Novel recombinant contagious pustular dermatitis virus and application of novel recombinant contagious pustular dermatitis virus in preparation of antitumor drugs
By constructing a recombinant virus with ORFV viral vector deletion of ORFs005-008 and inserting the GM-CSF gene, the drug resistance and GM-CSF transmission challenges of existing cancer treatment methods are solved, and the lysis and immune activation of tumor cells are achieved, which significantly inhibits tumor growth and provides a safe and efficient tumor treatment strategy.
Patent Information
- Application Number
- CN202510492001.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-07-22
Smart Images

Figure CN120349977A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an ORFV oncolytic virus expressing GM-CSF. Background Art
[0002] Surgery, chemotherapy, radiotherapy, and targeted therapy are the primary clinical methods for cancer treatment, but their effects are limited by drug resistance. Based on a better understanding of virology, tumor immunology, and molecular genetics, researchers' interest in tumor immunotherapy has been increasing. Oncolytic viruses are a type of virus that can replicate within tumor cells through different regulatory mechanisms and then lyse the tumor cells without affecting the growth of normal cells. During the lysis of tumor cells, oncolytic viruses release tumor-specific antigens, thereby activating the body's specific immune response. Oncolytic viruses can kill tumor cells through two ways: direct lysis and immune effects. In the 1990s, the technology for recombinant virus genome modification gradually matured, greatly improving the efficacy, specificity, and safety of oncolytic viruses in tumor treatment. A number of anti-tumor oncolytic virus drugs have been successfully marketed one after another. In 2015, the US FDA approved the oncolytic herpes simplex virus talimogene laherparepvec (T-VEC) of Amgen for the treatment of melanoma. In December of the same year, T-VEC was also approved by the European Union for the treatment of unresectable stage IIIb, IIIc, and IVM1a melanoma that has not metastasized to the bones, brain, lungs, or other organs. The success of T-VEC has greatly promoted the research and development of oncolytic viruses in the field of tumor treatment.
[0003] Orf virus (ORFV), also known as contagious ecthyma virus of sheep, is a member of the family Poxviridae, genus Parapoxviruses (PPVs), a linear double-stranded DNA virus, and is a novel oncolytic virus with high immunogenicity and unique immune stimulation. In 2023, Lin Jing et al. demonstrated that ORFV lacking the ORFs120 gene does not change its tumor tropism, replication, pro-inflammatory characteristics, and anti-tumor ability. Research shows that the recombinant expression of pseudorabies virus glycoprotein gC or gD using ORFV as a vector can protect guinea pigs from porcine pseudorabies virus infection. The ORFV D1701 strain lacking the VEGF gene is a novel virus vector system. To express the glycoprotein gene of rabies virus, the D1701-V-rabies virus glycoprotein recombinant strain was constructed. The recombinant virus can be used for a single immunization to neutralize highly efficient rabies virus in mice, cats, and dogs. After immunization with the recombinant virus, mice obtained good immune protection mediated by CD4 + T cells and could completely resist the attack of rabies virus on the brain. Therefore, ORFV can be developed to carry larger gene fragments and used as a candidate anti-tumor biotherapeutic drug.
[0004] Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a multifunctional hematopoietic growth factor and an important immunostimulatory factor. Its mechanism of action is mainly to promote the differentiation, maturation, and expansion of dendritic cells (DC) and macrophages, and to enhance their functions. Studies have shown that in addition to promoting the recovery of leukopenia caused by tumor chemotherapy, it can also induce the proliferation and differentiation of bone marrow dendritic cells and M1 macrophages, enhance antigen presentation, and induce the body's anti-tumor immune effect.
[0005] DCs and macrophages are the main antigen-presenting cells in the body, maintaining the key second link in the anti-tumor immune cycle by recognizing and processing tumor antigens or pathogens and presenting them to T cells, activating CD8 + T cells, thereby achieving anti-tumor and anti-infection immune responses. Mature DCs are critical in generating a certain intensity of anti-tumor immune responses. Compared with immature DCs, their cell surface expresses some membrane receptors such as Fc receptors that can mediate DC uptake of antigens. Therefore, mature DCs have stronger antigen uptake, processing and handling capabilities, and mature DCs express high levels of MHC (major histocompatibility complex)-II class molecules, co-stimulatory molecules, and adhesion molecules, and have strong antigen presentation capabilities. GM-CSF promotes the differentiation and maturation of DCs through the STAT (signal transducer and activator of transcription) 5 and nuclear transcription factor (nuclear factor, NF)-кB pathways, upregulates the expression of co-stimulatory molecules such as MHC II and CD80 / CD86, and activates mononuclear dendritic cells. Low-dose GM-CSF preferentially promotes granulocyte proliferation, and the higher the dose, the stronger the effect of promoting mononuclear dendritic cells. Studies have shown that GM-CSF can increase tumor T cell infiltration by restoring the function of DCs in the "cold tumor" microenvironment, turning it into a "hot tumor."
[0006] Although intralesional injection of GM-CSF can increase and activate the number of DC cells in the tumor microenvironment, its clinical application is limited. Despite the challenges encountered in the process of delivering GM-CSF intratumorally, oncolytic viruses encoding GM-CSF can significantly inhibit their growth when injected into tumors. Studies have shown that replication-deficient herpes simplex virus (HSV) expressing GM-CSF inhibits tumor growth in the Harding-Passey melanoma mouse model and improves the survival rate of tumor-bearing mice. Herpes simplex viruses constructed with deletions of ICP34.5 and ICP47 and insertion of GM-CSF have shown antitumor effects both in vivo and in vitro.
[0007] ORFV has unique biological characteristics and is an extremely attractive oncolytic virus vector. Genes replicate and transcribe in the cytoplasm rather than integrate into the host genome, so ORFV is considered relatively safe to develop into an oncolytic virus. Secondly, ORFV has a narrow host range of infection, and its damage is mainly limited to the skin that can recover quickly. The virus has low toxicity and there are almost no cases of systemic transmission. Thirdly, an attenuated virus strain can be constructed by knocking out virulence genes. As a viral vaccine vector, it has great gene compatibility and can replicate and express foreign genes. Therefore, ORFV is an ideal oncolytic virus vector. Summary of the Invention
[0008] The present invention provides an orf virus (ORFV virus, namely the recombinant orf virus described in the present invention) expressing GM-CSF, and its application in the preparation of anti-tumor drugs. The technical idea of the present invention is that while ORFV acts on tumor cells, GM-CSF acts on immune cells, thereby inhibiting tumor growth and having great potential in the treatment of cancer.
[0009] The present invention provides an attenuated strain of oncolytic virus prepared by precisely modifying a novel oncolytic virus. The oncolytic virus is orf virus (ORFV), specifically selected from Orf virus strain SY17 (ORFV SY17 strain, GenBank: MG712417.1). The present invention performs site-directed gene deletion on the ORFs005-008 genes of the ORFV virus to obtain an attenuated strain. Compared with the wild-type ORFV, it has higher safety and can be used as a carrier for substances such as antigens and cytokines. After binding with antigens, cytokines, etc., it can be used as a vaccine or a drug.
[0010] The present invention provides a novel recombinant orf virus, and the recombinant orf virus expresses granulocyte-macrophage colony-stimulating factor GM-CSF.
[0011] Preferably, the ORFs005-008 genes of the wild-type orf virus are deleted, and the GM-CSF gene is inserted into the deletion of the ORFs005-008 genes to obtain a recombinant orf virus ORFVΔ-GM-CSF expressing GM-CSF.
[0012] Preferably, any of the above-mentioned recombinant orf viruses is a strain with a deletion of the ORFs005-008 genes, and the deleted fragment is a nucleotide fragment as shown in SEQ ID NO: 1.
[0013] Preferably, any one of the above, the GM-CSF protein expressed by the recombinant orf virus is one of murine, human, feline or canine origin.
[0014] Preferably, any one of the above, the GM-CSF expressed by the recombinant orf virus is mGM-CSF, and the amino acid sequence is as shown in SEQ ID NO: 2.
[0015] Preferably, any one of the above, the GM-CSF expressed by the recombinant orf virus is hGM-CSF, and the amino acid sequence is as shown in SEQ ID NO: 3.
[0016] Preferably, any one of the above, the GM-CSF expressed by the recombinant orf virus is fGM-CSF, and the amino acid sequence is as shown in SEQ ID NO: 4.
[0017] Preferably, any one of the above, the GM-CSF expressed by the recombinant orf virus is cGM-CSF, and the amino acid sequence is as shown in SEQ ID NO: 5.
[0018] Preferably, any one of the above, the recombinant orf virus is the ORFV SY17 strain.
[0019] The present invention also provides a method for preparing the recombinant orf virus according to any one of the above, deleting the ORFs005-008 genes of the wild-type orf virus, and inserting the GM-CSF gene at the position where the ORFs005-008 genes are deleted to obtain the recombinant orf virus, which is also called ORFVΔ-GM-CSF in the present invention.
[0020] Preferably, the construction method of the recombinant orf virus ORFVΔ-GM-CSF is as follows:
[0021] Delete the ORFs005-008 genes of the wild-type orf virus and insert the GM-CSF gene. The orf virus based on the GenBank:MG712417.1 genomic sequence is used as the maternal genome. Preferably, the GM-CSF is one of murine, human, feline or canine origin, and the genomic sequence of mGM-CSF (murine) is X03019.1. The genomic sequence of hGM-CSF (human) is NM_000758.4. The genomic sequence of fGM-CSF (feline) is AF053007.1. The genomic sequence of cGM-CSF (canine) is S49738.1.
[0022] Preferably, the gene sequence expressing mGM-CSF is:
[0023] 1) The nucleotide sequence shown in SEQ ID NO: 6;
[0024] 2) A nucleotide sequence that is codon-degenerate with the nucleotide sequence shown in SEQ ID NO: 6 and expresses the amino acid sequence shown in SEQ ID NO: 2. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 10.
[0025] Preferably, the gene sequence expressing hGM-CSF is:
[0026] 3) The nucleotide sequence shown in SEQ ID NO: 7;
[0027] 4) A nucleotide sequence that is codon-degenerate with the nucleotide sequence shown in SEQ ID NO: 7 and expresses the amino acid sequence shown in SEQ ID NO: 3. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 11.
[0028] Preferably, the gene sequence expressing fGM-CSF is:
[0029] 5) The nucleotide sequence shown in SEQ ID NO: 8;
[0030] 6) A nucleotide sequence that is codon-degenerate with the nucleotide sequence shown in SEQ ID NO: 8 and expresses the amino acid sequence shown in SEQ ID NO: 4. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 12.
[0031] Preferably, the gene sequence expressing cGM-CSF is:
[0032] 7) The nucleotide sequence shown in SEQ ID NO: 9;
[0033] 8) A nucleotide sequence that is codon-degenerate with the nucleotide sequence shown in SEQ ID NO: 9 and expresses the amino acid sequence shown in SEQ ID NO: 5. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 13.
[0034] The ORFV virus expressing GM-CSF prepared by the present invention (i.e., the recombinant orf virus, ORFVΔ-GM-CSF) includes at least one of recombinant ORFVΔ-mGM-CSF (murine), ORFVΔ-hGM-CSF (human), ORFVΔ-fGM-CSF (feline), or ORFVΔ-cGM-CSF (canine). Further preferably, the foreign gene inserted into the recombinant orf virus is GM-CSF-P2A-eGFP, that is, the inserted foreign gene consists of the gene sequences of mGM-CSF, hGM-CSF, fGM-CSF, or cGM-CSF described in any one of the above, the P2A sequence, and the eGFP gene sequence.
[0035] Preferably, in any one of the above, the P2A sequence is the nucleotide sequence shown in SEQ ID NO: 24.
[0036] Preferably, in any one of the above, the eGFP gene sequence is as shown in SEQ ID NO: 34.
[0037] Preferably, in any one of the above, the inserted foreign gene GM-CSF-P2A-eGFP further includes the vv7.5 promoter sequence shown in SEQ ID NO: 35.
[0038] Further, the inserted foreign gene is preferably the nucleotide sequence of mGM-CSF-P2A-eGFP shown in SEQ ID NO: 20, or the nucleotide sequence of hGM-CSF-P2A-eGFP shown in SEQ ID NO: 21, or the nucleotide sequence of fGM-CSF-P2A-eGFP shown in SEQ ID NO: 22, or the nucleotide sequence of cGM-CSF-P2A-eGFP shown in SEQ ID NO: 23.
[0039] The present invention also provides the application of the recombinant orf virus described in any one of the above in the preparation of anti-tumor drugs.
[0040] The prominent features of the present invention are:
[0041] (1) ORFV infection can rapidly mediate humoral immunity and adaptive immune responses, but almost no neutralizing antibodies are produced after ORFV stimulation;
[0042] (2) Compared with the virus particles of ORFV and ORFVΔ, the virus particles of ORFVΔ-mGM-CSF have no morphological changes and are structurally intact;
[0043] (3) ORFVΔ-mGM-CSF can induce pyroptosis of tumor cells;
[0044] (4) After ORFVΔ-mGM-CSF infects B16 tumor cells, mGM-CSF is expressed in the tumor cells.
[0045] The beneficial effects of the present invention are as follows:
[0046] The present invention uses the oncolytic virus ORFV as a vector to develop the tumor immunotherapy drug ORFVΔ-GM-CSF expressing GM-CSF. Preferably, it includes at least one of ORFVΔ-mGM-CSF, ORFVΔ-hGM-CSF, ORFVΔ-fGM-CSF, and ORFVΔ-cGM-CSF. After the obtained ORFVΔ-GM-CSF of the present invention infects tumor cells, GM-CSF is expressed inside the tumor cells and does not induce the body to produce neutralizing antibodies. Since the body does not produce neutralizing antibodies against ORFVΔ-GM-CSF, ORFVΔ-GM-CSF can be injected multiple times without reducing the single anti-tumor effect. The ORFVΔ-GM-CSF oncolytic virus of the present invention aims to deliver GM-CSF into the tumor using the infection characteristics of the virus, and while lysing tumor cells, it promotes the chemotaxis of dendritic cells and M1 macrophages to the tumor microenvironment, enhancing the anti-tumor effect of the oncolytic virus. The present invention provides a new strategy for tumor treatment. Description of the Drawings
[0047] Figure 1 The recombinant plasmid pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs005-008 constructed for Preferred Embodiment 1 of the present invention.
[0048] Figure 2 Fluorescence detection (scale: 100 μm) of the recombinant virus obtained after homologous recombination of the recombinant plasmid pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs005-008 and the SY-ORFV wild-type virus in Preferred Embodiment 1 of the present invention.
[0049] Figure 3 Agarose gel verification of the genomic PCR amplification product of the recombinant orf virus ORFVΔ-mGM-CSF in Preferred Embodiment 1 of the present invention.
[0050] Figure 4 Results of the treatment of murine mammary tumors (subcutaneous) with the recombinant orf virus ORFVΔ-mGM-CSF described in Preferred Embodiment 2 of the present invention.
[0051] Figure 5This is the plasmid map of pUC57-LFΔORFs 005-008-hGM-CSF-eGFP-RFΔORFs005-008 in the preferred embodiment 4 of the present invention.
[0052] Figure 6 After treatment with the recombinant orf virus of contagious ecthyma of sheep ORFVΔ-hGM-CSF in the preferred embodiment 4 of the present invention, the release of LDH in 786-O cells (human renal cell adenocarcinoma cells) and B16 (mouse melanoma cells) was measured.
[0053] Figure 7 After treatment with the recombinant orf virus of contagious ecthyma of sheep ORFVΔ-hGM-CSF in the preferred embodiment 4 of the present invention, the survival of 786-O cells and B16 cells was detected by CCK-8 method.
[0054] Figure 8 This is the plasmid map of pUC57-LFΔORFs 005-008-fGM-CSF-eGFP-RFΔORFs005-008 (cat-derived) in the preferred embodiment 6 of the present invention.
[0055] Figure 9 This is the restriction enzyme digestion identification result of the recombinant plasmid pUC57-LFΔORFs005-008-fGM-CSF-eGFP-RFΔORFs 005-008 in the preferred embodiment 6 of the present invention.
[0056] Figure 10 After treatment with the recombinant orf virus of contagious ecthyma of sheep ORFVΔ-fGM-CSF in the preferred embodiment 6 of the present invention, the release of LDH in B16 (mouse melanoma cells) was measured.
[0057] Figure 11 After treatment with the recombinant orf virus of contagious ecthyma of sheep ORFVΔ-fGM-CSF in the preferred embodiment 6 of the present invention, the survival of B16 cells was detected by CCK-8 method.
[0058] Figure 12 This is the plasmid map of pUC57-LFΔORFs 005-008-cGM-CSF-eGFP-RFΔORFs005-008 (dog-derived) in the preferred embodiment 8 of the present invention.
[0059] Figure 13 This is the restriction enzyme digestion identification result of the recombinant plasmid pUC57-LFΔORFs005-008-cGM-CSF-eGFP-RFΔORFs 005-008 in the preferred embodiment 8 of the present invention.
[0060] Figure 14After treatment with the recombinant orf virus ORFVΔ-cGM-CSF in the preferred embodiment 8 of the present invention, the release of LDH in the supernatant of B16 was measured.
[0061] Figure 15 After treatment with the recombinant orf virus ORFVΔ-cGM-CSF in the preferred embodiment 8 of the present invention, the survival of B16 cells was detected by CCK-8 method.
[0062] Figure 16 Observation results of virus particles of ORFV, ORFVΔ and recombinant orf virus ORFVΔ-mGM-CSF in the preferred embodiment 11 of the present invention by cryo-electron microscopy (scale bar: 50 nm).
[0063] Figure 17 Results of the induction of pyroptosis in tumor cells by the recombinant orf virus ORFVΔ-mGM-CSF in the preferred embodiment 12 of the present invention (scale bar: 50 μm).
[0064] Figure 18 After the recombinant orf virus ORFVΔ-mGM-CSF in the preferred embodiment 13 of the present invention infects tumor cells, it can express GMCSF in tumor cells.
[0065] Figure 19 The recombinant orf virus ORFVΔ-mGM-CSF in the preferred embodiment 14 of the present invention does not induce the production of neutralizing antibodies (scale bar: 50 μm).
[0066] Figure 20 Results of the enrichment of dendritic cells and M1 macrophages in the tumor microenvironment by ORFVΔ-mGM-CSF in the preferred embodiment 15 of the present invention. Detailed implementation mode
[0067] The present invention will be further described in detail below with reference to the drawings and specific implementation modes.
[0068] Example 1
[0069] Construct the ORFVΔ-mGM-CSF recombinant oncolytic virus carrying the murine granulocyte colony-stimulating factor GM-CSF gene.
[0070] The recombinant plasmid pUC57-LFΔORFs005-008-mGM-CSF-eGFP-RFΔORFs 005-008 with homologous arms of ORFs005-008 genes and eGFP was constructed by homologous recombination technology. The left and right homologous arm sequences were determined according to the upstream and downstream parts of the published ORFs005-008 genes of orf virus in NCBI. The left and right homologous arm sequences were input into Premier 5.0 software. Primers were designed according to the selected homologous arm sequences, restriction enzyme sites were added, and nucleotide sequences with about 20bp repeats on both sides of the vector were added. They were synthesized by Sangon Biotech Co., Ltd. The upstream and downstream primers of ORFV-SY ORFs005-008 are shown in Table 1.1: Primers for left and right homologous arm sequences. Among them, the nucleotide sequence of LFΔF is shown in SEQ ID NO: 14, the nucleotide sequence of LFΔR is shown in SEQ ID NO: 15, the nucleotide sequence of RFΔF is shown in SEQ ID NO: 16, and the nucleotide sequence of RFΔR is shown in SEQ ID NO: 17.
[0071] Table 1.1: Primers for left and right homologous arm sequences.
[0072] Name Restriction site Sequence LFΔF EcoRΙ aaacgacggccagtgaattcAAAGCACCC CATCCACTGT TA LFΔR BglП tatagtatatagatagatctGG TAAAATATAACTATTTTTAT RFΔF BamH I aactcgaggatatcggatccCG CCTGCCTCCAGCAT RFΔR HindШ accatgattacgccaagcttCTTTTTGTAAAAGTTTTTT A
[0073] Note: Δ represents deletion; LF represents left homologous arm; RF represents right homologous arm; italics represent restriction enzyme sites.
[0074] (1) Extraction of viral genomic DNA.
[0075] According to the instruction manual of the innuPREP Virus DNAKit kit, the genomic DNA of the orf virus SY17 strain was extracted for use as a template for PCR amplification. The specific operation is as follows:
[0076] (a) Prepare Carrier Mix (add 1.25 mL ddH2O); Wash Solution HS (add 15 mL absolute ethanol), Wash Solution LS (add 64 mL absolute ethanol), Proteinase K (add 1.5 mL ddH2O); Pre-mix 1.2 mL Lysis solution CBV / 60 μL Carrier Mix in advance; Preheat RNase-free Water in a 70 °C water bath. (b) Sample preparation: 200 μL per well, a total of 5 tubes; Add 200 μL of the Lysis solution CBV / Carrier Mix mixture to each tube and add 20 μL of Proteinase K, incubate at 70 °C for 10 min; (c) Add 400 μL of Binding Solution SBS to each tube and shake vigorously; (d) Transfer the sample to the SpinFilter for filtration, centrifuge at 10,000 g for 1 min, discard the filtrate; (e) Add the pre-prepared Wash Solution HS, centrifuge at 10,000 g for 1 min, discard the filtrate; (f) Add the pre-prepared Wash Solution LS, centrifuge at 10,000 g for 1 min, discard the filtrate; Repeat once. (g) Centrifuge at 10,000 g for 5 min to evaporate the absolute ethanol; (h) Add 40 μL of pre-warmed RNase-free Water in a water bath to each tube and store at -40 °C for later use;
[0077] (2) Construction of gene deletion plasmid.
[0078] ① Amplification of left and right homologous arms.
[0079] Use the PCR method to amplify the left and right homologous arm sequences. Reaction system: 1 μL of template; 1 μL each of the upstream and downstream primers of ORFV ORFs005-008; ddH2O: 9.5 μL; PrimeSTAR Max: 12.5 μL. Reaction conditions: Pre-denaturation at 98 °C for 2 min; Denaturation at 98 °C for 15 s; Annealing at 55 - 63 °C for 15 s; Extension at 72 °C for 30 s; 35 cycles. Perform agarose gel electrophoresis on the PCR amplification products of the left and right homologous arms respectively, cut the target bands in the Gel Image System gel imaging instrument, and perform gel extraction according to the instructions of the gel extraction kit. The sequencing is successful.
[0080] The upstream and downstream primers of the left arm and the right arm are LFΔF (shown in SEQ ID NO: 14) / LFΔR (shown in SEQ ID NO: 15) or RFΔF (shown in SEQ ID NO: 16) / RFΔR (shown in SEQ ID NO: 17) respectively.
[0081] ② Plasmid digestion.
[0082] The pUC57-vvp7.5-eGFP recombinant plasmid was digested with BamH I and HindШ restriction endonucleases. The digestion system was as follows: 0.5 μL of BamH I and HindШ restriction endonucleases were respectively added, 2 μL of 10×Quick Cut Buffer, 17 μL of pUC57-vvp7.5-eGFP plasmid, and incubated in a 37°C water bath for 2 h. The plasmid pUC57-vv7.5-eGFP used in the present invention is a plasmid that has been publicly disclosed in the prior art (Zhou Yanlong, Guan Jiyu, Gao Feng, Li Zi, Lan Yungang, Lu Huijun, Song Deguang, Lv Lijun, Lv Pin, Xu Mengshi, Wang Zhenzhen, He Hongbin, Zhao Kui, He Wenqi. Orf virus ORF120 protein positively regulates the NF-κB pathway by interacting with G3BP1. [J]. Journal of virology, 2021.), and the public can obtain it by sharing with the author.
[0083] ③ Ligation.
[0084] The gel-extracted right homologous arm was cloned into the digested pUC57-vvp7.5-eGFP screening recombinant plasmid according to the instructions using the pEASY-Basic Seamless Cloning and Assembly Kit to construct the pUC57-eGFP-RFΔORFs 005-008 plasmid. Transformation and shaking culture were carried out. The DH5α competent cells were thawed on ice for transformation. The DH5α competent cells-ligation product was transferred to 1 mL of sterile LB liquid medium, incubated in a 37°C shaker for 1 h, then 200 μL of the bacterial solution was taken and added to an LB solid plate containing Amp resistance, and inverted at 37°C for 14 h. Single colonies were selected and cultured in an LB medium containing Amp resistance at 37°C and 160 r / min on a shaker for 12 h.
[0085] ④ Identification.
[0086] The bacterial solution was handed over to Sangon Biotech for sequencing verification to ensure its accuracy. After that, the bacteria were cultured on a larger scale, and plasmids were extracted using the Endo-free Plasmid Mini Kit П. Meanwhile, enzyme digestion was used for identification to confirm that the right homologous arm was ligated to the plasmid, and it was stored at -40 °C in the refrigerator for future use. For the enzyme digestion, ligation, transformation, and identification of the left homologous arm, the constructed pUC57-eGFP-RFΔORFs 005-008 was further digested with EcoRΙ and BglП restriction endonucleases and ligated with the left homologous arm of LFΔORFs 005-008. After transformation, culturing, and identification, the pUC57-LFΔORFs 005-008-eGFP-RFΔORFs005-008 gene deletion plasmid carrying green fluorescent protein was successfully constructed.
[0087] (3) Construction of recombinant plasmid.
[0088] ① Plasmid digestion.
[0089] The successfully constructed pUC57-LFΔORFs 005-008-eGFP-RFΔORFs 005-008 gene deletion plasmid carrying green fluorescent protein was digested with Xba I restriction endonuclease. The digestion system was as follows: 1 μL of Xba I restriction endonuclease was added, 2 μL of 10×Quick Cut Buffer, 17 μL of pUC57-LFΔORFs 005-008-eGFP-RFΔORFs 005-008 plasmid, and incubated in a 37 °C water bath for 2 h.
[0090] ② Ligation.
[0091] The mGM-CSF that had been recovered by gel extraction was cloned into the digested pUC57-LFΔORFs 005-008-eGFP-RFΔORFs005-008 to screen for recombinant plasmids using the pEASY-Basic Seamless Cloning and Assembly Kit according to the instructions, and the pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs 005-008 plasmid was constructed. For transformation and culturing, the DH5α competent cells were thawed on ice for transformation. The DH5α competent cells - ligation product was transferred to 1 mL of sterile LB liquid medium. After culturing on a shaker at 37 °C for 1 h, 200 μL of the bacterial solution was taken and added to an LB solid plate containing Amp resistance, and it was incubated upside down at 37 °C for 14 h. Single colonies were selected and cultured in an LB medium containing Amp resistance on a shaker at 37 °C at 160 r / min for 12 h. The nucleotide sequence of the mGM-CSF is shown in SEQ ID NO: 6.
[0092] ③ Identification.
[0093] The bacterial solution was sent to Sangon Biotech for sequencing verification. After ensuring it was correct, the bacteria were cultured on a larger scale. The plasmid was extracted using the Endo-free Plasmid Mini Kit П, and at the same time, it was identified by enzyme digestion, transformed, cultured, and identified. The recombinant plasmid pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs 005-008 carrying mGM-CSF was successfully constructed.
[0094] Figure 1 The recombinant plasmid pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs 005-008 was constructed. As shown in the figure, the self-cleaving 2A peptide (P2A) was inserted between the site where mGM-CSF was inserted and eGFP. The nucleotide sequence of mGM-CSF-P2A-eGFP (that is, mGM-CSF-eGFP in the recombinant plasmid pUC57-LFΔORFs 005-008-mGM-CSF-eGFP-RFΔORFs 005-008 of the present invention) is shown in SEQ ID NO: 20.
[0095] The nucleotide sequence of P2A is shown in SEQ ID NO: 24. Using the fusion PCR method, the P2A sequence was added to the N-terminus of the target gene sequence, and then primers with homologous arms were designed according to the principle of homologous recombination primer design. System: template (murine cell cDNA) 1 μL; upstream and downstream primers mF, mR1: 1 μL each; ddH2O: 9.5 μL; Prime STAR Max: 12.5 μL. Conditions: pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 15 s; annealing at 55 - 63 °C for 15 s; extension at 72 °C for 30 s; 35 cycles. The amplification products were subjected to agarose gel electrophoresis respectively, and the target bands were cut out in the Gel Image System gel imaging instrument, and gel recovery was carried out with reference to the instructions of the gel recovery kit. Using the recovered product as a template for PCR, system: template (mF, mR1 recovered product) 1 μL; upstream and downstream primers mF, R2: 1 μL each; ddH2O: 9.5 μL; Prime STAR Max: 12.5 μL. Conditions: pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 15 s; annealing at 55 - 63 °C for 15 s; extension at 72 °C for 30 s; 35 cycles. The amplification products were subjected to agarose gel electrophoresis respectively, and the target bands were cut out in the Gel Image System gel imaging instrument, and gel recovery was carried out with reference to the instructions of the gel recovery kit, and then ligated to pUC57-LFΔORFs
[0096] On the 005-008-eGFP-RFΔORFs vector. The nucleotide sequences of the primers are as follows: mF is the nucleotide sequence shown in SEQ ID NO: 25, mR1 is the nucleotide sequence shown in SEQ ID NO: 26, and R2 is the nucleotide sequence shown in SEQ ID NO: 27. For the recombinant orf virus of sheep contagious ecthyma constructed in the present invention, after deleting the ORFs005-008 genes of ORFV, the VV7.5 promoter and the eGFP green fluorescent reporter gene are introduced into the genome, and the target gene IL15 and the self-cleaving 2A peptide (P2A) are inserted between the VV7.5 promoter and the eGFP green fluorescent reporter gene, so that the target genes GM-CSF and eGFP are expressed separately.
[0097] ④ Transfection, screening and purification.
[0098] Referring to the instruction manual of Lipofiter 3.0 transfection reagent, 5 μg of pUC57-LFΔORFs005-008-mGM-CSF-eGFP-RFΔORFs 005-008 recombinant plasmid was made into a premix with 250 μL of double-antibiotic-free DMEM medium, and 10 μL of Lipofiter 3.0 transfection reagent was diluted with 250 μL of double-antibiotic-free DMEM medium. After incubating at room temperature for 15 min, 500 μL of plasmid-liposome complex was added to each well of OFTu cells that had grown to about 80% confluence for transfection. After 6 h, the wild-type strain of orf virus of sheep contagious ecthyma (ORFV-SY17) was inoculated into the above-mentioned transfected OFTu cells at an MOI of 0.1. After 2 h, DMEM culture medium containing 2% fetal bovine serum was added, and the cells were cultured in an incubator at 37 °C and 5% CO2.
[0099] After incubating the cells in a 37°C, 5% CO2 incubator for an additional 72 h, the infection of the recombinant virus was observed under an inverted fluorescence microscope. For cells that became round and had green fluorescent regions (suspected to carry the gene recombinant virus with the eGFP fluorescence marker) observed under the fluorescence inverted microscope, they were marked and circled, scraped with a 10 μL pipette tip, and repeatedly frozen and thawed three times for use in the next screening step. The virus solution from the scraped cells with cytopathic effects and green fluorescence markers was collected and repeatedly frozen and thawed 3 times. After centrifugation at 4°C, 1000 r / min for 10 min, it was inoculated into a 96-well plate pre-laid with OFTu cells using the limited dilution method for screening. Observed under the fluorescence inverted microscope, the diseased cells with fluorescence were scraped and repeatedly frozen and thawed three times, and screened 6 - 8 rounds using the limited dilution method; The fluorescent virus after limited dilution was inoculated into a 12-well plate. During this period, 1% - 1.5% low melting point agarose was prepared and sterilized in a vertical autoclave. The 2×DMEM culture medium nutrient solution containing 2% fetal bovine serum and 2% penicillin / streptomycin was preheated in a 37°C, 5% CO2 incubator and diluted with 1% - 1.5% low melting point agarose for plaque screening. After screening 2 - 3 times, the ORFVΔ-mGM-CSF recombinant strain was obtained.
[0100] Figure 2 As shown in this example, pUC57-LFΔORFs with ORFV-ORFs005-008 homologous arms
[0101] After transfection of the 005-008-eGFP-RFΔORFs 005-008 recombinant plasmid into OFTU cells for 6 h, SY-ORFV wild-type virus was added. After incubation for 2 h, the microscopic examination image under the fluorescence microscope at 72 h: Green fluorescent protein expression was visible under the excitation light, indicating successful transfection of the recombinant plasmid and homologous recombination with the SY-ORFV wild-type virus; Cells that were both cytopathic and expressed green fluorescent protein were collected to collect the virus, repeatedly frozen and thawed, and the virus was passaged by infecting OFTU cells. Fluorescent virus plaques were picked under the fluorescence microscope. The microscopic examination images showed that with successive rounds of plaque picking, the purity of the virus continuously increased. Finally, after multiple rounds of picking, all virus-infected cells carried fluorescence.
[0102] ⑤ Identification.
[0103] The genomic DNA of the ORFV-SY wild strain and the ORFVΔ-mGM-CSF recombinant strain was extracted using the innuPREP Virus DNA Kit. Identification primers synthesized and identified by Sangon Biotech Co., Ltd. were used, and the sequences are shown in Table 1.2 (JD-Fw: SEQ ID NO: 18, JD-Rv: SEQ ID NO: 19). The PCR reaction system was as follows: 1 μL of genomic DNA template, 12.5 μL of PrimeSTAR Max Premix (2×), 1 μL of JD-Fw primer, 1 μL of JD-Rv primer, and 9.5 μL of ddH2O, for a total of 25 μL; the PCR reaction conditions were: 98°C for 15 s, 55 - 62°C for 20 s, 72°C for 35 s, with 34 cycles starting from the second step of extension. The PCR amplification products were taken, subjected to gel electrophoresis on 1% agarose, observed and photographed using a Gel Image System gel imaging instrument, gel recovered, and sent to Sangon Biotech Co., Ltd. for sequencing, and no gene mutations were found.
[0104] As Figure 3 shown, it is the agarose gel verification of the PCR amplification products of the recombinant oncolytic virus ORFVΔ-mGM-CSF genome. Lane 1 is the DNA marker, lane 2 is the amplification product of the wild-type ORFV genome, and lanes 3 and 4 are the amplification products of the ORFVΔ-mGM-CSF genome. The PCR amplification products of the ORFVΔ-mGM-CSF genome were sequenced and compared, and the results of segmental comparison on BLAST showed no base mutations, and the target genes GM-CSF and P2A gene were successfully integrated into the ORFVΔ virus genome.
[0105] Table 1.2: Identification primer sequences
[0106] Name Sequence JD-Fw agccaccacattgtctcttgccaccaccgat JD-Rv attcagcccgcagcacctgccagcccgt
[0107] Example 2
[0108] The ORFVΔ-mGM-CSF recombinant oncolytic virus effectively inhibits mouse breast tumors.
[0109] In this example, taking the ORFVΔ-mGM-CSF oncolytic virus as an example, research was carried out in a mouse breast tumor model. 5×10 5 EMT6 cells (mouse breast cancer cells) were subcutaneously implanted on the left side of 6 - 8-week-old BALB / c female mice. Once the tumors were visible, the length (L) and width (W) of each tumor were measured daily using calipers, and the tumor volume was calculated using the following formula (L×W 2 ) / 2. Taking ORFVΔ as the control group, the ORFVΔ-mGM-CSF recombinant oncolytic virus was directly injected into the mouse breast tumors, and the injection volume was 10 6 TCID 50 / mouse. A total of 3 treatments were given, that is, injections were performed once every two days for a total of 3 times, and 10 injections were given each time. 6 TCID 50 / mouse. The results showed that the growth of tumors in mice was inhibited to varying degrees. Compared with the ORFVΔ group, the oncolytic virus ORFVΔ-mGM-CSF had a more significant inhibitory effect on tumor growth. After dissecting the treated mice, macroscopic observation showed that the color and texture of each organ of the mice after treatment with the recombinant oncolytic virus were no different from those of normal mice, indicating the basic safety of the ORFVΔ-mGM-CSF recombinant oncolytic virus during tumor treatment. Similarly, the tumor tissue after the last treatment was dissected and photographed. The results showed that after 3 treatments with ORFVΔ-mGM-CSF, there was also a significant difference in the size of the tumors in mice compared with the control group. Figure 4 As shown in the figure, Ctrl in the figure is the untreated control group on the right side of the mouse, ORFVΔ is the treatment control group with the attenuated strain of orf virus ΔORFs005-008, and ORFVΔ-mGM-CSF is the treatment group with the recombinant orf virus.
[0110] Example 3
[0111] The recombinant orf virus ORFVΔ-mGM-CSF was prepared in the same manner as in Example 1, except that the gene sequence of mGM-CSF was as shown in SEQ ID NO: 10. The effect of ORFVΔ-mGM-CSF prepared with SEQ ID NO: 10 was verified according to the method of Example 2. The results showed that the recombinant orf virus ORFVΔ-mGM-CSF obtained in Example 3 could significantly inhibit the growth of tumors in the mouse model, and its inhibitory effect was significantly different from that of the ORFVΔ treatment control group. The inhibitory effect of the recombinant orf virus ORFVΔ-mGM-CSF on tumor growth was more significant.
[0112] Example 4
[0113] 1) Construction and in vitro verification of the ORFVΔ-hGM-CSF recombinant oncolytic virus.
[0114] Using a preparation method similar to that in Example 1, the recombinant orf virus ORFVΔ-hGM-CSF was prepared, except that GM-CSF was hGM-CSF, and the gene sequence of hGM-CSF was as shown in SEQ ID NO: 7. Figure 5The prepared recombinant plasmid pUC57-LFΔORFs 005-008-hGM-CSF-eGFP-RFΔORFs 005-008 has a self-cleaving 2A peptide (P2A) inserted between the site where hGM-CSF is inserted and eGFP. The nucleotide sequence of hGM-CSF-P2A-eGFP (i.e., the hGM-CSF-eGFP sequence in the recombinant plasmid pUC57-LFΔORFs 005-008-hGM-CSF-eGFP-RFΔORFs 005-008 of the present invention) is shown in SEQ ID NO: 21.
[0115] The method for constructing the recombinant plasmid containing P2A is similar to that in Example 1, except that the nucleotide sequences of the primers are as follows: hF is the nucleotide sequence shown in SEQ ID NO: 28, hR1 is the nucleotide sequence shown in SEQ ID NO: 29, and R2 is the nucleotide sequence shown in SEQ ID NO: 27.
[0116] 2) LDH detection
[0117] In this example, the ORFVΔ of the contagious ecthyma virus of sheep and the recombinant contagious ecthyma virus of sheep ORFVΔ-hGM-CSF were respectively used to infect 786-O cells (human renal clear cell carcinoma cells) and B16 cells (mouse B16 melanoma cells) (MOI = 1). After 12 h, the cells were centrifuged at 400 × g for 5 min, and the supernatant was taken for testing. The lactate dehydrogenase cytotoxicity detection kit (C0016) of Beyotime Biotechnology Co., Ltd. was used to detect the LDH released in the supernatant of each group of cells; the results are as Figure 6 shown. The release amounts of LDH in the ORFVΔ-hGM-CSF and ORFVΔ treatment groups were both significantly different from those in the untreated group, indicating that after the deletion or addition of foreign genes, the deleted virus or recombinant virus can also infect tumor cells, causing their membrane rupture and releasing LDH.
[0118] 3) CCK-8 detection of cell viability
[0119] In this example, the ORFVΔ of the contagious ecthyma virus of sheep and the recombinant contagious ecthyma virus of sheep ORFVΔ-hGM-CSF were respectively used to infect 786-O cells and B16 cells (MOI = 1). After 72 h, the Cell Counting Kit-8 (CCK-8 kit) (C0037) of Beyotime Biotechnology Co., Ltd. was used to detect the viability of each group of cells; the results are as Figure 7 shown. Both the ORFVΔ-hGM-CSF and ORFVΔ treatment groups could significantly inhibit the viability of tumor cells.
[0120] Example 5
[0121] Example 5 was similar to Example 4, except that the hGM-CSF gene of the recombinant orf virus ORFVΔ-hGM-CSF was the nucleotide sequence shown in SEQ ID NO: 11. The results showed that for the recombinant orf virus ORFVΔ-hGM-CSF obtained in Example 5, the release amounts of LDH in the ORFVΔ-hGM-CSF and ORFVΔ treatment groups were both significantly different from those in the untreated group, indicating that after deletion or addition of foreign genes, the deleted virus or recombinant virus could also infect tumor cells, causing their membrane rupture and releasing LDH.
[0122] Example 6
[0123] 1) Construction and in vitro verification of the recombinant oncolytic virus ORFVΔ-fGM-CSF.
[0124] Using a preparation method similar to that in Example 1, the recombinant orf virus ORFVΔ-fGM-CSF was prepared, except that GM-CSF was fGM-CSF, and the gene sequence of fGM-CSF was as shown in SEQ ID NO: 8. Figure 8 The obtained pUC57-LFΔORFs 005-008-fGM-CSF-eGFP-RFΔORFs 005-008 recombinant plasmid had a self-cleaving 2A peptide (P2A) inserted between the site where fGM-CSF was inserted and eGFP. The nucleotide sequence of fGM-CSF-P2A-eGFP (i.e., the fGM-CSF-eGFP sequence in the pUC57-LFΔORFs 005-008-fGM-CSF-eGFP-RFΔORFs 005-008 recombinant plasmid of the present invention) was as shown in SEQ ID NO: 22.
[0125] The method for constructing the recombinant plasmid containing P2A was similar to that in Example 1, except that the nucleotide sequences of the primers were: fF was the nucleotide sequence shown in SEQ ID NO: 30, fR1 was the nucleotide sequence shown in SEQ ID NO: 31, and R2 was the nucleotide sequence shown in SEQ ID NO: 27.
[0126] Figure 9 For the restriction enzyme digestion identification result of the recombinant plasmid pUC57-LFΔORFs 005-008-fGM-CSF-eGFP-RFΔORFs 005-008, lane 1 was the restriction enzyme digestion result of the recombinant plasmid (the restriction enzyme sites were BgIII and Xhol); lane 2 was the recombinant plasmid pUC57-LFΔORFs 005-008-fGM-CSF-eGFP-RFΔORFs 005-008. The restriction enzyme digestion result was recovered and sent for sequencing, and the sequencing result comparison showed no base mutations.
[0127] 2) LDH detection
[0128] In this example, the B16 cells (mouse B16 melanoma cells) were infected with the ORFVΔ of the orf virus deletion strain and the recombinant orf virus ORFVΔ-fGM-CSF (MOI = 1). After 12 h, the cells were centrifuged at 400×g for 5 min, and the supernatant was taken for testing. The LDH released in the supernatant of each group of cells was detected using the Lactate Dehydrogenase Cytotoxicity Detection Kit (C0016) from Beyotime Biotechnology Co., Ltd. The results are as Figure 10 shown. The recombinant orf virus ORFVΔ-fGM-CSF can infect tumor cells, causing their membrane rupture and releasing LDH.
[0129] 3) CCK-8 assay for cell viability
[0130] In this example, the B16 cells were infected with the ORFVΔ of the orf virus deletion strain and the recombinant orf virus ORFVΔ-fGM-CSF (MOI = 1). After 72 h, the viability of each group of cells was detected using the Cell Counting Kit-8 (CCK-8 kit) (C0037) from Beyotime Biotechnology Co., Ltd. The results are as Figure 11 shown.
[0131] Both the ORFVΔ-fGM-CSF and ORFVΔ treatment groups could significantly inhibit the proliferation of tumor cells.
[0132] Example 7
[0133] Example 7 was similar to Example 6, except that the fGM-CSF gene for constructing the recombinant orf virus ORFVΔ-fGM-CSF was the nucleotide sequence shown in SEQ ID NO: 12. The results showed that for the recombinant orf virus ORFVΔ-fGM-CSF obtained in Example 7, the release amounts of LDH in the ORFVΔ-fGM-CSF and ORFVΔ treatment groups were significantly different from those in the untreated group, indicating that after deletion or addition of foreign genes, the deleted virus or recombinant virus could also infect tumor cells, causing their membrane rupture and releasing LDH.
[0134] Example 8
[0135] 1) Construction and in vitro verification of the ORFVΔ-cGM-CSF recombinant oncolytic virus
[0136] Using a preparation method similar to that in Example 1, the recombinant orf virus ORFVΔ-cGM-CSF was prepared, except that GM-CSF was cGM-CSF, and the gene sequence of cGM-CSF was as shown in SEQ ID NO: 9. Figure 12The prepared recombinant plasmid pUC57-LFΔORFs 005-008-cGM-CSF-eGFP-RFΔORFs 005-008 has a self-cleaving 2A peptide (P2A) inserted between the site where cGM-CSF is inserted and eGFP. The nucleotide sequence of cGM-CSF-P2A-eGFP (i.e., the cGM-CSF-eGFP sequence in the recombinant plasmid pUC57-LFΔORFs 005-008-cGM-CSF-eGFP-RFΔORFs 005-008 of the present invention) is shown in SEQ ID NO: 23.
[0137] The method for constructing the recombinant plasmid containing P2A is similar to that in Example 1, except that the nucleotide sequences of the primers are as follows: cF is the nucleotide sequence shown in SEQ ID NO: 32, cR1 is the nucleotide sequence shown in SEQ ID NO: 33, and R2 is the nucleotide sequence shown in SEQ ID NO: 27.
[0138] Figure 13 For the restriction enzyme digestion identification result of the recombinant plasmid pUC57-LFΔORFs 005-008-cGM-CSF-eGFP-RFΔORFs 005-008, among them, lane 1 is the restriction enzyme digestion result of the recombinant plasmid (the restriction enzyme sites are BgIII and Xhol); lane 2 is the recombinant plasmid, the restriction enzyme digestion result is recovered and sent for sequencing, and the comparison result shows no base mutation.
[0139] 2) LDH detection
[0140] In this example, the ORFVΔ strain of contagious ecthyma virus of sheep and the recombinant contagious ecthyma virus of sheep ORFVΔ-cGM-CSF were used to infect B16 cells (mouse B16 melanoma cells) (MOI = 1). After 12 h, the cells were centrifuged at 400×g for 5 min, and the supernatant was taken for testing. The lactate dehydrogenase cytotoxicity detection kit (C0016) of Beyotime Biotechnology Co., Ltd. was used to detect the LDH released in the supernatant of each group of cells; the results are as Figure 14 shown, indicating that after adding the foreign gene, the recombinant virus can also infect tumor cells, causing their membrane rupture and releasing LDH.
[0141] 3) CCK-8 detection of cell viability
[0142] In this example, the ORFVΔ strain of contagious ecthyma virus of sheep and the recombinant contagious ecthyma virus of sheep ORFVΔ-cGM-CSF were used to infect B16 cells (MOI = 1). After 72 h, the Cell Counting Kit-8 (CCK-8 kit) (C0037) of Beyotime Biotechnology Co., Ltd. was used to detect the viability of each group of cells; the results are as Figure 15 shown.
[0143] Both the ORFVΔ-cGM-CSF and ORFVΔ treatment groups could significantly inhibit the proliferation of tumor cells.
[0144] Example 9
[0145] Example 9 was similar to Example 8, except that the cGM-CSF gene for constructing the recombinant orf virus ORFVΔ-cGM-CSF was the nucleotide sequence shown in SEQ ID NO: 13. The results showed that for the recombinant orf virus ORFVΔ-cGM-CSF obtained in Example 9, the release amounts of LDH in both the ORFVΔ-cGM-CSF and ORFVΔ treatment groups were significantly different from those in the untreated group, indicating that after deletion or addition of foreign genes, the deleted virus or recombinant virus could also infect tumor cells, causing their membrane rupture and releasing LDH.
[0146] Example 10
[0147] Example 10 provided a preparation method for the orf virus ORFs005-008 gene deletion strain of the present invention for the treatment control group, which was abbreviated as the ORFVΔ strain in the present invention.
[0148] (1) The pUC57 / 005-008-eGFP recombinant plasmid with homologous arms of the orf virus ORFs005-008 gene and eGFP was constructed using homologous recombination technology. According to the upstream and downstream parts of the orf virus ORFs005-008 gene published by NCBI, the left and right homologous arm sequences were determined. The left and right homologous arm sequences were input into the Premier 5.0 software, primers were designed according to the selected homologous arm sequences, restriction enzyme sites were added, and at the same time, about 20bp repeated nucleotide sequences that were repeated with both sides of the vector were added. They were synthesized by Sangon Biotech Co., Ltd. The primer sequences of the left and right homologous arms are shown in Table 1.1: the primer sequences of the left and right homologous arms, where LFΔF is shown in SEQ ID NO: 14, LFΔR is shown in SEQ ID NO: 15, RFΔF is shown in SEQ ID NO: 16, and RFΔR is shown in SEQ ID NO: 17.
[0149] (2) Extraction of viral genomic DNA.
[0150] According to the instructions of the innuPREP Virus DNA Kit, extract the genomic DNA of the contagious pustular dermatitis virus SY17 strain as the template for PCR amplification. The specific operations are as follows: (a) Prepare Carrier Mix (add 1.25 mL ddH2O); Wash Solution HS (add 15 mL absolute ethanol), Wash Solution LS (add 64 mL absolute ethanol), Proteinase K (add 1.5 mL ddH2O); Mix 1.2 mL Lysis solution CBV / 60 μL Carrier Mix in advance; Preheat RNase-free Water in a 70 °C water bath. (b) Sample preparation: 200 μL per well, a total of 5 tubes; Add 200 μL of the Lysis solution CBV / Carrier Mix mixture to each tube and add 20 μL of Proteinase K, incubate at 70 °C for 10 min; (c) Add 400 μL of Binding Solution SBS to each tube and shake vigorously; (d) Transfer the sample to the Spin Filter for filtration, centrifuge at 10,000 g for 1 min, and discard the filtrate; (e) Add the pre-prepared Wash Solution HS, centrifuge at 10,000 g for 1 min, and discard the filtrate; (f) Add the pre-prepared Wash Solution LS, centrifuge at 10,000 g for 1 min, and discard the filtrate; Repeat once. (g) Centrifuge at 10,000 g for 5 min to evaporate the absolute ethanol; (h) Add 40 μL of the pre-warmed RNase-free Water in a water bath to each tube and store at -40 °C for standby;
[0151] (3) Construction of the deletion plasmid.
[0152] ① Amplification of the left and right homologous arms.
[0153] Use the PCR method to amplify the left and right homologous arm sequences. System: 1 μL of template; Forward and reverse primers for ORFV-SY ORFs005-008: LFΔF (shown in SEQ ID NO: 14) / LFΔR (shown in SEQ ID NO: 15) or RFΔF (shown in SEQ ID NO: 16) / RFΔR (shown in SEQ ID NO: 17), 1 μL each; ddH2O: 9.5 μL; Prime STAR Max: 12.5 μL. Conditions: Pre-denaturation at 98 °C for 2 min; Denaturation at 98 °C for 15 s; Annealing at 55 - 63 °C for 15 s; Extension at 72 °C for 30 s; 35 cycles. Perform agarose gel electrophoresis on the PCR amplification products of the left and right homologous arms respectively, cut the target bands in the Gel Image System gel imaging instrument, and perform gel extraction according to the instructions of the gel extraction kit. The sequencing is successful.
[0154] ② Plasmid digestion.
[0155] Digest the pUC57-vvp7.5-eGFP recombinant plasmid with BamH I and HindШ restriction endonucleases. The enzyme digestion system is as follows: Add 0.5 μL of BamH I and HindШ restriction endonucleases respectively, 2 μL of 10×Quick Cut Buffer, and 17 μL of pUC57-vvp7.5-eGFP plasmid, and incubate overnight in a 37°C water bath.
[0156] ③ Ligation.
[0157] Clone the gel-extracted right homologous arm into the digested pUC57-vvp7.5-eGFP screening recombinant plasmid according to the instructions using the pEASY-Basic Seamless Cloning and Assembly Kit to construct the pUC57-eGFP-RFΔORFs 005-008 plasmid. Transform and shake the bacteria. Thaw the DH5α competent cells on ice for transformation. Transfer the DH5α competent cells-ligation product to 1 mL of sterile LB liquid medium, incubate in a 37°C shaker for 1 h, then take out 200 μL of the bacterial solution and add it to an LB solid plate containing Amp resistance, and invert it at 37°C for 14 h. Select a single colony and culture it in an LB medium containing Amp resistance, and set the shaker at 37°C and 160 r / min for 12 h.
[0158] ④ Identification.
[0159] Submit the bacterial solution to Sangon Biotech for sequencing verification of the bacterial solution. After ensuring it is correct, expand the shaking of the bacteria, extract the plasmid using the Endo-free Plasmid Mini Kit П, and simultaneously perform enzyme digestion identification to determine that the right homologous arm is ligated to the plasmid, and store it in a -40°C refrigerator for later use. Digest, ligate, transform, and identify the homologous left arm. Further digest the constructed pUC57-eGFP-RFΔORFs 005-008 with EcoRΙ and BglП restriction endonucleases and ligate the LFΔORFs 005-008 homologous left arm, transform, shake the bacteria, and identify to successfully construct the pUC57-LFΔORFs 005-008-eGFP-RFΔORFs005-008 gene deletion plasmid carrying green fluorescent protein.
[0160] (4) Construction of the ORFVΔ deletion strain.
[0161] ① Transfection, screening, and purification.
[0162] The wild-type strain of orf virus (ORFV-SY17) was inoculated into OFTu cells that had grown to approximately 80% confluence at an MOI of 0.1. DMEM medium containing 2% fetal bovine serum was added, and the cells were cultured in an incubator at 37°C and 5% CO2 for 6-8 hours. Referring to the instruction manual of Lipofiter 3.0 transfection reagent, 5 μg of the pUC57-LFΔORFs 005-008-eGFP-RFΔORFs005-008 recombinant plasmid was made into a premix with 250 μL of serum-free DMEM medium. 10 μL of Lipofiter 3.0 transfection reagent was diluted with 250 μL of serum-free DMEM medium. After incubating at room temperature for 15 minutes, 500 μL of the plasmid-liposome complex was added to each well of the inoculated cells.
[0163] After continuing to incubate the cells in an incubator at 37°C and 5% CO2 for 72 hours, the infection of the recombinant virus was observed under an inverted fluorescence microscope. For the cells that became round and had green fluorescent regions (suspected to be genetically recombinant viruses carrying the eGFP fluorescent marker) observed under the fluorescence inverted microscope, they were marked and circled, scraped with a 10 μL pipette tip, and repeatedly frozen and thawed three times for further screening. The virus solution with cell lesions and green fluorescent markers scraped above was repeatedly frozen and thawed 3 times. After centrifugation at 4°C and 1000 r / min for 10 minutes, it was inoculated into a 96-well plate pre-coated with OFTu cells using the limiting dilution method for screening. Observed under the fluorescence inverted microscope, the fluorescent lesion cells were scraped and repeatedly frozen and thawed three times, and screened by the limiting dilution method for 6-8 rounds; the fluorescent virus after limiting dilution was inoculated into a 12-well plate. During this period, 1%-1.5% low melting point agarose was prepared and sterilized in a vertical autoclave. The 2×DMEM culture medium nutrient solution containing 2% fetal bovine serum and 2% penicillin / streptomycin was preheated in an incubator at 37°C and 5% CO2 and diluted with 1%-1.5% low melting point agarose for plaque screening, and screened 2-3 times.
[0164] ② Identification.
[0165] Extract the ORFV-SY wild strain and ORFVΔ genome using the innuPREP Virus DNA Kit. Synthetic identification primers were used, which were synthesized by Sangon Biotech Co., Ltd. The sequences are shown in the following table. The PCR reaction system is as follows: 1 μL of genomic DNA template, 12.5 μL of PrimeSTAR Max Premix (2×), 1 μL of JD-Fw primer, 1 μL of JD-Rv primer, 9.5 μL of ddH2O, for a total of 25 μL; PCR reaction conditions: 98 °C for 15 s, 55 - 62 °C for 20 s, 72 °C for 35 s, with 34 cycles starting from the second step of extension. Take the PCR amplification product, perform gel electrophoresis on 1% agarose, observe and photograph it with a Gel Image System gel imaging instrument, recover the gel and send it to Sangon Biotech Co., Ltd. for sequencing to obtain the correct ORFVΔ gene deletion sequence. The sequences of the identification primers are shown in Table 1.2, where the nucleotide sequence of JD-Fw is as shown in SEQ ID NO: 18, and the nucleotide sequence of JD-Rv is as shown in SEQ ID NO: 19.
[0166] Example 11
[0167] In Example 11, the viral particle morphology of the ORFVΔ-mGM-CSF recombinant oncolytic virus obtained in Example 1 was detected.
[0168] In DMEM medium without FBS, inoculate 80% confluent OFTu cells with ORFV, ORFVΔ, and recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF at 37 °C for 1 h, and then add 2% FBS for further culture. Observe the cytopathic effect (CPE) during the culture. Collect the cells showing CPE and perform three cycles of repeated freeze-thaw cycles. Then purify the released virus at 4 °C and 50,000 × g for 1.5 h by ultracentrifugation (Himac CP100WX Preparative Ultra centrifuge). Apply two microliters of the virus liquid onto a 200-mesh sieve and observe it with a transmission electron microscope (HITACHI). Cryo-electron microscopy showed that the viral particles of ORFV, ORFVΔ, and recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF were oval-shaped and covered with long thread-like tubules similar to yarn balls on the surface, and there were no differences in the morphology and structure of the viral particles compared with the wild strain of ORFV. The results are as Figure 16 shown.
[0169] Example 12
[0170] In Example 12, the ability of the ORFVΔ-mGM-CSF recombinant oncolytic virus obtained in Example 1 to induce pyroptosis of tumor cells was identified.
[0171] Since pyroptosis can activate a strong immune response of the body against tumors and promote the formation of long-term immune memory in the body during tumor treatment, pyroptosis should be regarded as a powerful anti-tumor strategy. Previous studies have found that oncolytic parapoxvirus ORFV induces Gasdermin E-mediated pyroptosis and activates anti-tumor immunity. Therefore, the ability of recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF to induce pyroptosis in tumor cells was examined next. To determine whether the cell death triggered by recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF is pyroptosis, EMT6 tumor cell lines were infected in vitro with recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF (MOI = 1). After 48 h, it was observed that the tumor cells treated with recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF showed cell swelling and bubbles on the cell membrane, indicating that recombinant contagious ecthyma virus of sheep ORFVΔ-mGM-CSF induced pyroptosis in tumor cells. The results are as Figure 17 shown.
[0172] Example 13
[0173] In Example 13, the expression of GM-CSF after the ORFVΔ-mGM-CSF recombinant oncolytic virus obtained in Example 1 infected tumor cells was detected.
[0174] To detect whether GM-CSF is expressed in B16 melanoma cells infected with recombinant contagious ecthyma virus of sheep ORFVΔ-GM-CSF, cells were infected with recombinant contagious ecthyma virus of sheep ORFVΔ-GM-CSF (MOI = 1), and the mRNA level expression of GM-CSF was detected by real-time fluorescence quantitative PCR 48 hours after infection. It was found that the expression of GM-CSF was significantly increased in B16 melanoma cell lines infected with recombinant contagious ecthyma virus of sheep ORFVΔ-GM-CSF, indicating that GM-CSF can be expressed in tumor cells after recombinant contagious ecthyma virus of sheep ORFVΔ-GM-CSF infects tumor cells. The results are as Figure 18 shown.
[0175] Example 14
[0176] In Example 14, after immunizing mice three times with the ORFVΔ-mGM-CSF recombinant oncolytic virus obtained in Example 1, blood was collected from the orbital cavity, serum was taken, and whether neutralizing antibodies were produced was measured.
[0177] One day before the virus neutralization experiment, OFTU cells were evenly passaged into a 96-well plate, and the cell seeding density was 2×10 5 cells / mL. Using 1×10 5 TCID 50The ORFVΔ-mGM-CSF recombinant oncolytic virus was used to immunize mice intraperitoneally three times (on days 7, 14, and 21). Seven days after the last immunization, blood was collected from the orbital cavities of the mice. The serum was separated from the obtained mouse blood. The test serum was inactivated at 56 °C for 30 min, and the serum was diluted 2-fold with DMEM and mixed with an equal volume of the virus of 2 TCID 50 . Five replicates were set up, and the mixture was placed in an incubator at 37 °C with 5% CO2. The green fluorescence was observed after 48 hours. Negative controls were set up. The negative controls included a serum group (serum) with only normal mouse serum wells and a blank control group (vehicle) with only cells. The experimental groups included the ORFVΔ-GM-CSF group and the ORFVΔ-GM-CSF + serum group. The results were as Figure 19 shown. It was found that there was no difference in the fluorescence ratio between the ORFVΔ-GM-CSF group and the ORFV-GM-CSF + serum group, indicating that ORFVΔ-mGM-CSF did not induce the production of neutralizing antibodies.
[0178] Example 15
[0179] After treating the B16 mouse tumor model with the ORFVΔ-mGM-CSF recombinant oncolytic virus obtained in Example 1 in Example 15, flow cytometry was used to detect the enrichment of dendritic cells and M1 macrophages in the tumor.
[0180] 1. Collect B16 cells in the logarithmic growth phase, wash them 2-3 times with PBS buffer, and adjust the cell concentration to 1×10 6 cells / mL. Inject 100 μL of the B16 cell suspension subcutaneously into the right abdomen of the mice to form orthotopic tumors (n = 5). The treatment group was injected intratumorally with 200 μL of ORFVΔ-mGM-CSF (1×10 6 TCID 50(mL), injected once every two days for 5 consecutive times. Collect the tumor tissues and place them in a petri dish containing sterile normal saline or phosphate buffer solution (PBS), and gently rinse to remove blood, mucus and other impurities on the tissue surface. Use sterile ophthalmic scissors to cut the washed tumor tissues into pieces about 1-2 mm in size. Transfer the cut tissue pieces to a centrifuge tube, add an appropriate amount of 0.25% trypsin solution, and digest at 37 °C for 30 minutes. Add medium containing serum to the centrifuge tube to terminate the activity of trypsin. Filter the digested cell suspension through a filter (100 mesh) to remove undigested tissue fragments and cell clumps. Transfer the filtered cell suspension to a centrifuge tube and centrifuge at 1000-1500 revolutions per minute for 5-10 minutes. After centrifugation, aspirate the supernatant, and add an appropriate amount of PBS to the centrifuge tube. Use a cell counting chamber to count the cells in the single-cell suspension, and at the same time detect the cell viability by methods such as trypan blue staining. For tumor-infiltrating dendritic cell staining, use (PE)-conjugated anti-mouse CD11b antibody and (APC)-conjugated anti-mouse CD11c antibody; for M1 macrophage staining, use (FITC)-conjugated anti-mouse F4 / 80 antibody and (PE)-conjugated anti-mouse CD86 antibody, incubate at 4 °C for 1 hour. After the incubation, add an appropriate amount of PBS to the flow tube and centrifuge and wash the cells 2-3 times. Fix the cells by incubating with 4% paraformaldehyde at 4 °C for 30 minutes, and wash the cells 2-3 times with PBS. Collect data using a Beckman Coulter CytoFLEX flow cytometer, and then use FCS Express 7 software for analysis. The results are as Figure 20 shown. The proportion of dendritic cells in the ORFVΔ-mGM-CSF treatment group increased to 30%, and the proportion of M1 macrophages was 14%, which was twice that of the control group, indicating that ORFVΔ-mGM-CSF can enrich dendritic cells and M1 macrophages in the tumor microenvironment.
[0181] The above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.
Claims
1. A novel recombinant orf virus, characterized in that, The recombinant orf virus expressing granulocyte-macrophage colony-stimulating factor GM-CSF.
2. The recombinant orf virus according to claim 1, characterized in that, The recombinant orf virus is a strain with deletion of ORFs005-008 genes, and the deleted fragment is the nucleotide fragment shown in SEQ ID NO:
1.
3. The recombinant orf virus according to claim 2, characterized in that, The GM-CSF gene is one of murine, human, feline or canine origin.
4. The recombinant orf virus according to claim 3, characterized in that, The GM-CSF is mGM-CSF, and its amino acid sequence is shown in SEQ ID NO:
2.
5. The recombinant orf virus according to claim 3, wherein, The GM-CSF is hGM-CSF, and its amino acid sequence is shown in SEQ ID NO:
3.
6. The recombinant orf virus according to claim 3, wherein, The GM-CSF is fGM-CSF, and its amino acid sequence is shown in SEQ ID NO:
4.
7. The recombinant orf virus according to claim 3, wherein, The GM-CSF is cGM-CSF, and its amino acid sequence is shown in SEQ ID NO:
5.
8. The recombinant orf virus according to any one of claims 1-7, characterized in that, The recombinant orf virus is ORFV SY17 strain.
9. The preparation method of the recombinant orf virus according to any one of claims 1-8, characterized in that, The wild-type orf virus ORFs005-008 genes were deleted, and the GM-CSF gene was inserted at the deletion position to obtain the recombinant orf virus ORFVΔ-GM-CSF.
10. Use of the recombinant orf virus according to any one of claims 1-8 in the preparation of an anti-tumor drug.