Sphingomonas genome editing vector based on CRISPR-Cas12a system, editing method and application

Abstract

The invention relates to the technical field of gene editing, in particular to a sphingomonas genome editing vector based on a CRISPR-Cas12a system, an editing method and application. According to the invention, an escherichia coli-sphingomonas shuttle plasmid pBRSL capable of realizing stable genetic expression in sphingomonas is constructed, and a library with 15 endogenous promoters is obtained through red fluorescence characterization; on the basis of a plasmid and a promoter, a CRISPR-Cas12a single plasmid, a sphingomonas genome editing vector based on a CRISPR-Cas12a system and an editing method are further constructed. The editing vector can be used for editing a sphingomonas genome, by utilizing the editing method disclosed by the invention, the genome editing time of a traditional double-exchange method can be shortened from 10-12 days to less than 3 days, and gene editing can be carried out through one-time electrotransfection of CRISPR-Cas12a single plasmids only by assembling a target site guide sequence and a proper repair homologous sequence; the short-time high-efficiency traceless editing of the sphingomonas is realized, the efficiency is high, the time and the cost can be saved, and the operation is simple and convenient.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a Sphingomonas genome editing vector, editing method and application based on the CRISPR-Cas12a system. Background Art

[0002] Sphingomonas sp. is a new type of microbial resource. As an aerobic Gram-negative bacterium, it uses sphingolipids rather than lipopolysaccharides as the main component of cellular lipids. Sphingomonas sp. has great application potential in many aspects due to its high metabolic capacity and multifunctional physiological characteristics. Sphingomonas sp. can synthesize many high-value polysaccharides, such as gellan gum, welan gum, rhamnose gum and diter gum. Most of these polysaccharides have the same main chain structure and are called sphingosine gums. Sphingosine gums often have excellent rheological properties and can be used as stabilizers, thickeners, emulsifiers and gelling agents. Sphingomonas sp. is also an important source of high-value biological pigments, such as β-carotene, lycopene and zeaxanthin. These carotenoids can be used as high-value nutritional additives and are beneficial to human health. In terms of environmental protection, many Sphingomonas have been found to be able to degrade pollutants such as polycyclic aromatic hydrocarbons. In addition, due to their strong environmental tolerance, Sphingomonas are also commonly used in technical fields such as bioremediation and wastewater treatment. However, as a non-model strain, Sphingomonas lacks relatively mature genetic modification methods.

[0003] Traditional genome editing technology for Sphingomonas mainly relies on the host's own homologous recombination system, introduces a type of non-replicable suicide plasmid, completes the first homologous recombination through resistance gene screening, and then uses suicide gene reverse screening to complete the second homologous recombination, and finally completes the genetic modification of the genome. The entire process is complicated, the experimental cycle is long, and the editing efficiency is low, which seriously restricts related research and applications. Efficient and simple genome editing tools can not only facilitate strain modification, but also promote the study of gene function, metabolic network and regulatory mechanism. The CRISPR-Cas system is an adaptive immune defense system formed by bacteria and archaea in the long-term evolution process. It guides Cas nucleases to cut and produce double-strand breaks at specific gene sites through RNA, thereby activating the endogenous DNA recombination repair mechanism and homologous recombination with donor DNA fragments, thereby achieving targeted knockout or modification of genes. At present, the modified CRISPR-Cas has been widely used in microbial genome editing. Summary of the invention

[0004] The technical problem to be solved by the present invention is to address the deficiencies of the prior art. Firstly, an Escherichia coli-Sphingomonas shuttle plasmid pBRSL is provided.

[0005] In a second aspect, the present invention provides a CRISPR-Cas12a single plasmid.

[0006] In a third aspect, the present invention provides a Sphingomonas genomic editing vector based on the CRISPR-Cas12a system.

[0007] In a fourth aspect, the present invention provides a genetically engineered bacterium containing the Sphingomonas genomic editing vector based on the CRISPR-Cas12a system described above.

[0008] In a fifth aspect, the present invention provides the application of the Sphingomonas genomic editing vector based on the CRISPR-Cas12a system described above, or the genetically engineered bacterium described above, in editing the genome of Sphingomonas.

[0009] In a sixth aspect, the present invention provides a method for editing the genome of Sphingomonas.

[0010] The idea of the present invention is as follows: aiming at using Sphingomonas sp. HT-1 as a model strain, after completing the development of the shuttle plasmid and the construction of the endogenous promoter library, a method for Sphingomonas genomic editing is constructed based on the CRISPR-Cas12a system, providing an effective gene editing tool for the molecular genetic transformation and rational metabolic pathway design of this strain, and promoting the development and application of this bacterium.

[0011] To solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0012] In a first aspect, the present invention provides an Escherichia coli-Sphingomonas shuttle plasmid pBRSL. The Escherichia coli-Sphingomonas shuttle plasmid pBRSL is based on the plasmid pBBR1MCS-2 as a backbone, and integrates a sequence containing the replication initiation protein RepA and a multiple cloning site sequence.

[0013] Among them, the backbone based on the plasmid pBBR1MCS-2 is divided into two segments. One segment contains its original replicon sequence, and this replicon sequence is as shown in SEQ ID NO.5. The other segment contains its kanamycin resistance gene sequence, and this kanamycin resistance gene sequence is as shown in SEQ ID NO.6.

[0014] Among them, the sequence containing the replication initiation protein RepA has a nucleotide sequence as shown in any one of SEQ ID NO.1 to 4.

[0015] Correspondingly, the Escherichia coli-Sphingomonas shuttle plasmid pBRSL is pBRSL1 plasmid, pBRSL2 plasmid, pBRSL3 plasmid and pBRSL4 plasmid.

[0016] Preferably, for the sequence containing the replication initiation protein RepA, its nucleotide sequence is as shown in any one of SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.

[0017] Correspondingly, the preferred Escherichia coli - Sphingomonas shuttle plasmid pBRSL is pBRSL1 plasmid, pBRSL2 plasmid, and pBRSL3 plasmid, and their nucleotide sequences are SEQ ID NO.33, SEQ ID NO.34, and SEQ ID NO.35 respectively.

[0018] Specifically, both the pBRSL1 plasmid, pBRSL2 plasmid, and pBRSL3 plasmid can stably inherit in Sphingomonas for at least 3 generations.

[0019] More preferably, for the sequence containing the replication initiation protein RepA, its nucleotide sequence is as shown in SEQ ID NO.3.

[0020] Correspondingly, the more preferred Escherichia coli - Sphingomonas shuttle plasmid pBRSL is pBRSL3.

[0021] Among them, for the multiple cloning site sequence, its nucleotide sequence is as shown in SEQ ID NO.7.

[0022] Specifically, for the multiple cloning site sequence, its multiple cloning sites include BlnⅠ, AflⅡ, XbaⅠ, SpeⅠ, Nde I, Sac I, and Kpn I restriction enzyme sites.

[0023] Currently, commonly used plasmids cannot replicate in Sphingomonas, and it is difficult to conveniently express foreign genes using plasmids as vectors. The Escherichia coli - Sphingomonas shuttle plasmid pBRSL of the present invention can not only be amplified in Escherichia coli but also stably inherit in Sphingomonas, which greatly facilitates the molecular transformation of Sphingomonas.

[0024] In a second aspect, the present invention provides a CRISPR - Cas12a single plasmid, and the CRISPR - Cas12a single plasmid is obtained by integrating the Cas12a protein OpCpf and a promoter using the Escherichia coli - Sphingomonas shuttle plasmid pBRSL as a backbone.

[0025] Among them, the Cas12a protein OpCpf is derived from Lachnospiraceae bacterium and is obtained by optimizing the codons of LbCpf1 in Lachnospiraceae bacterium with sphingosine, and its nucleotide sequence is as shown in SEQ ID NO.24.

[0026] Among them, the promoter is an endogenous promoter screened from the Sphingomonas genome and includes any one of promoters P1 to P15.

[0027] Specifically, for the promoters P1 to P15, their nucleotide sequences are as shown in SEQ ID NOs. 9 to 23 in sequence.

[0028] Among them, the method for constructing the CRISPR-Cas12a single plasmid is as follows: inserting the OpCpf sequence of the Cas12a protein between the Nde I and SacⅠ restriction enzyme sites in the multiple cloning site region of the Escherichia coli-Sphingomonas shuttle plasmid pBRSL, and inserting the endogenous promoter for constitutively expressing the Cas12a protein between the XbaⅠ and Nde I restriction enzyme sites in the multiple cloning site region.

[0029] In a third aspect, the present invention provides a Sphingomonas genome editing vector based on the CRISPR-Cas12a system, and the Sphingomonas genome editing vector is constructed by inserting a crRNA expression unit into the above-mentioned CRISPR-Cas12a single plasmid.

[0030] Among them, the crRNA expression unit is expressed under the control of a promoter with a 20-nt spacer sequence and a 23-nt guiding sequence.

[0031] Specifically, for the 20-nt spacer sequence, its nucleotide sequence is as shown in SEQ ID NO. 25.

[0032] Specifically, the 23-nt guiding sequence is the sequence 23 bp downstream of the PAM site in the target site gene; in some embodiments of the present invention, for the 23-nt guiding sequence, its nucleotide sequence is as shown in SEQ ID NO. 26 or as shown in SEQ ID NO. 27.

[0033] Among them, the sequence of the PAM site is: TTTV. The target DNA sequence can be recognized through the sequence of the PAM site, so that the crRNA can accurately guide Cas12a to a specific position of the target gene, thereby realizing the editing of the target gene.

[0034] In some embodiments of the present invention, the TTTV is TTTA or TTTC.

[0035] Specifically, the promoter is any one of promoters P1 to P15, and for the promoters P1 to P15, their nucleotide sequences are as shown in SEQ ID NOs. 9 to 23 in sequence.

[0036] Among them, the crRNA expression unit includes a terminator located at the 3' end of the crRNA expression unit for terminating transcription, and the nucleotide sequence of the terminator is as shown in SEQ ID NO.28.

[0037] Fourthly, the present invention provides a genetically engineered bacterium containing the Sphingomonas genomic editing vector based on the CRISPR-Cas12a system described above.

[0038] Fifthly, the present invention provides the application of the Sphingomonas genomic editing vector based on the CRISPR-Cas12a system or the genetically engineered bacterium in editing the Sphingomonas genome.

[0039] Specifically, the application in editing the Sphingomonas genome includes knockout, insertion, point mutation, etc. of genes or DNA sequences.

[0040] Sixthly, the present invention provides a method for editing the Sphingomonas genome, which includes the following steps:

[0041] (1) Design the crRNA expression unit of the target site gene and insert it into the CRISPR-Cas12a single plasmid to obtain a targeting plasmid.

[0042] (2) Amplify the upstream and downstream homologous arm sequences of the target site gene and obtain a homologous recombinant DNA fragment through overlap extension PCR.

[0043] (3) Integrate the homologous recombinant DNA fragment obtained in step (2) into the targeting plasmid in step (1) to obtain an editing plasmid.

[0044] (4) Demethylate the editing plasmid in step (3) and transform it into the competent cells of Sphingomonas for expression and editing.

[0045] Among them, in step (1), the sequence of the crRNA expression unit is inserted between the AflⅡ and XbaⅠ restriction enzyme sites.

[0046] Among them, in step (2), 600-1000 bp sequences upstream and downstream of the target site gene are selected as homologous arms, and they are ligated by overlap extension PCR into a 1200-2000 bp sequence as the homologous recombinant DNA fragment.

[0047] Among them, in step (3), the homologous recombinant DNA fragment is integrated between the BlnⅠ and AflⅡ restriction enzyme sites.

[0048] Among them, in step (4), the editing plasmid is demethylated. Specifically, the editing plasmid is chemically transformed into Escherichia coli GM2163, and then the plasmid is cultured and amplified. Subsequently, the demethylated editing plasmid is extracted using a plasmid miniprep kit.

[0049] In some embodiments of the present invention, using the editing method described in the present invention, the pigment gene crtB of Sphingomonas HT was successfully knocked out, and the gene knockout efficiency reached 50-75%.

[0050] In some embodiments of the present invention, the red fluorescent protein gene OpCherry was successfully inserted into Sphingomonas ATCC 31461, and the gene insertion efficiency reached 20-40%.

[0051] Beneficial effects:

[0052] Aiming at the problems of lack of genetic molecular modification means and low efficiency in Sphingomonas, the present invention constructed a shuttle plasmid that can be stably genetically expressed in Sphingomonas and obtained a library of 15 endogenous promoters through red fluorescence characterization. On the basis of the plasmid and the promoter, a genome editing vector and an editing method for Sphingomonas based on the CRISPR-Cas12a system were further developed. This editing method is simple to operate, highly efficient, time-saving and cost-effective. It can shorten the traditional double crossover genome editing from 10-12 days to within 3 days. Only by assembling the target site guiding sequence and the appropriate repair homologous sequence, gene editing can be carried out by electroporating the CRISPR-Cas12a single plasmid once, realizing scarless editing of Sphingomonas in a short time with high efficiency. Description of the drawings

[0053] The following further specifically describes the present invention in conjunction with the drawings, and the above and / or other advantages of the present invention will become clearer.

[0054] Figure 1 It is a schematic diagram of the truncation of the minimum replicon of the endogenous plasmid pSLPG of Sphingomonas.

[0055] Figure 2 It is a result diagram of the first-generation transformants of the 5 plasmids (pBBR1MCS-2, pBRSL1, pBRSL2, pBRSL3, and pBRSL4) electroporated into Sphingomonas on the plate.

[0056] Figure 3 It is a plasmid map of the shuttle plasmid pBRSL (i.e., plasmid pBRSL3).

[0057] Figure 4 It is a plasmid map of the red fluorescence characterization pBRSL-Px-OpCherry plasmid.

[0058] Figure 5 It is a chart of the strengths of 15 endogenous promoters of Sphingomonas

[0059] Figure 6 It is a plasmid map of the pBRSL-OpCpf-cr1-HA1 plasmid for CRISPR-Cas12a gene editing in Sphingomonas

[0060] Figure 7 It is a result graph of single-plasmid knockout of pigments by CRISPR-Cas12a gene editing in Sphingomonas

[0061] Figure 8 It is a plasmid map of the pBRSL-OpCpf-cr2-HA2 plasmid for CRISPR-Cas12a gene editing in Sphingomonas

[0062] Figure 9 It is a result graph of single-plasmid insertion of genes by CRISPR-Cas12a gene editing in Sphingomonas Specific implementation manners

[0063] The following further specifically describes the present invention in combination with specific implementation manners, and the above and / or other advantages of the present invention will become clearer.

[0064] In the following examples, the experimental methods are conventional methods unless otherwise specified; the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0065] In the following examples, the plasmid pSLPG (Accession number: AP012223.1) was donated by Professor Mingjie Jin of Nanjing University of Science and Technology; the plasmid pBBR1MCS-2 is a commercial plasmid; the Escherichia coli GM2163 is a commercial strain for plasmid demethylation; the competent cells of Escherichia coli DH5α were purchased from Anhui General Biosystems Co., Ltd.; the Sphingomonas sp. HT-1 was isolated by this laboratory and preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 2012062 and the NCBI number CP183770.1; the Sphingomonas ATCC31461 was purchased from the American Type Culture Collection, and the NCBI number is PRJNA72839.

[0066] In the following examples, the SOC medium has the following formula: peptone 20 g / L, yeast extract 5 g / L, NaCl 0.5 g / L, glucose 20 mM, MgSO4 10 mM, KCl 2.5 mM; the LB solid medium has the following formula: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar powder 2%.

[0067] Example 1: Construction of the Escherichia coli - Sphingomonas shuttle plasmid pBRSL

[0068] Since the commonly used plasmids at present cannot replicate in Sphingomonas, it is difficult to conveniently express foreign genes using plasmids as vectors. Therefore, this example provides a method for constructing an Escherichia coli - Sphingomonas shuttle plasmid.

[0069] 1. Amplify the sequence containing the replication initiation protein RepA

[0070] Use the primer Rep-F1 combined with the primers Rep-R1, Rep-R2, and Rep-R3 pairwise to perform PCR amplification on the endogenous plasmid pSLPG of Sphingomonas SYK-6 to obtain the DNA fragments Rep1 (4.8 kb), Rep2 (3.8 kb), and Rep3 (2.4 kb); then use the primers Rep-F2 / Rep-R3 to perform PCR amplification on the plasmid pSLPG to obtain the DNA fragment Rep4 (1.8 kb). As Figure 1 , the common feature of these 4 DNA fragments is that they all contain the replication initiation protein RepA sequence of the endogenous plasmid.

[0071] Among them, for the PCR amplification, the amplification program is set as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C (set according to 30 s / kb based on the fragment length), for a total of 30 cycles, and keep at 72°C for 5 min after the cyclic reaction ends; the product is purified and stored at -20°C. The amplification system is shown in Table 1.

[0072] Table 1 PCR amplification system

[0073] Component Volume F-prime (10 μM) 1 μL F-prime (10 μM) 1 μL 2×Phanta Max Master Mix (Vazyme) 25 μL Template X μL <![CDATA[ddH2O]]> To 50 μL Total volume 50 μL

[0074] Among them, the nucleotide sequences of the 4 DNA fragments containing the replication initiation protein RepA sequence are shown in SEQ ID NO.1 - 4 in sequence.

[0075] 2. Amplify the replicon, kanamycin resistance gene sequence, and multiple cloning site sequence

[0076] Two pairs of primers, pBR-F / pBR-R and Kan-F / Kan-R, were used to perform PCR amplification with the broad-host plasmid pBBR1MCS-2 as the template respectively to obtain its replicon sequence pBR and kanamycin resistance gene sequence Kan. Part of the sequences of primers MCS-F and MCS-R were complementary and bound to each other. After PCR amplification without adding a template, the multiple cloning site sequence MCS was obtained.

[0077] Among them, for the replicon DNA fragment pBR, its nucleotide sequence is as shown in SEQ ID NO.5; for the kanamycin resistance gene DNA fragment Kan, its nucleotide sequence is as shown in SEQ ID NO.6; for the multiple cloning site DNA fragment sequence MCS, its nucleotide sequence is as shown in SEQ ID NO.7.

[0078] 3. Construction of plasmids pBRSL1, pBRSL2, pBRSL3 and pBRSL4

[0079] Because homologous arm sequences were set on the primers during PCR amplification, the replicon sequence pBR, kanamycin resistance sequence Kan, and multiple cloning site sequence MCS obtained in step 2 could be respectively subjected to multi-fragment Gibson assembly with the 4 DNA fragments containing the replication initiation protein RepA sequence obtained in step 1, and 4 plasmids with different sizes, pBRSL1, pBRSL2, pBRSL3 and pBRSL4, were obtained by ligation. The reaction procedure for the multi-fragment recombination reaction of plasmid construction was to incubate at 50 °C for 30 min and then immediately place on ice for cooling. The reaction system is shown in Table 2.

[0080] Table 2 Reaction system for multi-fragment Gibson assembly

[0081] Component Volume RepX (X = 1, 2, 3, 4) sequence DNA fragment 1 μL pBR sequence DNA fragment 2 μL Kan sequence DNA fragment 2.5 μL MCS sequence DNA fragment 4.5 μL 2×CE Mix (Vazyme C116) 10 μL Total volume 20 μL

[0082] 4. Demethylated plasmid transformation and extraction

[0083] 10 μL of the plasmid pBBR1MCS-2 and the plasmids pBRSL1, pBRSL2, pBRSL3, and pBRSL4 obtained in step 3 were respectively taken and gently mixed with 100 μL of Escherichia coli GM2163 competent cells, then incubated on ice for 30 min, heat-shocked at 42 °C for 90 s, and then incubated on ice for 3 min. 700 μL of LB liquid medium was added and the mixture was resuscitated at 37 °C for 1 h and then spread on an LB solid plate containing 50 μg / mL kanamycin. After overnight culture at 37 °C, Escherichia coli transformants carrying the plasmids could be obtained. The Escherichia coli transformants of the 4 plasmids were respectively inoculated into 5 mL of LB liquid medium (50 μg / mL kanamycin) and cultured at 37 °C for 12 h. The culture solution was extracted using the plasmid extraction kit of Novoprotein to obtain the demethylated plasmids of pBBR1MCS-2, pBRSL1, pBRSL2, pBRSL3 and pBRSL4 respectively.

[0084] 5. Verification of the genetic stability of transformants

[0085] Take 200 ng of demethylated plasmids pBBR1MCS-2, pBRSL1, pBRSL2, pBRSL3, and pBRSL4 and add them to the competent cells of Sphingomonas sp. HT-1 on ice respectively. Gently pipette up and down to fully mix the plasmids and the competent cells. Incubate on ice for 10 min and then transfer to a pre-chilled electroporation cuvette (1 mm) at 0 °C. Perform electroporation (voltage 3 kV / cm, time constant = 4 ms) three times using an electroporator. Immediately add 700 μL of SOC medium and mix well, then transfer to a sterilized 1.5 mL centrifuge tube and incubate with shaking at 30 °C for 2 h. Finally, spread the culture solution on an LB solid medium plate containing kanamycin at a final concentration of 50 μg / mL and incubate at 30 °C for 48 h.

[0086] Count the first-generation transformants obtained on the plate. As Figure 2 shown, there are 50 - 100 transformants of electroporated plasmid pBBR1MCS-2, 800 - 1000 transformants of electroporated plasmid pBRSL1, 800 - 1000 transformants of electroporated plasmid pBRSL2, 400 - 600 transformants of electroporated plasmid pBRSL3, and 80 - 150 transformants of electroporated plasmid pBRSL4. Randomly pick the grown monoclonal colonies, perform colony PCR using the verification primers Seq-F / Seq-R, and then conduct agarose gel electrophoresis. The verification shows that the target bands can be amplified for all 5 plasmids, indicating that they have all been successfully transformed into Sphingomonas sp.

[0087] Perform liquid subculture of the 5 transformants respectively to verify their genetic stability. The liquid medium is SOC medium containing kanamycin at a final concentration of 40 μg / mL. The culture conditions are 30 °C and 200 rpm. After culturing for 24 h for each generation, perform liquid subculture for 3 generations. Colony PCR verification for each generation shows that except for plasmids pBBR1MCS-2 and pBRSL4 which were lost in the second generation, the remaining plasmids pBRSL1, pBRSL2, and pBRSL3 can be stably inherited in Sphingomonas sp. Therefore, the most streamlined plasmid pBRSL3 is selected as the final Escherichia coli - Sphingomonas shuttle plasmid, named pBRSL. Its plasmid map is as Figure 3 . The nucleotide sequences of the plasmids pBRSL1, pBRSL2, and pBRSL3 are shown as SEQ ID NO.33 - 35 in sequence.

[0088] The primer sequences used in this example are shown in Table 3.

[0089] Table 3 Primer sequences used in Example 1

[0090] Rep-F1 GAGAGCAAGCCCGTAGCTCCGCATCGTGAAG Rep-R1 TGTTCCGTCAGCAGCAACCGCTGAAGATTGTCC Rep-R2 TGTTCCGTCAGCAGCCCTTCTACCCGGAATTGC Rep-R3 TGTTCCGTCAGCAGCACACGCCGATTATTCTCG Rep-F2 GAGAGCAAGCCCGTACAGCTTCCTGCTGGAGTG pBR-F TACGGGCTTGCTCTCCGG pBR-R GGTACCTAGCCGCTTATGTCTATTG Kan-F GCTGCTGACGGAACAGCG Kan-R CCTAGGTCATTAAGCATTCTGCCGAC MCS-F GCTTAATGACCTAGGCTTAAGTCTAGAACTAGTCATATGGAG MCS-R AAGCGGCTAGGTACCGAGCTCCATATGACTAGTTCTAGAC Seq-F CTCATGCTGGAGTTCTTCGC Seq-R GGAGAGCCTGAGCAAACTGG

[0091] Example 2: Construction of an endogenous promoter library of Sphingomonas

[0092] After solving the plasmid vectors available for Sphingomonas, there is still a lack of efficient expression elements for heterologous gene expression using plasmids. In this example, based on the transcriptome data of Sphingomonas HT-1 and combined with the promoter prediction software NNPP (https: / / www.fruitfly.org / seq_tools / promoter.html), 15 endogenous promoters were selected and characterized by fluorescence intensity (RFU) using the red fluorescent protein as the reporter gene to construct an endogenous promoter library with a wide range of expression intensities.

[0093] 1. Construction of plasmid pBRSL-OpCherry

[0094] The red fluorescent protein sequence was codon-optimized according to Sphingomonas, and the optimized OpCherry sequence is shown in SEQ ID NO.8. It was synthesized by Anhui General Biotech Co., Ltd. and inserted between the NdeI and Sac I sites of the shuttle plasmid pBRSL constructed in Example 1. An RBS sequence AGAGGAAG was added between XbaⅠ and SpeⅠ before the 5' of the OpCherry sequence to obtain the plasmid pBRSL-OpCherry.

[0095] 2. Screening of endogenous promoters

[0096] Based on the transcriptome data of Sphingomonas HT-1, genes with relatively high transcriptional intensity were selected, and the sequences within 500 bp before the start codon ATG of the genes were used as potential promoter regions. Combined with the promoter prediction software NNPP (https: / / www.fruitfly.org / seq_tools / promoter.html), a total of 15 endogenous promoter sequences were obtained, as shown in SEQ ID NO.9 - 23.

[0097] 3. Construction of plasmid pBRSL-Px-OpCherry

[0098] The corresponding promoter fragment Px was PCR amplified from the genome of Sphingomonas HT-1 using primers Px-F / Px-R (x = 1, 2, 3...15, corresponding to the promoter numbers). The plasmid pBRSL-OpCherry obtained in step 1 was digested with AflⅡ and XbaⅠ enzymes to obtain a linearized vector, which was then assembled with the promoter fragment Px through Gibson assembly to obtain the plasmid pBRSL-Px-OpCherry. Its plasmid map is as Figure 4Specifically, the recombination reaction procedure of the linearized vector and the promoter fragment Px is as follows: After incubating at 30°C for 50 min, immediately cool on ice. The reaction system is shown in Table 4. The sequence information of primers Px-F / Px-R is shown in Table 5.

[0099] Table 4 Reaction system for Gibson assembly of the linearized vector and the promoter fragment Px

[0100] Component Volume Linearized vector 1 μL Promoter fragment Px 4 μL 2×CE Mix (Vazyme C116) 5 μL Total volume 10 μL

[0101] Table 5 Sequence information of primers Px-F / Px-R

[0102]

[0103]

[0104] 4. Extract the demethylated plasmid

[0105] After chemically transforming the plasmid pBRSL-Px-OpCherry obtained in step 3 into Escherichia coli GM2163, the method refers to step 4 of Example 1. Pick the transformants and inoculate them into 5 mL of LB liquid medium (50 μg / mL kanamycin), culture at 37°C for 12 h, and extract the culture solution using the plasmid extraction kit from Novoprotein to obtain the demethylated plasmid of pBRSL-Px-OpCherry.

[0106] 5. Determine the strength of the promoter according to the relative fluorescence intensity RFU

[0107] Electroporate the demethylated plasmid pBRSL-Px-OpCherry into the competent cells of Sphingomonas HT-1. After recovery, spread it on an LB solid plate containing kanamycin antibiotics and culture for 48 hours. Pick monoclonal colonies for colony PCR verification. Transfer the monoclonal colonies with correct results to SOC medium with a final concentration of 50 μg / mL kanamycin, culture at 30°C, 200 rpm for 36 h. Take 1 mL of the bacterial solution and put it into a 2 mL centrifuge tube, centrifuge at 4°C, 12000 rpm for 1 min to collect the bacteria. Wash the bacteria once with PBS at pH = 7.0, then resuspend and dilute 10 times with 1 mL of PBS. Take 2 mL of the diluted solution to measure the absorbance at 600 the absorbance at this wavelength, and then take 200 μL and add it to a 96-well fluorescence microplate to measure the fluorescence intensity with a fluorescence microplate reader (excitation wavelength 587 nm, emission wavelength 625 nm). Divide the fluorescence intensity by the corresponding OD value to obtain the relative fluorescence intensity RFU of the promoter Px.

[0108] As Figure 5As shown, according to the measured relative fluorescence intensity data, an endogenous promoter library of Sphingomonas with a wide range of expression intensities can be obtained. By defining promoters with RFU≥2500, 1000≤RFU<2500, and RFU<1000 as strong, medium, and weak promoters respectively, it can be seen that among the 15 endogenous promoters screened, there are 3 strong promoters, 7 medium promoters, and 5 weak promoters.

[0109] Example 3: Knockout of the pigment gene crtB of Sphingomonas sp. HT-1 using a CRISPR-Cas12a single plasmid

[0110] The present invention aims to use Sphingomonas sp. HT-1, which can produce welan gum, as a model strain to construct a method for genome editing of Sphingomonas based on the CRISPR-Cas12a system, providing an effective gene editing tool for the molecular genetic transformation and rational metabolic pathway design of this strain. crtB is one of the β-carotene synthases. Studies have shown that when the pigment gene of Sphingomonas is knocked out, the colony color changes from yellow to white. Therefore, in this example, the crtB gene was selected as the knockout target site to verify the application of the CRISPR-Cas12a gene editing vector method for Sphingomonas in gene knockout, and its effect is visually observable. The specific steps are as follows:

[0111] 1. Construct plasmid pBRSL-OpCpf

[0112] The CRISPR RNA-guided endonuclease LbCpf1 derived from Lachnospiraceae bacterium was codon-optimized according to Sphingomonas to obtain the OpCpf sequence, whose nucleotide sequence is shown in SEQ ID NO.24. It was synthesized by Anhui General Biology Company and inserted between the Nde I and Sac I sites of the shuttle plasmid pBRSL constructed in Example 1, and the sequence of the endogenous promoter P10 was added between XbaⅠ and NdeⅠ to obtain plasmid pBRSL-OpCpf.

[0113] 2. Construct plasmid pBRSL-OpCpf-cr1

[0114] The pigment gene crtB of Sphingomonas HT-1 was selected as the knockout target site. Through prediction on the CRISPOR website (https: / / crispor.gi.ucsc.edu), TTTA was selected as the PAM sequence. The 20-nt spacer sequence of crRNA (as shown in SEQ ID NO.25) was added with a 23-nt guiding sequence cr1 (as shown in SEQ ID NO.26). An endogenous promoter P15 was added in front of its 5' end to promote the transcription of crRNA, and a terminator Terminator sequence (as shown in SEQ ID NO.28) was added after its 3' end to avoid over-transcription. The complete crRNA (P-cr1-Ter) sequence including the promoter and terminator was as shown in SEQ ID NO.29, which was synthesized by Anhui General Biosciences and inserted between the AflⅡ and XbaⅠ sites of the above plasmid pBRSL-OpCpf to obtain plasmid pBRSL-OpCpf-cr1.

[0115] 3. Construction of plasmid pBRSL-OpCpf-cr1-HA1

[0116] The genomic DNA of Sphingomonas HT-1 was amplified by PCR using primers HA-L-F1 / HA-L-R1 and HA-R-F1 / HA-R-R1 to obtain two 1-kp homologous arm sequences HA-L1 and HA-R1 upstream and downstream of the pigment gene crtB. Then, primers HA-L-F1 / HA-R-R1 were used for overlap extension PCR to ligate the homologous arms HA-L1 and HA-R1 into a 2-kb homologous recombination donor DNA fragment HA1, and the sequence was as shown in SEQ ID NO.30. The above plasmid pBRSL-OpCpf-cr1 was digested with BlnⅠ and AflⅡ enzymes to obtain a linearized vector, which was assembled with the donor DNA fragment HA1 through Gibson assembly to obtain plasmid pBRSL-OpCpf-cr1-HA1, and its plasmid map was as Figure 6 .

[0117] 4. Demethylation of plasmid pBRSL-OpCpf-cr1-HA1

[0118] The plasmid pBRSL-OpCpf-cr1-HA1 was chemically transformed into Escherichia coli GM2163, and the method referred to step 4 of Example 1. The transformants were picked and inoculated into 5 mL of LB liquid medium (50 μg / mL kanamycin) and cultured at 37 °C for 12 h. The culture solution was extracted using Novoprotein's plasmid extraction kit to obtain the demethylated plasmid of pBRSL-OpCpf-cr1-HA1.

[0119] 5. Verification of crtB gene knockout

[0120] The demethylated plasmid pBRSL-OpCpf-cr1-HA1 was electrotransformed into the competent cells of Sphingomonas HT-1. After recovery, it was spread onto an LB solid plate containing kanamycin antibiotic and cultured for 60 hours.

[0121] As Figure 7 shown, there were 60 - 80 transformants on the plate, among which about 30 - 40 were white colonies. The white monoclonal colonies were picked and transferred to SOC liquid medium containing 0.5‰ SDS for subculture at 40 °C and 200 rpm, with subculture once every 24 hours. As a result, it was found that the plasmid pBRSL-OpCpf-cr1-HA1 was successfully eliminated in the second generation. The genomic DNA of the white Sphingomonas with the eliminated plasmid was extracted using a genomic DNA extraction kit and sent to the company for sequencing to determine that the crtB gene was successfully knocked out. The white color of the colonies was identified as the successful trait of the pigment gene knockout, and the gene knockout efficiency of the CRISPR-Cas12a gene editing vector for Sphingomonas in this example was calculated to reach 50 - 75% by dividing the number of white single colonies by the total number of single colonies.

[0122] The primer sequences used in this example are shown in Table 6.

[0123] Table 6 Information on primer sequences used in Example 3

[0124] HA-L-F1 CAGAATGCTTAATGACCTAGGCGTCGGCTTCGGACG HA-L-R1 TCGCCAATAACTCGACGAGCTTGTCG HA-R-F1 GTCGAGTTATTGGCGAGGATGCTG HA-R-R1 CTTCTGGAAGGTCTTCTTAAGGGATTGATGGACGTGCTG

[0125] Example 4: Gene knock-in of Sphingomonas ATCC 31461 using a CRISPR-Cas12a single plasmid

[0126] This example aims to use Sphingomonas paucimobilis ATCC 31461, which can produce gellan gum, as the target strain to verify the application of a CRISPR-Cas12a gene editing vector method for Sphingomonas in gene insertion, so as to provide an efficient gene editing tool for different species of Sphingomonas in the same genus. The expression of the red fluorescent protein OpCherry in colorless strains will make the colonies appear pink. Therefore, the pigment-deficient Sphingomonas ATCC 31461 was selected as the strain for gene OpCherry insertion, and the effect is visually observable. The specific steps are as follows:

[0127] 1. Construction of plasmid pBRSL-OpCpf-cr2

[0128] Using Sphingomonas sp. ATCC 31461 with the pigment gene crtB deleted as the target strain, a target site was selected near its original pigment gene. Through prediction on the CRISPOR website (https: / / crispor.gi.ucsc.edu), TTTC was selected as the PAM sequence. The 20 nt spacer sequence of crRNA (as shown in SEQ ID NO.25) plus the 23 nt guiding sequence cr2 was (as shown in SEQ ID NO.27). An endogenous promoter P15 was added in front of its 5' end to promote the transcription of crRNA, and a terminator Terminator sequence (as shown in SEQ ID NO.28) was added after its 3' end to avoid over-transcription. The complete crRNA (P-cr2-Ter) sequence including the promoter and terminator was as shown in SEQ ID NO.31, which was synthesized by Anhui General Biosciences and inserted between the AflⅡ and XbaⅠ sites of the plasmid pBRSL-OpCpf constructed in Example 3 to obtain the plasmid pBRSL-OpCpf-cr2.

[0129] 2. Construction of plasmid pBRSL-OpCpf-cr2-HA2

[0130] The genomic DNA of Sphingomonas sp. ATCC 31461 was amplified by PCR using the primers HA-L-F2 / HA-L-R2 and HA-R-F2 / HA-R-R2 to obtain two 1 kp homologous arm sequences HA-L2 and HA-R2, each 1 kp in length, upstream and downstream of the target site. Then, the homologous arms HA-L2, HA-R2 and the red fluorescent protein OpCherry fragment were ligated by overlap extension PCR using the primer HA-L-F2 / HA-R-R2 to form a 2.8 kb homologous recombination donor DNA fragment HA2, the sequence of which was as shown in SEQ ID NO.32. The above plasmid pBRSL-OpCpf-cr2 was digested with BlnⅠ and AflⅡ enzymes to obtain a linearized vector, which was assembled with the donor DNA fragment HA2 by Gibson assembly to obtain the plasmid pBRSL-OpCpf-cr2-HA2, and its plasmid map was as Figure 8 .

[0131] 3. Demethylation of plasmid pBRSL-OpCpf-cr2-HA2

[0132] After the plasmid pBRSL-OpCpf-cr2-HA2 was chemically transformed into Escherichia coli GM2163, the method referred to step 4 of Example 1. The transformants were picked and inoculated into 5 mL of LB liquid medium (50 μg / mL kanamycin) and cultured at 37 °C for 12 h. The culture solution was extracted using the plasmid extraction kit of Novoprotein to obtain the demethylated plasmid of pBRSL-OpCpf-cr2-HA2.

[0133] 4. Verification of the Knock-in of the Red Fluorescent Protein OpCherry Gene

[0134] The demethylated plasmid pBRSL-OpCpf-cr2-HA2 was electrotransformed into the competent cells of Sphingomonas paucimobilis ATCC 31461. After recovery, it was spread on an LB solid plate containing kanamycin antibiotic and cultured for 60 hours.

[0135] The results are as Figure 9 shown. There were 60 - 80 transformants on the plate, among which about 15 - 25 pink colonies expressing the red fluorescent protein were selected. The pink monoclonal colonies were transferred to SOC liquid medium containing 0.5‰ SDS for subculture at 37°C and 200 rpm, and subcultured every 24 hours. The plasmid pBRSL-OpCpf-cr2-HA2 was successfully eliminated in the second generation. After extracting the genomic DNA of the pink Sphingomonas paucimobilis with the plasmid eliminated using a genomic DNA extraction kit, it was sent to the company for sequencing to confirm that the red fluorescent protein gene OpCherry was successfully inserted into the genome. The pink color of the colonies was identified as the successful trait of the knock-in of the red fluorescent protein gene. The gene insertion efficiency of the CRISPR-Cas12a gene editing vector for Sphingomonas paucimobilis in this example was calculated by dividing the number of pink single colonies by the total number of single colonies, reaching 20 - 40%.

[0136] The primer sequences used in this example are shown in Table 7.

[0137] Table 7 Information on the Primer Sequences Used in Example 4

[0138]

[0139]

[0140] The present invention provides an idea and method for a Sphingomonas paucimobilis genome editing vector, editing method and application based on the CRISPR-Cas12a system. There are many methods and ways to specifically implement this technical solution. The above description is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Each component not clearly defined in this example can be realized by the prior art.

Claims

1. An Escherichia coli - Sphingomonas shuttle plasmid pBRSL, characterized in that, The Escherichia coli - Sphingomonas shuttle plasmid pBRSL is based on the plasmid pBBR1MCS - 2 and is obtained by integrating the sequence containing the replication initiation protein RepA and the multiple cloning site sequence; Among them, for the sequence containing the replication initiation protein RepA, its nucleotide sequence is shown as any one of SEQ ID NO.1 - 4; for the multiple cloning site sequence, its nucleotide sequence is shown as SEQ ID NO.

7.

2. A CRISPR-Cas12a single plasmid, characterized in that, The CRISPR - Cas12a single plasmid is based on the Escherichia coli - Sphingomonas shuttle plasmid pBRSL described in claim 1 and is obtained by integrating the Cas12a protein OpCpf and a promoter.

3. The CRISPR-Cas12a single plasmid according to claim 2, wherein For the Cas12a protein OpCpf, its nucleotide sequence is shown as SEQ ID NO.24; the promoter is any one of promoters P1 - P15, and for the promoters P1 - P15, their nucleotide sequences are shown as SEQ ID NO.9 - 23 in sequence.

4. A Sphingomonas genomic editing vector based on the CRISPR-Cas12a system, characterized in that, The Sphingomonas genomic editing vector is constructed by inserting the crRNA expression unit into the CRISPR - Cas12a single plasmid described in claim 2 or 3.

5. A genetically engineered bacterium containing the Sphingomonas genomic editing vector based on the CRISPR - Cas12a system described in claim 4.

6. Use of the Sphingomonas genomic editing vector based on the CRISPR - Cas12a system described in claim 4, or the genetically engineered bacterium described in claim 5, in editing the Sphingomonas genome.

7. A method for editing the genome of Sphingomonas, characterized in that, It includes the following steps: (1) Design the crRNA expression unit of the target site gene and insert it into the CRISPR - Cas12a single plasmid described in claim 2 or 3 to obtain a targeting plasmid; (2) Amplify the upstream and downstream homologous sequences of the target site gene and obtain a homologous recombinant DNA fragment through overlap extension PCR; (3) Integrate the homologous recombinant DNA fragment obtained in step (2) into the targeting plasmid in step (1) to obtain an editing plasmid; (4) Demethylate the editing plasmid in step (3) and transform it into the competent cells of Sphingomonas for expression and editing.

8. The method according to claim 7, wherein In step (1), the crRNA expression unit is expressed under the control of a promoter with a 20 - nt spacer sequence and a 23 - nt guide sequence.

9. The method according to claim 8, characterized in that, For the 20 - nt spacer sequence, its nucleotide sequence is shown as SEQ ID NO.25; the 23 - nt guide sequence is the sequence 23 bp downstream of the PAM site in the target site gene; among them, the sequence of the PAM site is: TTTV.

10. The method according to claim 8, wherein The promoter is any one of promoters P1 - P15, and for the promoters P1 - P15, their nucleotide sequences are shown as SEQ ID NO.9 - 23 in sequence; the crRNA expression unit includes a terminator, and its nucleotide sequence is shown as SEQ ID NO.28.

Images