants to the co-culture medium (B5 salts 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA3 0.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4), and culture them in the dark at 23 °C for 4 d.

[0046] (3) Adventitious bud induction

[0047] After the explants were co-cultured for 4 d, transfer the explants to the induction medium (B5 salts 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledon node and hypocotyl parts of the explants need to be inserted into the medium with the adaxial surface facing up and at a 45° angle to the horizontal plane, and cultured under the conditions of 25 °C and a 16 / 8 h light / dark cycle for about 2 weeks. Take out the explants, cut off the excess hypocotyl part, leaving only 5 mm, and then transfer the explants to fresh induction medium and continue to culture for 2 weeks under the same culture conditions.

[0048] (4) Bud elongation

[0049] Transfer the induced clustered buds (removing the cotyledon part of the tissue) to the bud elongation medium (MS salts 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cefotaxime 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) for culture. The culture conditions are 25°C and a 16 / 8 h light / dark cycle. Subculture once every 2 weeks.

[0050] (5) Rooting

[0051] When the resistant buds grow to about 4 cm, cut them off, soak them in IBA (1 mg / L) for 30 s, and then transfer them to the rooting medium (MS salts 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, asparagine 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, phytagel 3 g / L, pH 5.6) for continued culture. Transplant them to the greenhouse for growth and fruiting when strong roots have grown.

[0052] Use the specific primers of promoter Pjia to perform PCR detection on the T1 generation transgenic soybeans. After obtaining the transgenic soybean plants containing pCAMBIA3300-Pjia-DsRed by combining herbicide screening, observe the red fluorescence.

[0053] Example 5. Observe the red fluorescence in different parts of pCAMBIA3300-Pjia-DsRed transgenic soybean plants

[0054] Use the LUYOR-3415RG dual-wavelength fluorescence imaging system to perform tissue-specific expression analysis on the T1 generation pCAMBIA3300-Pjia-DsRed transgenic soybean plants. The results are as Figure 5 shown.

[0055] It was found that there was red fluorescence in the pods of the transgenic soybean plants, further verifying the tissue-specific expression of promoter Pjia in the pod tissue.

[0056] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A soybean pod-specific expression promoter Pjia, characterized in that, The nucleotide sequence of the soybean pod-specific expression promoter Pjia is shown in SEQ ID NO.

4.

2. The soybean pod-specific expression promoter Pjia as described in claim 1, wherein, The primer pair for amplifying the soybean pod-specific expression promoter Pjia is Pjia-F1 and Pjia-R1. The sequence of Pjia-F1 is shown in SEQ ID NO.5, and the sequence of Pjia-R1 is shown in SEQ ID NO.

6.

3. An expression cassette containing the soybean pod-specific expression promoter Pjia described in claim 1 or 2.

4. The application of the promoter Pjia described in claim 1 or 2 or the expression cassette described in claim 3 in transgenic soybeans.

5. The application according to claim 4, wherein The construction method of the transgenic soybeans includes the following steps: (1) Construct an expression vector containing the soybean pod-specific expression promoter Pjia and the target gene; (2) Transform the expression vector in step (1) into Agrobacterium; (3) Use the Agrobacterium in step (2) to infect soybean explants, and after culturing and rooting, obtain transgenic soybean plants.

6. The application according to claim 5, characterized in that, The backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.

Images