High-toxicity klebsiella pneumoniae gene deletion strain, construction method and application

Abstract

The invention discloses a high-virulence klebsiella pneumoniae gene deletion strain, a construction method and application, the high-virulence klebsiella pneumoniae gene deletion strain is obtained by knocking out a uvrD gene from a high-virulence klebsiella pneumoniae gene, and the sequence of the knocked-out uvrD gene is as shown in SEQ ID NO.1. The invention further discloses a construction method of the high-virulence klebsiella pneumoniae gene deletion strain. The attenuated live vaccine prepared from the high-virulence klebsiella pneumoniae gene deletion strain provides high immune protection for mice, has good immune protection compared with an attenuated dead vaccine, has a wide market application prospect, broadens the research on the pathogenesis of hvKP, and provides a theoretical basis for prevention and treatment of hvKP.

Description

Technical Field

[0001] The present invention relates to the field of genetic biology, and particularly relates to a hypervirulent Klebsiella pneumoniae gene deletion strain, a construction method and an application thereof. Background Art

[0002] Klebsiella pneumoniae (KP) is a common opportunistic pathogen in clinical practice, which can colonize in multiple parts of the human body such as the respiratory tract, digestive tract, urinary tract, skin, etc., and can cause severe community- and hospital-acquired infections. Hypervirulent Klebsiella pneumoniae (hvKP) is a highly virulent variant of Klebsiella pneumoniae, which can infect healthy people without underlying diseases and cause severe community-acquired infections, such as severe pneumonia, liver abscess and bloodstream infection. In addition, hvKP is more likely to cause severe invasive and disseminated infections than classical Klebsiella pneumoniae (cKP), and it has high invasiveness and high pathogenicity, which increases the difficulty of the diagnosis and treatment of KP infections.

[0003] The World Health Organization (WHO) has called for the use of vaccines to address the major public health problem of microbial resistance. There are many existing vaccine types, but all have certain deficiencies. The KP capsular polysaccharide (CPS) vaccine was first reported in 1985, but the high variability based on capsular serotypes limits the vaccine coverage rate, and there is currently a lack of a universal KP vaccine in clinical practice. Inactivated vaccines mainly produce antibodies against extracellular pathogens, and pathogens located intracellularly cannot be neutralized by antibodies produced by serum, resulting in insufficient protection. Relatively speaking, live attenuated vaccines are replicating vaccines, which can induce a good cellular immune response after vaccination, so as to efficiently eliminate invading pathogens. Therefore, the research and popularization of KP live attenuated vaccines are expected to prevent KP infections and reduce the drug resistance of KP.

[0004] A key factor determining the safety of live attenuated vaccines is the low virulence of the vaccine strain. Currently, it is known that KP uses a variety of virulence factors to enhance its own virulence, such as capsular polysaccharide, lipopolysaccharide, siderophore, flagellum, outer membrane protein and secreted protein, etc. The uvrD gene encodes an ATP-dependent DNA helicase, which is widely involved in DNA replication, mismatch repair (MMR) and nucleotide excision repair (NER). Existing research focuses on the role of uvrD in bacterial DNA repair, but the mechanism by which it indirectly affects virulence heterogeneity by regulating genomic stability has not been clarified. Therefore, there has been no report on the research of deleting the uvrD gene of KP and constructing a live attenuated vaccine in the prior art. Summary of the Invention

[0005] In view of the problems existing in the prior art, the present invention provides a highly virulent Klebsiella pneumoniae gene deletion strain, a construction method and an application thereof to solve the problems raised in the above background art.

[0006] A highly virulent Klebsiella pneumoniae gene deletion strain is obtained by knocking out the uvrD gene in the highly virulent Klebsiella pneumoniae gene, wherein the sequence of the knocked-out uvrD gene is as shown in SEQ ID NO.1.

[0007] The beneficial effects of the highly virulent Klebsiella pneumoniae gene deletion strain according to the present invention are as follows: Experiments show that the hvKP lacking the uvrD gene in the present invention has a weakened killing effect on Galleria mellonella, and a weakened colonization number in the internal organs of mice, and reduced damage to the liver and lungs, indicating that knocking out the uvrD gene in hvKP can reduce the pathogenicity of hvKP. At the same time, the immunoprotection experiment proves that the live attenuated vaccine prepared from the highly virulent Klebsiella pneumoniae gene deletion strain provides high immunoprotection for mice, has good immunoprotection compared with the inactivated attenuated vaccine, has broad market application prospects, broadens the research on the pathogenic mechanism of hvKP, and provides a theoretical basis for the prevention and treatment of hvKP.

[0008] On the other hand, the present invention also provides an application of the highly virulent Klebsiella pneumoniae gene deletion strain as described above in the preparation of a live attenuated vaccine for preventing highly virulent Klebsiella pneumoniae infection.

[0009] On the other hand, the present invention also provides a construction method of a highly virulent Klebsiella pneumoniae gene deletion strain, and the method includes: S1. Using the first primer and the second primer, performing PCA amplification with the whole genome DNA of highly virulent Klebsiella pneumoniae as a template to obtain an amplification product, and purifying the amplification product to obtain a uvrD gene homologous arm sequence fragment; S2. Incubating the suicide plasmid pLP12 with a recombinase, cloning the uvrD gene homologous arm sequence fragment into the restriction enzyme site of the suicide plasmid pLP12 to obtain a ligation product, transforming the ligation product into Escherichia coli competent S17-λpir to obtain transformed bacteria, culturing the transformed bacteria, selecting a single colony and performing colony PCR verification with the third primer and the fourth primer, screening positive clone bacteria and expanding the culture to obtain the plasmid pLP12-uvrD; S3. Electrotransform the plasmid pLP12-uvrD into competent Escherichia coli β2163 cells. After the transformation is completed, add DAP-LB liquid medium for resuscitation to obtain a resuscitated bacterial solution. Spread the resuscitated bacterial solution on an LB plate for cultivation, and then pick the positive strains resistant to gentamicin to obtain the pLP12-uvrD / β2163 strain; S4. Co-culture the pLP12-uvrD / β2163 strain with highly virulent Klebsiella pneumoniae HV-KP2 to produce a conjugation effect, and then screen the HV-KP2 strain with an insertion mutation of the first homologous recombination on an LB plate to obtain the pLP12-uvrD / HV-KP2 mutant; S5. Screen the uvrD gene deletion strain with the second homologous recombination of the pLP12-uvrD / HV-KP2 mutant on an LB plate to obtain the highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD.

[0010] Preferably, in the step S1, the amplification program of PCA amplification is: 98°C for 5 min; 98°C for 15 s, 58°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 5 min, and store at 12°C.

[0011] Preferably, the sequence of the first primer is as shown in SEQ ID NO.2, and the sequence of the second primer is as shown in SEQ ID NO.3.

[0012] Preferably, the sequence of the third primer is as shown in SEQ ID NO.4, and the sequence of the fourth primer is as shown in SEQ ID NO.5.

[0013] Preferably, in the step S3, the conditions for electrotransformation are: 3.0 kV / cm, 200 Ω, 25 μF.

[0014] Preferably, the step S4 is specifically as follows: After overnight culturing the pLP12-uvrD / β2163 strain and the highly virulent Klebsiella pneumoniae HV-KP2 respectively, take 100 μL of each bacterial solution and mix them. Centrifuge to discard the supernatant, then add 10 μL of fresh LB to resuspend and spread on a DAP-LB plate, and culture at 30°C for 12 h. Then wash all the bacteria with 1 mL of LB and take 100 μL of the washed bacteria and spread them on a Gen-LB plate. Pick the single colonies on the Gen-LB plate and perform colony PCR identification with the first primer and the second primer. The correct insertion mutant is used as the pLP12-uvrD / HV-KP2 mutant.

[0015] Preferably, the step S5 is specifically as follows: Inoculate the pLP12-uvrD / HV-KP2 mutant strain on LB liquid medium, shake and culture for 2 h, take 100 μL of the bacterial liquid and spread it on an LB plate containing 0.02% L-arabinose, culture at 37 °C for 12 h, pick single colonies on the plate, after enlarged culture, extract its genomic DNA, perform PCR amplification with the fifth primer and the sixth primer, perform sequencing identification after amplification, and use the correctly identified scarless mutant strain as the high-virulence Klebsiella pneumoniae gene deletion strain ΔuvrD.

[0016] Preferably, the sequence of the fifth primer is as shown in SEQ ID NO.6, and the sequence of the sixth primer is as shown in SEQ ID NO.7.

[0017] Additional aspects and advantages of the present invention will be given in part in the following description, will become apparent in part from the following description, or will be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 It is a PCR verification result diagram of the high-virulence Klebsiella pneumoniae gene deletion strain provided by the embodiment of the present invention; Figure 2 It is a schematic diagram of the influence result of the uvrD gene on the lethality of hvKP in the greater wax moth model provided by the embodiment of the present invention; Figure 3 It is a result diagram of the influence of the uvrD gene on the growth of hvKP in mice provided by the embodiment of the present invention; Figure 4 It is a result diagram of the influence of the uvrD gene on the inflammation of the liver, lung, kidney, and spleen caused by the growth of hvKP in mice provided by the embodiment of the present invention.

[0020] The following will further illustrate the embodiments of the present invention with reference to the drawings. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0021] The present invention provides a highly virulent Klebsiella pneumoniae gene deletion strain, a construction method and an application. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate alterations and combinations to the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0022] The highly virulent Klebsiella pneumoniae gene deletion strain in the present invention is obtained by knocking out the uvrD gene of the highly virulent Klebsiella pneumoniae gene by means of homologous recombination, wherein the sequence of the knocked-out uvrD gene is as shown in SEQ ID NO.1.

[0023] Meanwhile, the whole genome of the highly virulent Klebsiella pneumoniae gene is the gene sequence publicly disclosed in the prior art and will not be elaborated here.

[0024] The present invention also provides an application of the highly virulent Klebsiella pneumoniae gene deletion strain in the preparation of a live attenuated vaccine for preventing highly virulent Klebsiella pneumoniae infection.

[0025] The sequence shown in SEQ ID NO.1 is as follows:

[0026] The present invention also provides a method for constructing a highly virulent Klebsiella pneumoniae gene deletion strain, and the method includes: S1. Using a first primer and a second primer, performing PCA amplification with the whole genome DNA of highly virulent Klebsiella pneumoniae as a template to obtain an amplification product, and purifying the amplification product to obtain a uvrD gene homologous arm sequence fragment; S2. Incubating the suicide plasmid pLP12 with a recombinase, cloning the uvrD gene homologous arm sequence fragment into the restriction enzyme site of the suicide plasmid pLP12 to obtain a ligation product, transforming the ligation product into Escherichia coli competent S17-λpir to obtain transformed bacteria, culturing the transformed bacteria, selecting a single colony and performing colony PCR verification with a third primer and a fourth primer, screening positive clone bacteria and expanding the culture to obtain plasmid pLP12-uvrD; S3. Electrotransforming plasmid pLP12-uvrD into Escherichia coli β2163 competent cells, adding DAP-LB liquid medium for resuscitation after transformation to obtain a resuscitated bacterial solution, spreading the resuscitated bacterial solution on an LB plate for culture, and then picking positive strains resistant to gentamicin to obtain pLP12-uvrD / β2163 strains; S4. Co-culturing the pLP12-uvrD / β2163 strain with highly virulent Klebsiella pneumoniae HV-KP2 to produce a conjugation effect, and then screening for HV-KP2 strains with an insertion mutation of the first homologous recombination on an LB plate to obtain pLP12-uvrD / HV-KP2 mutant strains; S5. Screening for uvrD gene deletion strains with the second homologous recombination on an LB plate for the pLP12-uvrD / HV-KP2 mutant strains to obtain a highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD.

[0027] In the step S1, the amplification program of PCA amplification is: 98°C for 5 min; 98°C for 15 s, 58°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 5 min, and storing at 12°C; The sequence of the first primer is shown as SEQ ID NO.2, and the sequence of the second primer is shown as SEQ ID NO.3; The sequence shown as SEQ ID NO.2 is: GGAATTCTAGACCTTTGAGTCGAATTCATGAACGCTATGCTGACGTGAT.

[0028] The sequence shown as SEQ ID NO.3 is: ACCCTCACTAAAGGGAACAGCTAGCCTGATTTGTGCCCGCCGGACACT。

[0029] The sequence of the third primer is shown as SEQ ID NO.4, and the sequence of the fourth primer is shown as SEQ ID NO.5; The sequence shown in SEQ ID NO.4 is: GACACAGTTGTAACTGGTCCA。

[0030] The sequence shown in SEQ ID NO.5 is: CAGGAACACTTAACGGCTGAC。

[0031] In the step S3, the conditions for electrotransformation are: 3.0 kV / cm, 200 Ω, 25 uF; The step S4 is specifically as follows: After the pLP12-uvrD / β2163 strain and the highly virulent Klebsiella pneumoniae HV-KP2 are cultured overnight respectively, 100 μL of each bacterial liquid is mixed, centrifuged to discard the supernatant, then 10 μL of fresh LB is added to resuspend and spread on the DAP-LB plate, cultured at 30 °C for 12 h, then all the bacteria are washed off with 1 mL of LB and 100 μL of the washed bacteria is taken and spread on the Gen-LB plate. Single colonies on the Gen-LB plate are taken and identified by colony PCR with the first primer and the second primer, and the correct insertion mutant strain is used as the pLP12-uvrD / HV-KP2 mutant strain; The step S5 is specifically as follows: The pLP12-uvrD / HV-KP2 mutant strain is inoculated on the LB liquid medium and cultured with shaking for 2 h. 100 μL of the bacterial liquid is taken and spread on the LB plate containing 0.02% L-arabinose, cultured at 37 °C for 12 h. Single colonies on the plate are taken, expanded and cultured, and then the whole genome DNA is extracted. PCR amplification is carried out with the fifth primer and the sixth primer, and sequencing identification is carried out after amplification. The correct scarless mutant strain is used as the highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD; The sequence of the fifth primer is shown as SEQ ID NO.6, and the sequence of the sixth primer is shown as SEQ ID NO.7; The sequence shown in SEQ ID NO.6 is: GATCGCGATAACACCCGATC。

[0032] The sequence shown in SEQ ID NO.7 is: CCATGTTTTCATACTGGCGTG。

[0033] The reagent consumables used in the present invention are all ordinary commercially available products. The present invention will be further elaborated below in conjunction with examples: Example 1 Construction of a highly virulent Klebsiella pneumoniae gene deletion strain 1. Main culture media, reagents and instruments The culture medium is LB medium; the reagents include: 2× Taq Master Mix (Dye Plus) (Novoprotein), ordinary DNA product purification kit (Novoprotein), plasmid miniprep kit (Novoprotein), genomic DNA extraction kit (Novoprotein), Gentamicin, Diaminopimelic acid (DAP), D-glucose, L-arabinose (Biosharp); the instruments include a constant temperature incubator (Yiheng), a constant temperature shaking incubator (Lanyi), a low-temperature tabletop high-speed centrifuge (Eppendorf), and an electroporation instrument (Bio Rad).

[0034] 2. Construction steps A. Preparation and purification of the target gene deletion fragment Determine the sequence of the uvrD gene in highly virulent Klebsiella pneumoniae through the NCBI database. According to the primer design principle of the Novoprotein homologous recombination website, design the homologous arms of the target gene and related primers, and design the left and right homologous arms of the uvrD gene. The specific operation is as follows: Use the first primer and the second primer to perform PCR amplification with the extracted genomic DNA of highly virulent Klebsiella pneumoniae as the template. Amplification program: 98°C for 5 min; 98°C for 15 s, 58°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 5 min, store at 12°C. Purify the PCR product with a DNA recovery kit to obtain the uvrD gene homologous arm sequence fragment, and store it at -20°C for later use.

[0035] B. Construction and identification of plasmid pLP12-uvrD Incubate the suicide plasmid pLP12 with a recombinase (ClonExpress Ultra One Step Cloning Kit V2, Vazyme). After incubating at 50°C for 5 min, directionally clone the uvrD gene homologous arm sequence fragment into the restriction enzyme digestion site of the suicide plasmid pLP12. Then transform the ligation product into Escherichia coli competent S17-λpir, coat the transformed bacteria on a 50 μg / mL Gen-LB resistant solid medium (Gentamicin), pick a single colony, and perform colony PCR verification with the third primer and the fourth primer. Expand the culture of the selected positive clone bacteria and extract the plasmid to obtain plasmid pLP12-uvrD, and store it at -20°C for later use.

[0036] C. Construction of the donor strain pLP 12-uvrD / β2163 Electrotransform the plasmid pLP12-uvrD into competent Escherichia coli β2163 cells (the competent β2163 cells are prepared in advance). Specific method: Take 10 μL of the pLP12-uvrD plasmid and add it to the competent β2163 cells for electrotransformation. The transformation conditions are: 3.0 kV / cm, 200 Ω, 25 μF. Immediately after electrotransformation, add 1 mL of pre-warmed DAP-LB liquid medium and resuscitate at 37 °C for 1 h. Take 100 μL of the resuscitated bacterial liquid and spread it on an LB plate (Gen = 50 μg / mL, DAP = 0.3 mmol / L, 0.3% D-glucose), and culture it at 37 °C for 12 h. Pick the positive strains resistant to gentamicin and name them pLP12-uvrD / β2163 strains.

[0037] D. Construction and identification of insertion mutant strains Co-culture the pLP12-uvrD / β2163 strain with the highly virulent Klebsiella pneumoniae HV-KP2 to produce a conjugation effect, and then screen for the HV-KP2 strain with an insertion mutation resulting from the first homologous recombination on an LB plate (50 μg / mL Gen + 0.3% D-glucose). The specific operation is as follows: After overnight culturing the pLP12-uvrD / β2163 strain and the highly virulent Klebsiella pneumoniae HV-KP2 respectively, take 100 μL of each bacterial liquid and mix them. Centrifuge to discard the supernatant, then add 10 μL of fresh LB to resuspend and spread it on a DAP-LB plate, and culture it at 30 °C for 12 h. Wash all the bacteria with 1 mL of LB and take 100 μL to spread on a Gen-LB plate. Pick single colonies on the plate and perform colony PCR identification with the first primer and the second primer. Name the correct insertion mutant strain pLP12-uvrD / HV-KP2 mutant strain.

[0038] E. Construction and identification of deletion mutant strains Screen the above pLP12-uvrD / HV-KP2 mutant strain on an LB plate (containing 0.4% L-arabinose) to obtain a uvrD gene deletion strain resulting from the second homologous recombination. The specific operation is as follows: Inoculate the pLP12-uvrD / HV-KP2 mutant strain into an appropriate amount of LB liquid medium and shake culture for 2 h. Take 100 μL of the bacterial liquid and spread it on an LB plate containing 0.4% L-arabinose, and culture it at 37 °C for 12 h. Pick single colonies on the plate, expand the culture, and then extract its genomic DNA (refer to the instruction manual of the Novoprotein Genomic DNA Extraction Kit). Perform PCR amplification with the fifth primer and the sixth primer, and perform sequencing identification (the sequencing is completed by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.). The results Figure 1As shown, the correctly identified highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD was stored at -20°C for future use.

[0039] Example 2. Effect of the highly virulent Klebsiella pneumoniae gene deletion strain on the pathogenicity of hvKP In this example, the virulence of the wild strain (highly virulent Klebsiella pneumoniae HV-KP2) and the knockout strain (highly virulent Klebsiella pneumoniae gene deletion strain) on the host was determined through the Galleria mellonella killing experiment and the murine bloodstream infection model to verify the change in virulence of the knockout strain relative to the wild strain.

[0040] 1. Galleria mellonella killing experiment: The Galleria mellonella killing experiment was used to determine the lethal ability of the wild strain and the knockout strain against Galleria mellonella. The wild strain and the knockout strain were inoculated from the stock culture tubes stored in the refrigerator. After picking single colonies and shaking the bacteria overnight, they were subcultured at a 1:100 ratio until the mid-late logarithmic phase. After washing 3 times with sterile pre-cooled PBS, the concentrations of both strains were adjusted to OD 600 = 1.0 and diluted 10-fold. Galleria mellonella weighing about 300 mg were selected as the in vivo virulence detection model (Galleria mellonella were purchased from Tianjin Huide Co., Ltd.). 10 μL of bacteria were injected into the left hind leg of the second last segment of each Galleria mellonella, so that the amount of bacteria in each Galleria mellonella was controlled at 1.0×10 7 CFU. A wild group, a knockout group, and a PBS control group were set up. The wild strain, the knockout strain, and normal saline were injected into these three groups respectively, and each group had 10 Galleria mellonella. After the operation, they were placed at 37°C and observed every 12 h. The survival numbers were recorded and the survival curves of the wild group and the knockout group were plotted. The results are as Figure 2 shown.

[0041] It can be seen from Figure 2 that hvKP has a strong lethal effect on Galleria mellonella. In contrast, Galleria mellonella infected with the highly virulent Klebsiella pneumoniae gene deletion strain died more slowly. There were obvious differences in the killing effects of these two strains on Galleria mellonella, indicating that the virulence of hvKP decreased after deleting the uvrD gene.

[0042] 2. Mouse infection experiment Experimental purpose: To investigate the effect of strain infection on the bacterial load in organs and the visceral tissue structure of mice. A murine bloodstream infection model was constructed using the wild strain and the knockout strain. The accumulation of different strains in different organs of mice was reflected by isolating the bacteria from the liver, lung, kidney, and spleen of mice. The damage degree of different strains to different organs of mice was reflected by HE staining of mouse lung tissue sections.

[0043] Constructing a mouse model infected with wild-type and knockout strains: inoculate wild-type and knockout strains from the bacterial tubes stored in the refrigerator, pick a single colony and shake overnight, then shake twice at a ratio of 1:100 until the middle and late logarithmic growth phase, wash three times with sterile PBS buffer, adjust the concentration of both strains to OD600 of 1.0, and dilute 10 times for later use. Prepare 18 C57BL / 6J mice of about 8 weeks old (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.), and randomly and evenly divide the mice into three groups, namely, the wild-type infection group, the knockout strain infection group, and the PBS control group. The three groups of mice were injected with 100 uL of the wild-type strain (1.0×10 6 CFU), knockout strains (1.0 × 10 6 CFU) and PBS buffer. Organ bacterial load counts after infection with wild-type and knockout strains: Observe the condition of mice within 12 hours of infection. If there are signs of dying such as mental depression, difficulty breathing, and slow movement, immediately take samples and kill them. If there are no signs of dying, take samples and kill them uniformly 12 hours after modeling. Then, use aseptic techniques to collect the liver, lungs, kidneys, and spleen of mice and place them in a 1.5mL EP tube containing 200uL sterile PBS buffer. Use an electric tissue grinder to fully grind the collected tissues in a low-temperature, sterile environment. The ground tissue homogenate is diluted 10-100 times, and then the bacterial count in these organs is detected by the plate count method. The results are as follows: Figure 3 shown. from Figure 3 It can be seen that after hvKP infected mice, the liver, lungs, kidneys, and spleen of the mice were all affected, and the number of bacteria isolated from each gram of internal organs after grinding could reach up to 10 6 CFU, in contrast, the amount of bacteria isolated from the viscera of mice infected with the highly virulent gene-deficient strain of Klebsiella pneumoniae decreased significantly after 12 hours. The above results indicate that there is a significant difference in the invasion of the two strains on the viscera of mice, *: p<0.05, **: p<0.01, ***: p<0.001, ns: no significant difference.

[0044] Effects of infection with wild-type and knockout strains on the visceral tissue structure of mice The liver, lung, kidney, and spleen of mice were collected using the same method as above, and then the collected organs were fixed in tissue fixative. Immediately after collecting the organs, the visceral tissues of mice were embedded, sectioned, and HE-stained to detect whether inflammation occurred in the visceral organs of mice. Figure 4 shown. from Figure 4It can be seen that the inflammation of the lungs is most affected. Therefore, the lung inflammation will be mainly described below. After the mice were infected with hvKP, the lung morphology of the mice was severely damaged. Compared with the PBS control group, the alveolar septum of the lungs of the mice infected with the wild strain was significantly thickened, and a large number of neutrophils were visible, indicating that the infection with the wild strain caused an inflammatory response in the lungs of the mice. In contrast, compared with the PBS control group, the alveolar septum of the lungs of the mice infected with the knockout strain was slightly thickened, and neutrophils were occasionally seen, indicating that the infection with the knockout strain caused only a mild inflammatory response in the lungs of the mice.

[0045] Therefore, it can be known that the deletion of the uvrD gene can significantly reduce the pathogenicity of hvKP. The gene-deleted strain of hypervirulent Klebsiella pneumoniae is a weak virulent strain and can be used to prepare a live attenuated vaccine for preventing the infection of hypervirulent Klebsiella pneumoniae.

[0046] In summary, the experiments show that the deletion of the uvrD gene in hvKP of the present invention weakens the killing effect on Galleria mellonella, reduces the colonization number in the internal organs of mice, and decreases the damage to the liver and lungs, indicating that the deletion of the uvrD gene in hvKP can reduce the pathogenicity of hvKP. At the same time, the live attenuated vaccine prepared from the gene-deleted strain of hypervirulent Klebsiella pneumoniae provides a high level of immune protection for mice through the immune protection experiment, has good immune protection compared with the inactivated vaccine, has broad market application prospects, broadens the research on the pathogenic mechanism of hvKP, and provides a theoretical basis for the prevention and treatment of hvKP.

[0047] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.

[0048] The above-described embodiments only represent several implementation manners of the present invention. The descriptions are relatively specific and detailed, but should not be construed as a limitation on the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention should be subject to the appended claims.

Claims

1. A highly virulent Klebsiella pneumoniae gene deletion strain, characterized in that, The highly virulent Klebsiella pneumoniae gene deletion strain is obtained by knocking out the uvrD gene in the highly virulent Klebsiella pneumoniae gene, wherein the sequence of the knocked-out uvrD gene is as shown in SEQ ID NO.

1.

2. Use of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 1 in the preparation of a live attenuated vaccine for preventing infection with highly virulent Klebsiella pneumoniae.

3. A method for constructing a highly virulent Klebsiella pneumoniae gene deletion strain, characterized in that, The method includes: S1. Using a first primer and a second primer, performing PCA amplification with the genomic DNA of highly virulent Klebsiella pneumoniae as a template to obtain an amplification product, and purifying the amplification product to obtain a uvrD gene homologous arm sequence fragment; S2. Incubating the suicide plasmid pLP12 with a recombinase, cloning the uvrD gene homologous arm sequence fragment into the restriction enzyme site of the suicide plasmid pLP12 to obtain a ligation product, transforming the ligation product into Escherichia coli competent S17-λpir to obtain transformed bacteria, culturing the transformed bacteria, picking a single colony and performing colony PCR verification with a third primer and a fourth primer, screening positive clone bacteria and expanding the culture to obtain the plasmid pLP12-uvrD; S3. Electrotransforming the plasmid pLP12-uvrD into Escherichia coli β2163 competent cells, adding DAP-LB liquid medium for resuscitation after transformation to obtain a resuscitated bacterial solution, spreading the resuscitated bacterial solution on an LB plate for culture, and then picking a positive strain resistant to gentamicin to obtain the pLP12-uvrD / β2163 strain; S4. Co-culturing the pLP12-uvrD / β2163 strain with highly virulent Klebsiella pneumoniae HV-KP2 to produce a conjugation effect, and then screening the HV-KP2 strain with an insertion mutation of the first homologous recombination on an LB plate to obtain the pLP12-uvrD / HV-KP2 mutant strain; S5. Screening the uvrD gene deletion strain with the second homologous recombination of the pLP12-uvrD / HV-KP2 mutant strain on an LB plate to obtain the highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD.

4. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, In the step S1, the amplification program of PCA amplification is: 98°C for 5 min; 98°C for 15 s, 58°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 5 min, and storing at 12°C.

5. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, The sequence of the first primer is as shown in SEQ ID NO.2, and the sequence of the second primer is as shown in SEQ ID NO.

3.

6. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, The sequence of the third primer is as shown in SEQ ID NO.4, and the sequence of the fourth primer is as shown in SEQ ID NO.

5.

7. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, In the step S3, the conditions for electrotransformation are: 3.0 kV / cm, 200 Ω, 25 μF.

8. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, The step S4 is specifically: After overnight culturing the pLP12-uvrD / β2163 strain and the highly virulent Klebsiella pneumoniae HV-KP2 respectively, 100 μL of each bacterial liquid was mixed, centrifuged to discard the supernatant, then resuspended in 10 μL of fresh LB and spread on a DAP-LB plate, cultured at 30 °C for 12 h. After that, all the bacteria were washed off with 1 mL of LB and 100 μL of the washed bacteria was spread on a Gen-LB plate. Single colonies on the Gen-LB plate were taken and identified by colony PCR with the first primer and the second primer. The correctly inserted mutant strain was used as the pLP12-uvrD / HV-KP2 mutant strain.

9. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 3, characterized in that, The specific steps of step S5 are as follows: The pLP12-uvrD / HV-KP2 mutant strain was inoculated on LB liquid medium and cultured with shaking for 2 h. 100 μL of the bacterial liquid was spread on an LB plate containing 0.02% L-arabinose and cultured at 37 °C for 12 h. Single colonies on the plate were taken, expanded and cultured, and then its genomic DNA was extracted. PCR amplification was carried out with the fifth primer and the sixth primer, and sequencing identification was carried out after amplification. The correctly identified scarless mutant strain was used as the highly virulent Klebsiella pneumoniae gene deletion strain ΔuvrD.

10. The construction method of the highly virulent Klebsiella pneumoniae gene deletion strain according to claim 9, characterized in that, The sequence of the fifth primer is as shown in SEQ ID NO.6, and the sequence of the sixth primer is as shown in SEQ ID NO.7.

Images