Application of Maize Gene ZMM3 in Controlling Maize Yield

Abstract

This invention belongs to the field of plant genetic engineering technology and discloses the use of the maize gene ZMM3 in controlling maize yield. The gene is located on maize chromosome 9 and controls the important yield traits of ear number and ear diameter. The protein encoded by the gene is shown in SEQ ID NO. 2. Knocking out the gene and inhibiting its expression using CRISPR / Cas9 technology can increase the number of rows in maize ears. This invention provides a new genetic resource for improving maize yield.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology and specifically relates to the application of the maize gene ZMM3 in controlling maize yield. The gene of the present invention is located on maize chromosome 9 and controls the important yield traits of maize, namely the number of rows of female ears and ear diameter. Background Art

[0002] Corn breeding theory and practice have demonstrated a significant positive correlation between hybrid yield and inbred line yield (Richey, 1946). Under identical planting conditions, hybrid and inbred line yields exhibit similar growth trends. Therefore, increasing inbred line yield is crucial for boosting hybrid yield.

[0003] Corn yield is an extremely complex quantitative trait. Kernel yield is determined by kernel yield per ear and number of ears. Kernel yield per ear can be further broken down into the number of rows per ear, kernels per row, and 100-kernel weight. Dissecting the corn yield trait into its various yield factors and conducting genetic analysis of each is the optimal strategy for ultimately elucidating the genetic mechanisms underlying yield. The number of rows per ear is one of the most important yield factors in corn, showing a significant positive correlation with yield per ear. Elucidating the genetic basis of the number of rows per ear is crucial for understanding the mechanisms underlying yield.

[0004] In light of this, this study used genetic methods to isolate ZMM3, a gene located on maize chromosome 9 that controls ear row number and ear weight. This gene encodes a MADS-box transcription factor involved in the sugar signaling pathway in plants. Based on the genetic phenotypes of the transgenic material and related molecular biological analyses, the biological function of this gene in controlling ear row number was confirmed. This genetic transformation study of ZMM3 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0005] The present invention aims to provide an application of the maize gene ZMM3 in controlling maize ear diameter and / or ear row number. The protein encoded by the gene is shown in SEQ ID NO.2.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The protection scope of the present invention includes:

[0008] Application of the maize gene ZMM3 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO. 2 (AQL01877.1);

[0009] The applications mentioned above are:

[0010] Increased expression of the maize gene ZMM3 for use in reducing maize yield;

[0011] Application of reducing the expression of maize gene ZMM3 in increasing maize yield;

[0012] The above application, specifically, is the application of knocking out, inhibiting or silencing the expression of the corn gene ZMM3 in increasing corn yield;

[0013] In the above-mentioned applications, preferably, the knockout is carried out using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein, thereby achieving the effect of increasing corn yield.

[0014] Preferably, the target sites of gRNA in the CRISPR / Cas9 system are GGATCGAGAACAAGATCAGCCGG and CTCATCATCTTCTCCAGCCGCGG.

[0015] In the above-mentioned application, the corn with increased yield after editing by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO.5 or SEQ ID NO.6.

[0016] Application of the maize gene ZMM3 in creating high-yield maize varieties, specifically, introducing a substance that reduces the expression of the ZMM3 gene in maize into maize, wherein the gene encodes a protein represented by SEQ ID NO. 2;

[0017] In the above application, preferably, the substance is a nucleic acid molecule containing a knockout, inhibition or silencing ZMM3 gene, or an expression cassette of the nucleic acid molecule, a recombinant vector, or a recombinant microorganism;

[0018] The ZMM3 gene is shown as SEQ ID NO.1.

[0019] In the above application, the control of corn yield is achieved by controlling the number of ear rows and / or ear diameter.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] This study cloned and confirmed the gene ZMM3, which controls ear number and ear diameter, in maize. The relationship between ear number and ZMM3 expression levels was also confirmed, demonstrating that reducing ZMM3 expression levels can increase ear number. The difference in ear number between transgenic and wild-type materials is due to editing of the gene's coding region, which results in a decrease in the level of the protein encoded by the gene. In terms of its mechanism of action, it is believed that this gene participates in the sugar signaling response in the plant, increasing the sugar signaling response, thereby regulating the expression of downstream genes, ultimately modulating the differentiation activity of the maize inflorescence meristem and influencing the number of ears and yield trait. Therefore, this study provides a new genetic resource for improving maize yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of maize ZMM3 gene knockout material;

[0023] A is a schematic diagram of the ZMM3 gene editing in maize, where ZMM3-1 lacks 91 bp and ZMM3-2 lacks 92 bp. The deletion of these bases leads to the premature termination of protein translation.

[0024] B is a schematic diagram of the protein structure of maize ZMM3 gene knockout materials, from top to bottom: the wild-type family (WT) isolated from transgenic heterozygous plants, and two ZMM3 gene-edited families ZMM3-1 and ZMM3-2;

[0025] C is a schematic diagram of the female ear of the maize ZMM3 gene knockout material, from left to right are the wild-type family (WT) and the ZMM3 gene-edited family ZMM3-1;

[0026] D is a schematic diagram of the meristem size of maize ZMM3 gene knockout materials, from left to right are the wild-type family (WT) and the ZMM3 gene-edited family ZMM3-1;

[0027] E is a schematic diagram of the ear diameter of the maize ZMM3 gene knockout material, and the bars from left to right are the wild-type family (WT) and the ZMM3 gene-edited family ZMM3-1;

[0028] F is a schematic diagram of the number of ear rows in the maize ZMM3 gene knockout material. The bar graphs from left to right are the wild-type family (WT) and the ZMM3 gene-edited family ZMM3-1.

[0029] Figure 2 Schematic diagram of the expression pattern of the maize ZMM3 gene;

[0030] Among them: A: ZMM3 is highly expressed in maize meristem; BC: In situ hybridization results showed that ZMM3 is specifically expressed in IM (inflorescence meristem), SPM (spikelet pair meristem) and SM (spikelet meristem) of 2mm young ears. DETAILED DESCRIPTION

[0031] The following examples further define the present invention. Based on the following description and examples, those skilled in the art can determine the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make appropriate improvements and modifications to the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels or published materials.

[0032] Example 1:

[0033] Cloning of the Maize Gene ZMM3

[0034] Total DNA was extracted from leaves of the inbred line KN5585 (Liu et al. High-throughput CRISPR / Cas9 mutagenesis streamlines trait gene identification in maize. The Plant Cell, 2020, 32:1397–1413). Primers ZMM3-F and ZMM3-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZMM3 gene was amplified by PCR and resequenced in KN5585. The complete nucleotide sequence of the ZMM3 gene was obtained (SEQ ID NO. 1). The protein encoded by this gene is shown in SEQ ID NO. 2.

[0035] Total DNA from plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s, and finally extension at 72°C for 5 min.

[0036] Table 1. Primers used in the present invention and their sequences

[0037]

[0038] Example 2: Genetic transformation of ZMM3 in maize

[0039] The genetic transformation of ZMM3 gene knockout is to use ZMM3 in the transgenic recipient material KN5585 as the applied gene, the sequence of which is shown in SEQ ID NO.1. http: / / cbi.hzau.edu.cn / crispr / ) were used to design gene targets, ultimately obtaining guide RNAs (Target: GGATCGAGAACAAGATCAGCCGG and CTCATCATCTTCTCCAGCCGCGG). Based on these guide RNAs, ZmU6-Target-sgRNA1 and ZmU6-Target-sgRNA2 fragments (sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively) were synthesized by gene synthesis and constructed into the commercial pEASY-T1 vector.

[0040] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID2) and the fragment was amplified by Hind The CPB-ZmUbi-hspCas9 vector was linearized by single enzyme digestion, recovered by electrophoresis, and detected. The guide RNA was then ligated into the target vector CPB-ZmUbi-hspCas9 (CN113004383A) via homologous recombination. Finally, the resulting clone was sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1; primer ID is 3) to confirm that the target fragment was ligated into the vector.

[0041] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was completed by the Life Science Technology Center of China National Seed Group Corporation). Using specific ZMM3 gene detection primers (primer sequences are shown in Table 1, primer ID4), two maize transformation events were screened in the KN5585 background ( Figure 1 A), ZMM3-1 and ZMM3-2, among which ZMM3-1 has a 91bp deletion (ZMM3-1 contains the sequence shown in SEQ ID NO.5), and ZMM3-2 has a 92bp deletion (ZMM3-2 contains the sequence shown in SEQ ID NO.6). The deletion of these bases leads to the premature termination of protein translation ( Figure 1 Furthermore, in 2022, the phenotypic values ​​of corn ear diameter and ear row number in ZMM3 gene knockout families were investigated in Gansu ( Figure 1 Middle C), the results showed that: compared with WT, the ear diameter of ZMM3-1 increased by 9.7% after the loss of ZMM3 gene function ( Figure 1 Middle E), the number of ear rows increased by 14.3% ( Figure 1 Based on the above results, it was proved that reducing the expression of ZMM3 gene could increase the number of corn ear rows and increase the corn ear diameter.

[0042] Example 3:

[0043] Expression Analysis of Maize ZMM3

[0044] Based on the maize B73 expression database, the expression pattern of the ZMM3 gene was analyzed. The expression level of the ZMM3 gene in maize meristem was very high (FPKM) ( Figure 2 At the same time, we used RNA in situ hybridization to verify the specific expression pattern of ZMM3 in ~2mm young ears ( Figure 2 The primer sequences are shown in Table 1 (primer ID 5). This gene is highly expressed in the early IM, SPM, and SM of maize ears; therefore, ZMM3 affects maize traits such as ear diameter and ear row number.

Claims

1. Corn Genes ZMM3 The application of the gene in controlling corn yield is shown in SEQ ID NO.

2. The control is to reduce the yield of corn. ZMM3 Gene expression to increase corn yield.

2. The use according to claim 1, characterized in that: The control is achieved by knocking out, inhibiting or silencing the corn gene ZMM3 expression to increase maize yield.

3. The use according to claim 2, characterized in that: The knockout uses the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein, thereby achieving the effect of increasing corn yield.

4. The use according to claim 3, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GGATCGAGAACAAGATCAGCCGG and CTCATCATCTTCTCCAGCCGCGG.

5. The use according to claim 4, characterized in that: The corn with improved yield after editing by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO.5 or SEQ ID NO.

6.

6. Corn Genes ZMM3 The application in creating high-yield corn is specifically to reduce ZMM3 The substance expressing the gene is introduced into corn, the protein encoded by the gene is shown in SEQ ID NO.2, and the substance contains the substance for knocking out, inhibiting or silencing ZMM3 The nucleic acid molecule of the gene, or the expression frame of the nucleic acid molecule, the recombinant vector, and the recombinant microorganism.

7. The use according to claim 1 or 6, characterized in that: The ZMM3 The gene is shown as SEQ ID NO.

1.

8. The use according to claim 1, characterized in that: The control of corn yield is achieved by controlling the number of ear rows and / or ear diameter.

Images