KASP marker related to white character of cucumber peel and application of KASP marker
By developing KASP markers related to the white traits of cucumber peels, finely localizing and identifying CsLeuC gene mutations, the problem of difficulty in cultivating high-quality white cucumbers in the existing technology is solved, and efficient identification and breeding research on white traits of cucumber peels is achieved.
Patent Information
- Application Number
- CN202510161538.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-13
- Publication Date
- 2025-07-18
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing technology is difficult to effectively use gene localization and typing to cultivate high-quality white cucumbers with high-quality peels, and the market demand has not been met.
A KASP marker related to the white trait of cucumber peel is provided. By detecting the A to T mutation at 181bp of the second exon of the CsLeuC gene, corresponding KASP marker kits and primers are developed to identify the genetic breeding of white traits of cucumber peel.
The fine positioning and efficient identification of the white traits of cucumber peels has been achieved, providing a new research foundation for breeding, and laying the foundation for cultivating high-quality white cucumber varieties.
Smart Images

Figure CN120330362A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of breeding, and particularly relates to a KASP marker related to the white fruit peel trait of cucumber and its application. Background Art
[0002] The fruit peel color is an important quality trait of cucumber and has important commercial economic value. The fruit peel colors of immature cucumber fruits mainly include light green, green, dark green, and white, etc. With the improvement of the national material living standard, high-quality white fruit peel cucumber varieties are not only favored by consumers but also become the focus of attention of breeders. Therefore, specifically cultivating white fruit peel cucumber varieties that meet market demands and satisfy the increasing quality requirements of consumers is an important breeding goal for realizing the improvement of the economic value of cucumber.
[0003] During the early development of cucumber fruits, the decrease in chlorophyll content and the defect in chloroplast development are the main reasons for the white or light green color of the fruit peel. The cucumber white peel gene w was initially mapped to a 33 kb region between the flanking SNP markers ASPCR39262 and ASPCR39229 on chromosome 3. With the in-depth research, the white peel gene appr2(w) was finely mapped. Compared with white peel cucumbers, the expression level of APRR2 in green peel cucumbers is higher, and the contents of chlorophyll a and chlorophyll b in the exocarp are also higher, and there are more chloroplasts. The allele aprr2 of APRR2 in white peel cucumbers lacks the functional domain at the C-terminus, making it unable to perform normal functions in the fruit ripening signal pathway, resulting in a decrease in chlorophyll content and a reduction in the number of chloroplasts, and finally forming white fruit peel cucumbers. CsaARC5 has been confirmed as the light green fruit peel gene of cucumber. The loss of CsaARC5 function seriously affects the division of chloroplasts, resulting in a decrease in the number of chloroplasts and an increase in its volume, making the lgp (light green peel) mutant fruit peel show a light green color. CsYcf54 in cucumber encodes a Ycf54-like protein, and Ycf54-like proteins are important cyclases required in the process of chlorophyll synthesis. The mutation of CsYcf54 leads to the obstruction of chlorophyll synthesis and a significant reduction in chlorophyll content. The subcellular localization results prove that the protein encoded by CsYcf54 is localized in chloroplasts. Therefore, CsYcf54 mainly regulates the light green cucumber leaves and fruit peels by affecting the biosynthesis of chlorophyll.
[0004] In recent years, the research on white or light-colored pericarp of other Cucurbitaceae plants has gradually been carried out. CmAPPR2 in melon is a homologous gene of the cucumber white pericarp gene appr2. Compared with the dark green pericarp of melon, the exon polymorphism of CmAPPR2 in the light green pericarp reduces the chlorophyll content in the pericarp and makes the pericarp color lighter. In wax gourd, appr2 is involved in the regulation of white pericarp. Compared with green-skinned wax gourd, two key bases are deleted in Bhaprr2 of white-skinned wax gourd, resulting in poor chloroplast development and chlorophyll synthesis, thus forming the white pericarp phenotype. Yan et al. conducted a combined metabolome and transcriptome analysis on the mature pericarp of two wax gourd inbred lines (yellow-green pericarp B214 and dark green pericarp B227). The chlorophyll content of the dark green pericarp B227 is higher than that of the yellow-green pericarp B214. All significantly differentially expressed genes in the chlorophyll synthesis pathway were down-regulated in the B214 pericarp, and it is speculated that the low expression rate of chlorophyll synthesis genes is the reason for the formation of the yellow-green pericarp. Li et al. detected that the chlorophyll content of the dark green pericarp 9904 of watermelon is 4 times that of the light green pericarp Handel, and transmission electron microscopy observed fewer and loosely arranged chloroplasts in the light green pericarp Handel. ClCGMenG finely mapped on chromosome 8 is a homologous gene of Arabidopsis MENG, and the encoded enzyme is related to the development of chlorophyll and chloroplasts. The mutation of ClCGMenG is the reason for the formation of the light green pericarp Handel.
[0005] Cucumber pericarp color is one of the main factors affecting market selection. Utilizing high-quality cucumber varieties to mine new genes for white pericarp and developing high-quality white-pericarp cucumber varieties that meet market demands will lay a foundation for the creation of future cucumber germplasm resources. Summary of the Invention
[0006] The present invention aims to overcome the deficiencies of the prior art and provides a KASP marker related to the white pericarp trait of cucumber and its application.
[0007] To achieve the above object, the technical solution provided by the present invention is as follows:
[0008] The SNP locus of the KASP marker related to the white pericarp trait of cucumber corresponds to the A>T mutation of the base A to T at the 181bp of the second exon of the CsLeuC gene, and the TT genotype at this molecular marker is the cucumber with white pericarp.
[0009] Preferably, the nucleotide sequence of the KASP marker is as shown in DEQ ID NO.1.
[0010] A kit for detecting the KASP marker related to the white pericarp trait of cucumber, characterized in that the kit includes primers for detecting the KASP marker related to the white pericarp trait of cucumber, and the primers include:
[0011] Primer_AlleleFAM:
[0012] GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA(SEQ ID NO.2);
[0013] Primer_AlleleHEX:
[0014] GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT(SEQ ID NO.3);
[0015] Primer_Common:
[0016] CGCCTCAACAATCGGAACGCAAG(SEQ ID NO.4).
[0017] The present invention also provides the application of a reagent for detecting a KASP marker related to the white trait of cucumber peel in the identification of genetic breeding of the white trait of cucumber peel; the KASP marker is the KASP marker described in claim 1.
[0018] The present invention also provides the application of a primer for detecting a KASP marker related to the white trait of cucumber peel in the identification of genetic breeding of the white trait of cucumber peel; the KASP marker is the aforementioned KASP marker, and the primer is the aforementioned primer.
[0019] The following further describes the present invention:
[0020] The cucumber fruit peel color is an important quality trait, and high-quality white-peel cucumber varieties are increasingly favored by the market. In previous work, when the inventor was multiplying the green-peel parental line Cuiqiu of the advanced inbred line, a mutant strain Cuiqiu-White Peel with white peel was discovered. After self-crossing the mutant strain Cuiqiu-White Peel and conducting systematic breeding for many years, nearly isogenic line materials of the white-peel mutant strain Cuiqiu-White (Cuiqiu-W) and the green-peel wild type Cuiqiu-Green (Cuiqiu-G) were obtained. The chlorophyll content and the number of chloroplasts in the Cuiqiu-Green peel are much higher than those in Cuiqiu-White. In this invention, genetic populations of Cuiqiu-Green, Cuiqiu-White, and their F2 and F3 generations were constructed. Genetic analysis showed that the white-peel trait is controlled by a recessive single gene. By combining BSA-seq and KASP genotyping, a candidate new gene CsLeuC (Csa3G912340) involved in the formation of white cucumber peel was finely mapped and cloned. A missense mutation occurred at SNP-181 in exon 2 of this gene, resulting in the mutation of threonine to serine. The homologous gene LeuC (At4g13430) of CsLeuC is involved in the biosynthesis of leucine (Leu) in Arabidopsis chloroplasts. Subcellular localization prediction showed that CsLeuC is distributed in chloroplasts and the cytoplasm. The qRT-PCR results showed that the expression level of CsLeuC in the Cuiqiu-Green peel is higher than that in the Cuiqiu-White peel. This invention enriches the research content of cucumber fruit peel color and provides a new research basis for future high-quality cucumber breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 : Phenotypic identification of wild type Cuiqiu-Green and mutant Cuiqiu-White: (A) Fruits are Cuiqiu-Green, F1, and Cuiqiu-White fruits at 9 DAP respectively; (B) Phenotypes of leaves, buds, male flowers, female flowers, and tendrils; Scale bar: 5 cm;
[0022] Figure 2 : Chlorophyll detection in the 9 DAP peel;
[0023] Figure 3 : Transmission electron micrographs of chloroplasts: (A, B) show the number of chloroplasts in Cuiqiu-Green and Cuiqiu-White respectively.
[0024] Arrows indicate chloroplasts; (C) Ultrastructure of normal-sized and -shaped chloroplasts in Cuiqiu-Green; (D) Ultrastructure of chloroplasts with increased volume and irregular shape in Cuiqiu-White;
[0025] Figure 4 : Linkage map and sequence analysis of CsLeuC: (A) Distribution of single nucleotide polymorphism (SNP)-index,
[0026] Chr1, Chr2, Chr3, Chr4, Chr5, Chr6, and Chr7 are the 7 chromosomes of cucumber respectively, and the differential SNPs
[0027] Shown with blue dots; (B) KASP genotyping of the F2 population; (C) KASP genotyping of the F3 population; (D) Gene structure of CsLeuC;
[0028] Figure 5 : Subcellular localization of CsLeuC;
[0029] Figure 6 : Analysis of CsLeuC expression level: (A) Expression level of CsLeuC in Cuiqiu-G and Cuiqiu-W; (B)
[0030] Expression level of CsLeuC in different tissues of Cuiqiu-G; Error bars represent 3 biological replicates ± SEM, **,
[0031] 0.001 < p < 0.01. *, 0.01 < p < 0.05.;
[0032] Figure 7 : Mutation of SNP-181 on the second exon of CsLeuC in different cucumber varieties. Detailed implementation method
[0033] 1 Materials and methods
[0034] 1.1 Plant materials and population construction
[0035] In 2008, the parental variety Cuiqiu was collected from a local variety in Haiyang City, Shandong Province, and provided by Yantai Dadi Seed Industry Co., Ltd. When the research group propagated the advanced inbred line parental variety Cuiqiu (with green peel) in the base in 2011, a mutant plant Cuiqiu white peel with white peel was found among more than 2,800 parental materials. After self-crossing the mutant plant Cuiqiu white peel and conducting systematic breeding for many years, the 5th generation self-crossed homozygous mutant (with white peel) Cuiqiu white and the 5th generation self-crossed homozygous near-isogenic line wild type (with green peel) Cuiqiu green were obtained. In autumn 2016 in Hunan and winter 2016 in Hainan, the hybrid F1 generation was obtained and self-crossed to get the F2 generation population. Recombinant single plants were selected from the F2 generation population and self-crossed to get the F3 generation hybrid families. In spring 2017, the two parents, F1 generation, and F2 generation population were planted in a greenhouse in spring in Hunan. In spring 2023, the F3 generation hybrid families were planted in a greenhouse in spring in Hunan. The fruit color phenotypes of the F1 generation, F2 generation population, and F3 generation hybrid families were comprehensively identified and genetic analysis was carried out. The F2 generation population was used for preliminary mapping and narrowing the mapping interval, and the F3 generation hybrid families were used for fine mapping. Except for planting the F1 generation in Hainan in 2016, the rest of the materials were planted in the greenhouse of the Vegetable Research Institute of Hunan Academy of Agricultural Sciences. Single plants were planted in double rows, with a "herringbone" support. Cultivated with plastic film mulch, and the fertilizer and water conditions were the same as the general field production level.
[0036] 1.2 Chlorophyll content detection
[0037] 3 g of fresh pericarp was collected from each sample for chlorophyll quantification. A plant chlorophyll content detection kit (BC0995, Beijing, China) was used to measure the chlorophyll a, chlorophyll b, and total chlorophyll contents of the fresh pericarps of Cuqiu Green and Cuqiu White materials using a BioTek Epoch microplate reader. The absorbance values at 663 nm and 645 nm were measured using the microplate reader and denoted as A 663 and A 645 .
[0038] Chlorophyll a content (mg / g mass) = (21.2 × A663 - 4.48 × A645) × Vext × F ÷ W ÷ 1000 = 0.01 × (21.2 × A663 - 4.48 × A645) × F ÷ W.
[0039] Chlorophyll b content (mg / g mass) = (38.2 × A645 - 7.8 × A663) × Vext × F ÷ W ÷ 1000 = 0.01 × (38.2 × A645 - 7.8 × A663) × F ÷ W.
[0040] Total chlorophyll content (mg / g mass) = (33.7 × A645 + 13.4 × A663) × Vext × F ÷ W ÷ 1000 = 0.01 × (33.7 × A645 + 13.4 × A663) × F ÷ W.
[0041] Vext: extraction solution volume, 10 mL; F: dilution factor; W: sample mass, g. Each sample was repeated 3 times, and a total of 6 samples were used.
[0042] 1.3 Transmission electron microscopy observation of chloroplasts
[0043] Fresh pericarps of Cuqiu Green and Cuqiu White were taken, and samples were taken within 1 min to 3 min. The sampled tissue was 1 mm 3 in size. Fixed in an EP tube with electron microscopy fixative (G1102, Wuhan, China), rinsed 3 times with 0.1 M phosphate buffer PB (pH 7.4) for 15 min each time. Fixed in the dark at room temperature for 7 h with 1% osmium tetroxide prepared with 0.1 M phosphate buffer PB (pH 7.4). Rinsed 3 times with 0.1 M phosphate buffer PB (pH 7.4) for 15 min each time. The tissue was dehydrated successively in 30%, 50%, 70%, 80%, 95%, 100%, 100% ethanol for 1 h each time. At 37 °C, using acetone and 812 resin (CAT#: 25068-38-6, The mixture (supplied by PA, USA) was infiltrated at a ratio of 3:1 for 2 - 4 hours, 1:1 overnight, and 1:3 for 2 - 2 hours; then infiltrated with pure 812 resin for 5 - 8 hours. The infiltrated samples were embedded in a mold, cured overnight in an oven at 37 °C, and then polymerized at 60 °C for 48 hours. The resin blocks were taken out and reserved. The resin blocks were ultrathin sectioned at 60 - 80 nm with a Leica UC7 ultramicrotome, and the sections were picked up with a 150 - mesh Fanghua film copper grid. The copper grid was stained with a saturated alcohol solution of 2% uranyl acetate in the dark for 8 min; washed 3 times with 70% alcohol; washed 3 times with ultrapure water; stained with a 2.6% lead citrate solution in the dark for 8 min to avoid carbon dioxide; washed 3 times with ultrapure water and slightly blotted with filter paper. The copper grid sections were placed in a copper grid box and dried at room temperature overnight. The chloroplast structure was observed using a Hitachi HT7800 transmission electron microscope, and representative images were collected from three biological replicates of each sample.
[0044] 1.4 Whole - genome re - sequencing
[0045] Twenty wild-type (green pericarp) individual plants and twenty mutant-type (white pericarp) individual plants were selected from the F2 segregating population, and their leaves were used to construct a green pericarp DNA pool and a white pericarp DNA pool, respectively. DNA was extracted using the CTAB method (Wilkie et al., 1997). Two parental pools (Cuiqiulu and Cuiqiubai) and two DNA pools (green pericarp pool and white pericarp pool) were obtained. The DNA samples were randomly fragmented into 350-bp fragments using a Covaris S220 Focused-ultrasonicator (Covaris, Woburn, MA, USA). A complete library was prepared through end repair, poly(A) tail addition, adapter ligation, purification, and PCR amplification. After library construction, a Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) was used for initial quantification. The library was diluted to 1 ng / μL, and then the insert size of the library was detected using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The effective concentration of the library was accurately quantified by Q-PCR (effective library concentration > 2 nM). The qualified libraries were sequenced on an Illumina Novaseq platform (HiSeq PE150). The reads were aligned to the 9930 cucumber reference genome (http: / / cucurbitgenomics.org / , version v2) using BWA software (http: / / bio-bwa.sourceforge.net / ). Software version: 0.7.12. The SAMtools software (http: / / www.htslib.org / ) was used to find the SNP sites across the genome. Software version: v0.1.18. The GATK software (version 3.2-2) was used to detect the mutation results. The SNP filtering criteria were that the sequencing depth of each SNP site and each sample was greater than or equal to 5, the alignment quality value was greater than or equal to 20, and the variant detection quality value was greater than or equal to 30. The SNP index of the recessive pool minus the dominant pool was used for mapping.
[0046] 1.5 KASP Genotyping Technology
[0047] A total of 273 F2 individuals and 400 F3 individuals were used for KASP genotyping. SNP information in the candidate region of the target gene was detected on the LGC Genomics genotyping platform at the Vegetable Center of the Beijing Academy of Agriculture and Forestry Sciences. The 100-bp DNA sequences upstream and downstream of each SNP site were intercepted as the template for KASP primer design. Three primers, Primer_Allele FAM, Primer_Allele HEX, and Primer_Common, were designed in the 5’–3’ direction using Primer Premier 5 software (Premier Biosoft, San Francisco, CA, USA).
[0048] 1.6 Gene cloning and sequencing
[0049] DNA was extracted using the CTAB method, and primers were designed using Primer Premier 5 software. 5 μl of the PCR product was subjected to 1% agarose gel electrophoresis, and the electrophoresis parameters were: 150 V, 100 mA, for 10 - 20 min for electrophoresis observation. The agarose gel block containing the target DNA was excised and recovered and purified using the Axygen Gel Extraction Kit (Axygen, Union City, CA, US). The PCR product was sequenced using the 3730XL sequencer produced by ABI, USA. After sequencing, Chromas (Technelysium Pty Ltd, Australia) and DNASTAR (DNASTAR, Inc., Madison, WI, US) were used to assemble and analyze the sequencing results.
[0050] 1.7 RNA extraction and qRT-PCR
[0051] Total RNA was extracted using the TaKaRa MiniBEST Kit (TaKaRa Bio, Japan) according to Protocol-II. cDNA synthesis was carried out using the TaKaRa PrimeScript TM RT Kit and gDNA Eraser (TaKaRa Bio, Japan). After the reverse transcription reaction, TB Green Premix Ex Taq II (TaKaRa Bio, Japan) was selected for qRT-PCR detection. CsActin (Csa6G041900) was used as the internal reference gene. The reaction was carried out in a fluorescence quantitative PCR instrument (ABI 7300). After the reaction, the amplification curve and melting curve of Real Time PCR were confirmed, and the 2 -ΔΔCT method was used to analyze the relative gene expression level. Each sample had three biological replicates.
[0052] 1.8 Subcellular localization in tobacco
[0053] The subcellular localization of the CsLeuC protein was predicted using the WoLF-PSORT online program. The full-length coding region of the CsLeuC gene, excluding the stop codon, was amplified and constructed into the pCAMBIA1300-35S-N-GFP plasmid. The pCAMBIA1300-35S-N-GFP vector was constructed and transformed into Agrobacterium tumefaciens EHA105 (transformation with the empty vector served as the control), and screening was carried out using plates with kanamycin resistance. Single colonies were picked and cultured overnight, the bacterial solution was collected, resuspended in the induction medium for 4 hours, and then resuspended in the infiltration medium. The OD600 was controlled at about 0.5. Tobacco leaves at 4 weeks old were injected using a 1 mL syringe. After 48 h, the leaves injected with Agrobacterium were cut and observed and photographed under a laser confocal scanning microscope. Induction medium formula: 60 mM K2HPO4, 33 mM KH2PO4, 7.6 mM (NH4)2SO4, 2 mM sodium citrate, 1 mM MgSO4, 0.2% glucose, 0.4% glycerol, 10 mM MES, 50 μg / mL acetosyringone, pH 5.6. Infiltration medium formula: 0.5×MS, 10 mM MES, 150 μg / mL acetosyringone, pH 5.6.
[0054] 1.9 Statistical analysis
[0055] All the collected phenotypic and histological data were initially processed using Microsoft Excel. The segregation ratios of the phenotypic and genotypic data were analyzed using SAS (Statistical Analysis System) software.
[0056] 2 Results
[0057] 2.1 Phenotypic identification of near-isogenic line cucumber materials Cuiqiulu and Cuiqiubai
[0058] Cuiqiulu and Cuiqiubai are two near-isogenic line cucumber materials that are high-generation inbred lines and have stable inheritance of fruit peel color traits. At 9 DAP (days after pollination) of the plants, it was observed that compared with the wild-type Cuiqiulu, the fruit peel of the mutant Cuiqiubai was significantly white ( Figure 1 A), while other traits such as fruit length, leaves, apical buds, male flowers, female flowers, and tendrils did not show obvious differences ( Figure 1 B).
[0059] 2.2 Detection of fruit peel chlorophyll content
[0060] The chlorophyll contents in the fresh peels of Cucumis sativus cv. Cuiqiulv and Cuiqiubai at 9 DAP during the commercial stage were detected respectively. The results showed that the chlorophyll a contents in Cuiqiulv and Cuiqiubai were 1.22 mg / g and 0.04 mg / g respectively, the chlorophyll b contents were 0.51 mg / g and 0.07 mg / g respectively, and the average total chlorophyll contents were 1.73 mg / g and 0.11 mg / g( Figure 2 ). The chlorophyll content in Cuiqiulv was 15.73 times that in Cuiqiubai, indicating that the white peel trait of Cuiqiubai might be caused by the lack of chlorophyll.
[0061] 2.3 Observation of Chloroplasts by Transmission Electron Microscopy
[0062] We compared the morphology and number of chloroplasts in the peel cells of the wild-type Cuiqiulv and the mutant Cuiqiubai by transmission electron microscopy( Figure 3 ). In Cuiqiubai, there were 2 chloroplasts with increased volume and irregular morphology, which might be related to the decrease in chlorophyll content( Figure 3 B,D). In Cuiqiulv, there were 6 chloroplasts with normal morphology, indicating that chlorophyll synthesis was in a normal state( Figure 3 A,C).
[0063] 2.4 Genetic Analysis
[0064] The F1 generation was obtained by crossing Cuiqiulv and Cuiqiubai, and the peels of the commercial fruits in the F1 generation all showed green. In 2017, the parents, F1, and F2 generation populations were planted in spring greenhouses in Hunan. The color changes of the peels were identified during the commercial stage, the traits were investigated, and genetic analysis was carried out. The investigation results showed that the chi-square test of the fruit green plants and fruit white plants conformed to the segregation ratio of 3:1 (Table 1). It indicated that the white peel trait was controlled by a recessive single gene.
[0065] Table 1 Segregation of fruit green and fruit white plants in the genetic population of Cuiqiulv × Cuiqiubai
[0066]
[0067] 2.5 Preliminary Mapping of the Target Gene by BSA-based Whole Genome Resequencing
[0068] From the F2 segregating population, we selected 20 plants with dominant traits (green pericarp) and 20 plants with recessive traits (white pericarp) to construct two DNA pools (dominant pool and recessive pool) respectively. Whole-genome resequencing was performed on two parents (Cuiqiu White and Cuiqiu Green) and two DNA pools, generating a total of 38 Gb of sequence data. The GC content of the samples was between 37.38% and 38.34%, and Q30 was ≥91.33% for all. The sequencing depths of the dominant parental pool, recessive parental pool, dominant pool, and recessive pool were 14.12×, 16.19×, 24.02×, and 25.71× respectively, all covering more than 90% of the whole genome. The data yield and quality of this sequencing met the analysis requirements. The reads were aligned to the cucumber reference genome V2 using the BWA software, and the SAMtools software was used to find SNP sites in the whole genome. Analysis of differential SNP sites was carried out, and a total of 2,710 differential SNPs were found. Since the SNP associated with the target trait is linked genetically to the SNPs around it on the chromosome, the target gene for white pericarp was preliminarily mapped to the region of 36,027,253 - 39,778,966 bp at the end of chromosome 3 in the candidate region. This region contains 1,600 SNPs( Figure 4 A).
[0069] 2.6 Fine mapping of the new gene CsLeuC for white pericarp
[0070] To narrow down the candidate region of the target gene, the KASP technique was used to genotype 273 F2 segregating populations, and recombinant individuals were selected. The new gene for white pericarp was preliminarily mapped between 387 kb of SNP3G39144487 and SNP3G39531980 on chromosome 3( Figure 4 B). To finely map the gene for white pericarp and simultaneously verify the correctness of the KASP genotyping of the F2 population, five heterozygous individuals (#169, #310, #199, #231, #319) from the F2 generation were selected and a total of 400 F3 families were planted, and 5 SNP markers were designed for genotyping verification. Finally, the target gene was mapped between 26 kb of SNP3G39505114 and SNP3G39531980 on chromosome 3( Figure 4 C). There are 4 annotated genes in the 9930 reference genome (version v2) in this interval. Sequencing found that only a missense mutation (A181T) occurred at SNP - 181 in the second exon of CsLeuC, resulting in the mutation of threonine (Thr) to serine (Ser)( Figure 4 D). The homologous gene LeuC of CsLeuC is expressed in the chloroplast of Arabidopsis thaliana. It is preliminarily speculated that CsLeuC may be related to chlorophyll synthesis in cucumber, and it was used as a candidate gene for regulating white pericarp in cucumber. Primer information is shown in Table 2.
[0071] Table 2 KASP primer information
[0072]
[0073] 2.7 Subcellular localization of CsLeuC
[0074] The prediction results of the WoLF PSORT website showed that among the 14 Nearest Neighbors, 8 were localized on chloroplasts, 5 were extracellular, and 1 was cytoplasmic. The prediction results of the CELLO website indicated that CsLeuC was localized in the cytoplasm and chloroplasts, with Reliability values of 1.666 and 1.588, respectively, much higher than those for other structures. To confirm the specific intracellular location of the CsLeuC protein, the CsLeuC fusion protein with GFP tag was transiently transfected into tobacco. The results are as Figure 5 shown. The CsLeuC-GFP signal was observed in chloroplasts, indicating that CsLeuC is distributed on chloroplasts.
[0075] 2.7 Expression analysis of CsLeuC
[0076] To understand the differential expression of CsLeuC at different stages in Cuqiulu and Cuqiubai, qRT-PCR analysis revealed that the expression level of CsLeuC in the peel of Cuqiulu was higher than that in Cuqiubai. The differential expression of CsLeuC may have led to the difference in peel color between the two materials ( Figure 6 A). Different organs (peel, carpel, root, flower, stem, tendril, and leaf) of Cuqiulu were selected to analyze the expression level of CsLeuC. The results showed that the highest expression level of CsLeuC was in leaves, which was higher than that in other organs. Secondly, it was also expressed in flowers, carpels, and peels ( Figure 6 B).
[0077] 2.8 Development of KASP markers
[0078] The KASP marker related to the white fruit peel trait of cucumber described in the present invention and its application are located at 181 bp of the second exon of Csa3G912340 (CsLeuC gene) (SNP-181). Cucumber fruit peels with base T:T at this position are white, while those with base A:A are green.
[0079] The primers for detecting the KASP marker related to the white fruit peel trait of cucumber are:
[0080] Primer_AlleleFAM:
[0081] GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA (SEQ ID NO.2)
[0082] Primer_AlleleHEX:
[0083] GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT (SEQ ID NO.3)
[0084] Primer_Common: CGCCTCAACAATCGGAACGCAAG (SEQ ID NO.4).
[0085] The present invention first performs KASP analysis on 428 materials including Cuiqiulu parents, Cuiqiubai parents, hybrid F2 generation materials, and F3 generation materials, and conducts phenotypic identification of the pericarp color of the 428 materials.
[0086] The Cuiqiulu parents are A:A at SNP-181, with a pericarp phenotype of green, a total of 19 plants. The Cuiqiubai parents are T:T at SNP-181, with a pericarp phenotype of white, a total of 15 plants. F1 is a heterozygous population, A:T at SNP-181, with a pericarp phenotype of green, a total of 20 plants (Table 3).
[0087] The F2 population has a total of 327 plants. At SNP-181, there are 69 plants with T:T, 64 plants with a pericarp phenotype of white, and the other 5 plants have a pericarp green phenotype. At SNP-181, there are 72 plants with A:A, 71 plants with a pericarp phenotype of white, and only 1 plant has a pericarp green phenotype. Among the 186 heterozygous plants with A:T at SNP-181, 180 plants have a pericarp phenotype of green and 6 plants have a pericarp white phenotype (Table 3).
[0088] The F3 population has a total of 141 plants. At SNP-181, there are 3 plants with A:A, all with a pericarp green phenotype. There are 2 plants with T:T, all with a pericarp white phenotype. There are 42 heterozygous plants with A:T, all with a pericarp green phenotype (Table 4). In summary, it shows that this SNP-181 is linked to the pericarp white trait.
[0089] Table 3 Relationship between KASP detection results of SNP-181 and pericarp phenotypic traits
[0090]
[0091]
[0092]
[0093]
[0094]
[0095] Relationship between KASP detection results of SNP-181 and pericarp phenotypic traits
[0096]
[0097]
[0098] 2.9 Detection of SNP39505114 in the second exon of CsLeuC in cucumber varieties with different pericarp colors
[0099] In addition, we sequenced SNP-181 in the second exon of CsLeuC in cucumber pericarp white materials (Cuiqiu-W and T-1-5) and pericarp green materials (Cuiqiu-G, NY19, S519 and BLF), respectively. The results showed that the SNP in the pericarp white materials was base T, and the SNP in the pericarp green materials was base A( Figure 7 ), further verifying that CsLeuC is the key gene for the formation of cucumber pericarp greenness.
Claims
1. A KASP marker related to the white trait of cucumber peel, characterized in that, The SNP locus of the KASP marker corresponds to CsLeuC a mutation from base A to T at 181 bp in the second exon of the gene. Cucumbers with the TT genotype at this molecular marker have white fruit peels.
2. The KASP marker related to the white trait of cucumber peel according to claim 1, characterized in that, The nucleotide sequence of the KASP marker is as shown in DEQ ID NO.
1.
3. A kit for detecting KASP markers related to the white trait of cucumber peel, characterized in that, The kit includes primers for detecting the KASP marker related to the white fruit peel trait of cucumber, and the primers include: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA; Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT; Primer_Common: CGCCTCAACAATCGGAACGCAAG.
4. Application of a reagent for detecting the KASP marker related to the white fruit peel trait of cucumber in the genetic breeding identification of the white fruit peel trait of cucumber; the KASP marker is the KASP marker described in claim 1.
5. Application of primers for detecting the KASP marker related to the white fruit peel trait of cucumber in the genetic breeding identification of the white fruit peel trait of cucumber; the KASP marker is the KASP marker described in claim 1, and the primers are the primers described in claim 3.