Method for synthesizing D-psicose through polyphosphate-driven high-temperature-resistant multienzyme catalysis
Through the polyphosphate-driven high-temperature resistant multi-enzyme catalytic synthesis method, the multi-enzyme system and immobilized enzyme technology of recombinant E. coli expression was used to solve the problems of low conversion rate and high cost in D-psicose production, and achieve efficient and low-cost industrial production.
Patent Information
- Application Number
- CN202510841650.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2025-07-22
AI Technical Summary
The prior art has problems such as low conversion rate, high cost and cumbersome process in the production of D-psicose, making it difficult to achieve efficient and low-cost industrial production.
Polyphosphate-driven high-temperature resistant multi-enzyme catalytic synthesis method is adopted, and the recombinant E. coli expresses a multi-enzyme system, including polyphosphate glucose kinase, 6-phosphate glucose isomerase, D-psicose-6-phosphate-3 epimerase and D-psicose-6-phosphate-phosphate-phosphate-esterase. The reaction conditions are optimized through the in vitro multi-enzyme one-pot reaction and immobilization enzyme technology to improve the temporal and spatio-ether of D-psicose.
The efficient synthesis of D-psicose was achieved, with a spatiotemporal yield of 4.57g/L/h, which reduced the preparation cost, simplified the process, and was suitable for industrial production. The immobilized enzyme system still maintained 70% activity after 5 consecutive use.
Smart Images

Figure CN120350077A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of synthetic biotechnology, and particularly relates to a method for polyphosphate-driven high-temperature resistant multi-enzyme catalytic synthesis of D-allulose. Background Art
[0002] D-allulose is a novel functional monosaccharide with a sweetness about 70% of sucrose, but a calorific value only 0.5% of sucrose. In nature, D-allulose exists in trace amounts in some plants such as Itea virginica and wheat, etc., but it is very difficult to obtain. It has now been found that D-allulose has a variety of important physiological functions, such as effectively inhibiting blood sugar elevation, improving blood lipid metabolism, alleviating diabetes symptoms and reducing the risk of type II diabetes. Given the great application prospects of D-allulose in the food and pharmaceutical fields, developing a method for efficient production of D-allulose will be an important task for the intensive processing of the sugar industry and an inevitable requirement to meet market growth.
[0003] Previously, many scholars have tried various ways, as well as strategies such as the exploration and transformation of pathway enzyme systems and the regulation of metabolic pathways to promote the research progress of D-allulose biosynthesis. For example, the equilibrium conversion rate of D-fructose catalyzed by D-allulose 3-epimerase (DPEase) to synthesize D-allulose is 20-30%; the equilibrium conversion rate of the dual-enzyme system combining the cheaper substrate D-glucose and glucose isomerase GI is only 12%-16%; the two-step method dominated by L-rhamnose kinase phosphorylates D-allulose to D-allulose-1-phosphate and then converts it to D-allulose by in vitro dephosphorylation. Although this method improves the catalytic equilibrium conversion rate, the two-step method makes its actual application more cumbersome and it is difficult to promote industrial application. Therefore, a method for producing D-allulose with a high-temperature resistant multi-enzyme system needs to be developed. Summary of the Invention
[0004] The technical problem to be solved by the present invention is: aiming at the deficiencies existing in the prior art, to provide a method for polyphosphate-driven high-temperature resistant multi-enzyme catalytic synthesis of D-allulose, by which low-cost and high-efficiency synthesis of D-allulose can be achieved.
[0005] To solve the above technical problem, the technical solution of the present invention is:
[0006] The method for synthesizing D-allulose by multi-enzyme catalysis driven by polyphosphate at high temperature according to the present invention is prepared by using D-glucose as a substrate and performing an in vitro multi-enzyme one-pot reaction. The multi-enzyme system is constructed by preparing crude enzymes from recombinant Escherichia coli; the recombinant Escherichia coli overexpresses polyphosphate glucokinase PPGK, 6-phosphoglucose isomerase PGI, D-allulose-6-phosphate-3-epimerase A6PE, and D-allulose-6-phosphate phosphatase A6PP respectively.
[0007] The in vitro multi-enzyme one-pot reaction is carried out according to the following operations: the pH is 6 - 8.5, the reaction temperature is 37 - 55 °C, the reaction time is 1 - 9 h, the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the multi-enzyme system is added at a ratio of 1:1:(1 - 6):1, and polyphosphate and metal ions are added during the reaction.
[0008] The multi-enzyme system is constructed by immobilizing the crude enzymes prepared from recombinant Escherichia coli.
[0009] The immobilized enzyme is prepared by the chitosan-glutaraldehyde cross-linking method according to the following operations: the glutaraldehyde concentration is 20 - 40 g / L, the chitosan concentration is 0.06 - 0.08 g / mL, the cross-linking temperature is 30 - 45 °C, and the immobilization temperature is 10 - 20 °C.
[0010] The addition amount of the polyphosphate is 15 - 20 mM.
[0011] The recombinant Escherichia coli is constructed as follows: The polyphosphate glucokinase PPGK derived from Thermobifida fusca YX is inserted between the BamHⅠ and SalⅠ restriction sites of the vector pCDFDuet-1 to obtain the recombinant plasmid pCDFDuet-PPGK; The glucose-6-phosphate isomerase PGI derived from Thermus thermophilus is inserted between the Hind Ⅲ and BamHⅠ restriction sites of the pET-32a(+) vector to obtain the recombinant plasmid pET-32a(+)-PGI; The D-psicose-6-phosphate 3-epimerase A6PE derived from Clostridium thermosaccharolyticum and the D-psicose-6-phosphate phosphatase A6PP derived from Clostridium thermocellum are respectively inserted between the Hind Ⅲ and BamHⅠ and the Hind Ⅲ and EcoRⅤ restriction sites of the pRSFDuet-1 vector to obtain the recombinant plasmids pRSFDuet-A6PE and pRSFDuet-A6PP; The recombinant plasmids pCDFDuet-PPGK, pET-32a(+)-PGI, pRSFDuet-A6PE and pRSFDuet-A6PP are respectively transformed into Escherichia coli BL21(DE3) to obtain the recombinant Escherichia coli.
[0012] The metal ion is Mg 2+ , Co 2+ , Ni 2+ , Mn 2+ added in one or more combinations.
[0013] The substrate concentration of the in vitro multi-enzyme one-pot reaction is 25 - 100 g / L, and the metal ion addition amount is 5 mM.
[0014] The preparation method of the crude enzyme is as follows: The wet cells of the recombinant Escherichia coli are diluted with 1×PBS to OD 600 5 - 10, the ultrasonic power is 180 W, working for 2 s, pausing for 3 s, and the total ultrasonic time is 10 min, and the crude enzyme solution is collected by centrifugation.
[0015] The preparation method of the wet cells of the recombinant Escherichia coli is as follows: The recombinant Escherichia coli is inoculated into the LB medium for culture, induced with IPTG at 18 - 20 °C for 16 - 20 h, and the wet cells are collected.
[0016] The inoculation amount of inoculating the recombinant Escherichia coli into the LB medium is: 1%.
[0017] The LB medium is prepared according to the following components: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.
[0018] The beneficial effects of the present invention are as follows:
[0019] When constructing recombinant Escherichia coli, the present invention introduces a new enzyme system for synthesizing D-allulose through the glycolytic pathway, polyphosphate glucokinase (PPGK). In the catalytic synthesis without exogenous addition of adenosine triphosphate (ATP), the space-time yield of D-allulose can reach up to 4.57 g / L / h at most.
[0020] In the system for synthesizing D-allulose of the present invention, polyphosphate is used as the enzyme power supply. Compared with adenosine triphosphate (ATP), polyphosphate has low cost and stable properties, can effectively reduce the preparation cost, and simplify the process.
[0021] All the multi-enzyme systems in the present invention are heat-resistant enzymes, which are suitable for relatively high reaction temperatures, are beneficial to product synthesis, and can effectively inhibit the action of heteroproteins.
[0022] In the present invention, a multi-enzyme immobilization operation obtains an immobilized enzyme system with good repeatability. After being continuously used 5 times in the catalytic synthesis of D-allulose, it can still retain 70% of the decay activity.
[0023] The present invention uses D-glucose as a substrate to convert and synthesize D-allulose. D-glucose is easily obtained in nature and has low cost, can effectively reduce the preparation cost, and is suitable for industrial production. Description of the Drawings
[0024] Figure 1 is the process flow chart of the present invention;
[0025] Figure 2 is the reaction flow chart of the present invention;
[0026] In the figure, PolyPi: polyphosphate; PPGK: polyphosphate glucokinase; PGI: glucose-6-phosphate isomerase; A6PE: D-allulose-6-phosphate-3-epimerase, A6PP: D-allulose-6-phosphate-phosphatase. Detailed Embodiments
[0027] The following is further illustrated by specific examples. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
[0028] The raw materials and reagents used in the embodiments of the present invention are all conventional chemical reagents, and can all be obtained through commercial channels. The LB medium is prepared according to the following components: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.
[0029] Examples 1 - 32 adopted the method of the present invention. Examples 1 - 18 were preparation examples of the method without using immobilized enzymes, and Examples 19 - 32 were preparation examples of the reaction using immobilized enzymes. Among them, Example 32 used an immobilized enzyme system that had continuously catalyzed the synthesis of D - allulose 5 times for the reaction. Comparative Example 1 did not adopt the in vitro multi - enzyme one - pot method of the present invention, but used whole - cell catalysis reaction.
[0030] Figure 1 This is the process flow chart of the present invention. The optimal solution of the present invention is specifically as Figure 1 shown. Recombinant Escherichia coli was used to prepare crude enzymes respectively, then the enzymes were immobilized, and then the in vitro multi - enzyme one - pot method was adopted. After multiple experiments by the applicant, directly using the crude enzymes for the in vitro multi - enzyme one - pot method after preparing the crude enzymes also had significantly higher effects than the whole - cell catalysis reaction.
[0031] Figure 2 This is the reaction flow chart of the present invention, which shows the biochemical process of converting D - glucose into D - allulose through a series of enzymatic reactions. The figure shows each intermediate product and its structural changes.
[0032] Example 1
[0033] This example is an implementation example of a method for synthesizing D - allulose by multi - enzyme catalysis driven by polyphosphate with high temperature resistance described in the present invention. The specific steps are as follows:
[0034] (1) Construction of recombinant Escherichia coli
[0035] Construction of recombinant plasmid pCDFDuet-PPGK: Using the PPGK gene fragment derived from Thermobifida fusca YX as a template, PPGK-F: TCATCACCACAGCCAGGATCCCATGGCGAGCCGTGG (BamHⅠ) as the upstream primer, and PPGK-R: TGCGGCCGCAAGCTTGTCGACTTACGCGCTAACACGATCGC (SalⅠ) as the downstream primer for PCR amplification. The plasmid vector pCDFDuet-1 was double digested with restriction endonucleases BamHⅠ and SalⅠ at 37°C, and then the gene fragment and the plasmid vector pCDFDuet-1 were recombinantly ligated using a seamless cloning kit to obtain the recombinant plasmid pCDFDuet-PPGK.The sequence of the recombinant plasmid pCDFDuet-PPGK is as follows: CATGGCGAGCCGTGGTCGTGTTGGTCTGGGTATCGATATCGGCGGCTCTGGCATCAAAGGTGCGCCGGTGGATCTGGATCGTGGCACCTTCGTTGTTGACCGTGTGAAAATTGCGACCCCGCAGCCGGCGACCCCGGAAGCTGTTGCTGCGGTTGTTGCGGAAATTGTTACCGCGTTTGCGGATGATGTTCCGCAGGATGCGCCGCTGGGTGTGACCTTCCCGGCTGTTATCCAGCACGGTGTTGCGCGTAGCGCGGCTAACGTTGATCGTAGCTGGATCGGCACCAACGTTGAAGAACTGCTGAGCGCAGTTACCGGTCGTCGTGTTCTGGTTGTTAACGATGCGGATGCGGCTGCGATGGCGGAACATCGCTACGGTGCGGCGAGCGGCGTTGACGGTGTGGTGCTGCTGACCACCCTGGGTACTGGCATCGGCACTGCGGTTCTGGTGGATGGTGTTCTGCTGCCGAACACCGAATTCGGCCACCTGGAAATTGATGGCTACGATGCAGAAACCCGTGCGTCCGCTAGCGCGAAAGAACGTGAAAACCTGTCTTATAAAGAATGGGCGGAAGAACGTCTGCAGCGTTACTACTCCGTTATCGAGGATCTGCTGTGGCCGGATCTGATCGTTGTTGGTGGCGGTGTTTCTCGTAAAGCGGATAAATTCCTGCCGCACCTGCGTCTGCGTGCGCCGATCGTGCCGGCGAAACTGCGTAACACCGCGGGCATCGTGGGTGCGGCGGTGCTGGCGGCGGAACGTCTGGGTGGCGATCGTGTTAGCGCGTAA。
[0036]
[0037] Construction of recombinant plasmid pRSFDuet-A6PE: Using the A6PE gene fragment from Clostridium thermosaccharolyticum as a template, A6PE-F: GCCGTTGAAGTTGCCGAT (Hind Ⅲ) as the upstream primer, and A6PE-R: CGGGCTGAACAGGTATTTCAT (BamHⅠ) as the downstream primer for PCR amplification. The plasmid vector pRSFDuet-1 was double-digested with restriction endonucleases Hind Ⅲ and BamHⅠ at 37°C, and then the gene fragment and plasmid pRSFDuet-1 were recombinantly ligated using a seamless cloning kit to obtain the recombinant plasmid pRSFDuet-A6PE. The sequence of the recombinant plasmid pRSFDuet-A6PE is as follows: ATGAAATACCTGTTCAGCCCGAGCCTGATGTGCATGAACCTGATCAAACTGAACGAACAGATCAGCGTTCTGAACAGCAAAGCGGATTTCCTGCACGTTGATATCATGGATGGCCACTTCGTTAAAAACATCACCCTGAGCCCGTTCTTCATCGAACAGATCAAAAGCTACGTTAACATCCCGATCGATGCGCACCTGATGGTTGAAAATCCGGGCGATTACATCGAAATCTGCGAAAAAAGCGGCGCGAGCTTCATCACCATCCACGCGGAAACCATCAACCGTGAAGCGTTCCGTATCATCGATCGTATCAAAAGCCACGGCCTGATGGTTGGCATCGCGCTGAACCCGGCGACCCCGATCAGCGAAATCAAACACTACATCAACAAAATCGATAAAATCACCATCATGACCGTTGATCCGGGCTTCGCGGGCCAGCCGTTCATCCCGGAAGTTCTGGAAAAAATCCGTGATCTGAAACGTCTGAAAGATGATAACAACTACAACTACCTGATCGAAGCGGATGGCAGCTGCAACAAAAACACCTTCCAGGTTCTGAAAGATGCGGGCTGCAAAGTTTTCGTTCTGGGCAGCAGCGGCCTGTTCAACCTGAGCGATGATCTGGGCAAAGCGTGGGAAATCATGATCGGCAACTTCAACGGC。
[0038] Construction of recombinant plasmid pRSFDuet-A6PP: Using the A6PP gene fragment from Clostridium thermocellum as a template, A6PP-F: GCTCGAGCAGCATGAACATATCCAGCAGG (Hind Ⅲ) as the upstream primer, and A6PP-R: GAAGAAAACCGCTTTGTATTTGATCATAAGCTTTTA (EcoRⅤ) as the downstream primer for PCR amplification. The plasmid vector pRSFDuet-1 was double-digested with restriction endonucleases Hind Ⅲ and EcoRⅤ at 37°C, and then the gene fragment and plasmid pRSFDuet-1 were recombinantly ligated using a seamless cloning kit to obtain the recombinant plasmid pRSFDuet-A6PP. The sequence of the recombinant plasmid pRSFDuet-A6PP is as follows: ATGATCAAATACAAAGCGGTTTTCTTCGATTTCGATTACACCCTGGCGGATAGCAGCAAAGCGGTTATCGAATGCATCAACTACGCGCTGCAGAAAATGGGTTACCCGGAAAGCAGCCCGGAAAGCATCTGCCGTACCATCGGCCTGACCCTGGCGGAAGCGTTCAAAATCCTGAGCGGTGATACCAGCGATAGCAACGCGGACCTGTTCCGTCAGTACTTCAAAGAACGTGCGGATCTGGTTATGTGCGATCGTACCGTTATGTACAGCACCGTTGAATGCGTTCTGAAAAAACTGAAAAAAGCGGATGTTAAAACCGGTATCGTTAGCACCAAATACCGTTACCGTATCGAAGATATTCTGAAACGTGATAAACTGCTGCAGTACTTCGATGTTATCGTTGGCGGCGAAGATGTTGCGGCGCACAAACCGGACCCGGAAGGCCTGCTGAAAGCGATCAGCATGGTTGGCTGCCAGAAAGAAGAAGTTCTGTTCGTTGGTGATAGCACCGTTGATGCGCGTACCGCGAAAAACGCGGGCGTTGATTTCGTTGCGGTTCTGACCGGCACCACCGGCGCGAACGAATTCAGCGAATACAACCCAGGCGCGGTTATCGAAGATCTGAGCGGCCTGCTGGATATGTTCATGCTG。
[0039] The recombinant plasmids pCDFDuet-PPGK, pET-32a(+)-PGI, pRSFDuet-A6PE, and pRSFDuet-A6PP were respectively transformed into Escherichia coli BL21(DE3).
[0040] (2)Preparation of wet bacterial cells
[0041] The recombinant Escherichia coli was inoculated into LB medium at an inoculum size of 1% and cultured at 37 °C. When the OD600 reached 0.6, IPTG with a final concentration of 1 mM was added, and induction was carried out at 20 °C for 20 h. The fermentation broth was centrifuged at 8000 r / min, and the obtained wet bacterial cells were resuspended with 1×PBS buffer and then centrifuged again.
[0042] (3)Preparation of crude enzyme
[0043] The wet bacterial cells were diluted with 1×PBS to OD 600 6, the ultrasonic power was 180 W, the working time was 2 s, the pause time was 3 s, the total ultrasonic time was 10 min, and the supernatant was collected by centrifugation at 6000 r / min to obtain the crude enzyme solution.
[0044] (4)In vitro multi-enzyme one-pot reaction
[0045] The conditions for the in vitro multi-enzyme one-pot reaction were as follows: Using D-glucose as the substrate, the substrate concentration was 25 g / L, the concentration of the multi-enzyme system was 40 ng / mL, the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the multi-enzyme system was added at 1:1:1:1, the reaction temperature was 50 °C, the pH was 8.0, the metal ion was 5 mM of Mn 2+ , the addition amount of the cofactor polyphosphate was 15 mM, and the catalytic reaction time was 3 h.
[0046] (5)Product detection
[0047] The consumption of the substrate D-glucose and the production of D-allulose were detected by high performance liquid chromatography (HPLC), and the conversion rate was calculated.
[0048] The HPLC detection conditions were as follows: The chromatographic analysis column was Aminex HPX-87C, 300 mm × 7.8 mm, the mobile phase was ultrapure water, the flow rate was 0.6 mL / min, the column temperature was 80 °C, and the differential refractive index (RI) detector was used. The retention time of the D-glucose standard was 10.60 min, the retention time of the D-fructose standard was 13.32 min, and the retention time of the D-allulose standard was 18.82 min.
[0049] Example 2
[0050] During the in vitro multi-enzyme one-pot reaction, the temperature of the reaction system was adjusted to 40 °C, and the rest of the operations were the same as those in Example 1.
[0051] Example 3
[0052] When performing the in vitro multi-enzyme one-pot reaction, adjust the temperature of the reaction system to 60 °C, and the remaining operations are the same as those in Example 1.
[0053] Example 4
[0054] When performing the in vitro multi-enzyme one-pot reaction, adjust the pH of the reaction system to 6.5, and the remaining operations are the same as those in Example 1.
[0055] Example 5
[0056] When performing the in vitro multi-enzyme one-pot reaction, adjust the pH of the reaction system to 7.0, and the remaining operations are the same as those in Example 1.
[0057] Example 6
[0058] When performing the in vitro multi-enzyme one-pot reaction, adjust the pH of the reaction system to 8.5, and the remaining operations are the same as those in Example 1.
[0059] Example 7
[0060] When performing the in vitro multi-enzyme one-pot reaction, adjust the metal ion in the reaction system to Mg 2+ , and the remaining operations are the same as those in Example 1.
[0061] Example 8
[0062] When performing the in vitro multi-enzyme one-pot reaction, adjust the metal ion in the reaction system to Co 2+ , and the remaining operations are the same as those in Example 1.
[0063] Example 9
[0064] When performing the in vitro multi-enzyme one-pot reaction, adjust the addition amount of polyphosphate in the reaction system to 10 mM, and the remaining operations are the same as those in Example 1.
[0065] Example 10
[0066] When performing the in vitro multi-enzyme one-pot reaction, adjust the addition amount of polyphosphate in the reaction system to 20 mM, and the remaining operations are the same as those in Example 1.
[0067] Example 11
[0068] When performing the in vitro multi-enzyme one-pot reaction, adjust the concentration of D-glucose in the reaction system to 50 g / L, and the remaining operations are the same as those in Example 1.
[0069] Example 12
[0070] When performing the in vitro multi-enzyme one-pot reaction, adjust the concentration of D-glucose in the reaction system to 100 g / L, and the remaining operations are the same as those in Example 1.
[0071] Example 13
[0072] When performing the in vitro multi-enzyme one-pot reaction, adjust the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the reaction system to 1:1:2:1, and the remaining operations are the same as those in Example 1.
[0073] Example 14
[0074] When performing the in vitro multi-enzyme one-pot reaction, adjust the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the reaction system to 1:1:4:1, and the remaining operations are the same as those in Example 1.
[0075] Example 15
[0076] When performing the in vitro multi-enzyme one-pot reaction, adjust the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the reaction system to 1:1:6:1, and the remaining operations are the same as those in Example 1.
[0077] Example 16
[0078] When performing the in vitro multi-enzyme one-pot reaction, adjust the overall reaction time of the reaction system to 1 h, and the remaining operations are the same as those in Example 1.
[0079] Example 17
[0080] When performing the in vitro multi-enzyme one-pot reaction, adjust the overall reaction time of the reaction system to 6 h, and the remaining operations are the same as those in Example 1.
[0081] Example 18
[0082] When performing the in vitro multi-enzyme one-pot reaction, adjust the overall reaction time of the reaction system to 9 h, and the remaining operations are the same as those in Example 1.
[0083] Example 19
[0084] (1) Construction of recombinant Escherichia coli
[0085] Refer to Example 1.
[0086] (2) Preparation of wet bacterial cells
[0087] Refer to Example 1.
[0088] (3) Preparation of crude enzyme
[0089] Refer to Example 1.
[0090] (4) Immobilized enzyme
[0091] The immobilized enzyme operation is carried out as follows: A certain amount of chitosan is added to 1.5% glacial acetic acid, and it is mixed evenly by a magnetic stirrer and left standing overnight. The next day, the solution is slowly dropped into an equal volume of a mixed solution of 1 mol / L NaOH and methanol (volume ratio 3:1) through a syringe to form carrier microspheres. After solidifying for 15 minutes, it is taken out by filtration and slowly rinsed with distilled water. The microspheres are put into deionized water to obtain a chitosan carrier; the carrier is dried to remove water, added to glutaraldehyde for binding (1 g:10 mL), and placed in a shaker (1 h, 180 rpm), taken out by filtration and rinsed with distilled water to obtain an activated carrier. The activated carrier is placed in a multi-enzyme system (the addition ratio of four enzymes, PPGK, PGI, A6PE, and A6PP, is 1:1:4:1), and the multi-enzyme mixed system concentration is 40 ng / mL for 6 h. After completion, the immobilized enzyme is taken by filtration and washed 2 - 3 times with neutral sodium acetate buffer solution to obtain the immobilized enzyme.
[0092] Immobilized enzyme conditions: Glutaraldehyde concentration is 30 g / L, chitosan concentration is 0.07 g / mL, cross-linking temperature is 40 °C, and immobilization temperature is 15 °C.
[0093] (5) In vitro multi-enzyme one-pot reaction
[0094] In vitro multi-enzyme one-pot reaction conditions: Using D-glucose as the substrate, the substrate concentration is 25 g / L, the reaction temperature is 50 °C, the pH is 7.0, the metal ion is 5 mM Mg 2+ , and the addition amount of cofactor polyphosphate is 15 mM, and the catalytic reaction time is 3 h.
[0095] (6) Product detection
[0096] Refer to Example 1.
[0097] Example 20
[0098] When immobilizing the multi-enzyme system, the glutaraldehyde concentration is adjusted to 20 g / L, and the rest of the operations are the same as those in Example 19.
[0099] Example 21
[0100] When immobilizing the multi-enzyme system, the glutaraldehyde concentration is adjusted to 40 g / L, and the rest of the operations are the same as those in Example 19.
[0101] Example 22
[0102] When immobilizing the multi-enzyme system, the chitosan concentration is adjusted to 0.06 g / mL, and the rest of the operations are the same as those in Example 19.
[0103] Example 23
[0104] When immobilizing the multi-enzyme system, adjust the chitosan concentration to 0.08 g / mL, and the remaining operations are the same as those in Example 19.
[0105] Example 24
[0106] When immobilizing the multi-enzyme system, adjust the cross-linking temperature to 30 °C, and the remaining operations are the same as those in Example 19.
[0107] Example 25
[0108] When immobilizing the multi-enzyme system, adjust the cross-linking temperature to 45 °C, and the remaining operations are the same as those in Example 19.
[0109] Example 26
[0110] When immobilizing the multi-enzyme system, adjust the immobilization temperature to 10 °C, and the remaining operations are the same as those in Example 19.
[0111] Example 27
[0112] When immobilizing the multi-enzyme system, adjust the immobilization temperature to 20 °C, and the remaining operations are the same as those in Example 19.
[0113] Example 28
[0114] When performing the in vitro multi-enzyme one-pot reaction, adjust the reaction temperature in the reaction system to 55 °C, and the remaining operations are the same as those in Example 19.
[0115] Example 29
[0116] When performing the in vitro multi-enzyme one-pot reaction, adjust the reaction temperature in the reaction system to 55 °C and the pH to 8.0, and the remaining operations are the same as those in Example 19.
[0117] Example 30
[0118] When performing the in vitro multi-enzyme one-pot reaction, adjust the reaction temperature in the reaction system to 55 °C and the pH to 6.0, and the remaining operations are the same as those in Example 19.
[0119] Example 31
[0120] When performing the in vitro multi-enzyme one-pot reaction, adjust the reaction temperature in the reaction system to 55 °C, the pH to 6.0, and the metal ion to Ni 2+ , and the remaining operations are the same as those in Example 19.
[0121] Example 32
[0122] Referring to the in vitro multi-enzyme one-pot catalytic reaction conditions of Example 31, the reaction was carried out using an immobilized enzyme system that had continuously catalyzed the synthesis of D-allulose 5 times, and the rest of the operations were the same as those in Example 19. The yield was measured and the decay activity of the immobilized enzyme was analyzed by comparison (immobilized enzyme decay activity = yield of the 6th catalytic synthesis / yield of the first catalytic synthesis × 100%). It can be seen from Table 2 that the yield of the 6th catalytic synthesis was 3.199 g / L / h, and the yield of the first catalytic synthesis was 4.570 g / L / h (Example 31), and the calculated decay activity was 70%.
[0123] Comparative Example 1
[0124] The in vitro multi-enzyme one-pot catalytic reaction was adjusted to a whole-cell catalytic reaction, and the multi-enzyme system was changed to GLK, PGI from Escherichia coli BL21(DE3), A6PE, and A6PP from Bacteroides fragilis NCTC9343. Construction of recombinant plasmid pRSFDuet-GLK: Using the GLK gene fragment from Escherichia coli BL21(DE3) as a template, GLK-F: tcatcaccacagccaggatccgatgacaaagtatgcattagtcggt (BamH I) as the upstream primer, and GLK-R: tgcggccgcaagcttgtcgacagaatgtgacctaaggtctgg (Not I) as the downstream primer for PCR amplification. The plasmid pRSFDuet-1 was double-digested with restriction enzymes BamH I and Not I at 37°C, and then the gene fragment and plasmid pRSFDuet-1 were recombinantly ligated using a seamless cloning kit to obtain the recombinant plasmid pRSFDuet-GLK.
[0125] Construction of recombinant plasmid pRSFDuet-GLK-PGI: Using the PGI gene fragment from Escherichia coli BL21(DE3) as a template, PGI-F: agatatacatatggcagatctcatgaaaaacatcaatccaacgcag (Bgl II) as the upstream primer, and PGI-R: ggtttctttaccagactcgagttaaccgcgccacgctttata (Xho I) as the downstream primer for PCR amplification. The plasmid pRSFDuet-GLK was double-digested with restriction enzymes Bgl II and XhoI at 37°C, and then the gene fragment and plasmid pRSFDuet-GLK were recombinantly ligated using a seamless cloning kit to obtain the recombinant plasmid pRSFDuet-GLK-PGI.
[0126] Construction of recombinant plasmid pETDuet-A6PE: Using the Escherichia coli BL21(DE3) A6PE genome as a template, A6PE-F: tcatcaccacagccaggatccgatgatgaaaatctccccctcgttaatg (BamH I) as the upstream primer, and A6PE-R: gcattatgcggccgcaagcttttatgctgtttttgcatgaggct (Hind III) as the downstream primer for PCR amplification. The plasmid pETDuet-1 was double-digested with restriction enzymes BamH I and Hind III at 37°C, and then homologous recombination ligation was performed using a seamless cloning kit to obtain the recombinant plasmid pETDuet-A6PE;
[0127] Construction of recombinant plasmid pETDuet-A6PE-A6PP: Using the Bacteroides fragilis NCTC9343 genome as a template, A6PP-F: agatatacatatggcagatctcatgaaatacaccgtttacctgttcg (Bgl II) as the upstream primer, and A6PP-R: agcggtttctttaccagacgttacagcgggcaaccgc (Xho I) as the downstream primer for PCR amplification. The plasmid pETDuet-A6PE was double-digested with restriction enzymes Bgl II and Xho I at 37°C, and then homologous recombination ligation was performed using a seamless cloning kit to obtain the recombinant plasmid pETDuet-A6PE-A6PP;
[0128] The recombinant plasmids pRSFDuet-GLK-PGI and pETDuet-A6PE-A6PP were co-transformed into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli.
[0129] In the reaction system, the substrate concentration was 25 g / L, the wet cell concentration was 25 g / L, the reaction temperature was 37°C, the pH was 7.5, the metal ion was 5 mM of Mg 2+ , the cofactor adenosine triphosphate (ATP) was added at 25 mM, and the catalytic reaction time was 12 h. The rest of the operations were the same as in Example 1.
[0130] The space-time yields of D-allulose in Examples 1-18 and Comparative Example 1 of the present invention are shown in Table 1; the space-time yields of D-allulose in Examples 19-32 are shown in Table 2.
[0131] Table 1 Space-time yield table of D-allulose in Examples 1-18 and Comparative Example 1
[0132] Example Substrate concentration g / L Temperature °C pH Metal ion Concentration of polyphosphate Ratio of multi-enzyme system Reaction time Space-time yield g / L / h Example 1 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 2.536 Example 2 25 40 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 1.524 Example 3 25 60 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 0.627 Example 4 25 50 6.5 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 1.712 Example 5 25 50 7.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 1.925 Example 6 25 50 8.5 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 2.107 Example 7 25 50 8.0 <![CDATA[5mM Mg 2+ > 15 mM 1:1:1:1 3h 1.986 Example 8 25 50 8.0 <![CDATA[5mM Co 2+ > 15 mM 1:1:1:1 3h 2.274 Example 9 25 50 8.0 <![CDATA[5mM Mn 2+ > 10 mM 1:1:1:1 3h 2.160 Example 10 25 50 8.0 <![CDATA[5mM Mn 2+ > 20 mM 1:1:1:1 3h 2.312 Example 11 50 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 2.102 Example 12 100 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 3h 1.926 Example 13 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:2:1 3h 3.047 Example 14 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:4:1 3h 3.435 Example 15 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:6:1 3h 3.526 Example 16 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 1h 1.543 Example 17 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 6h 2.625 Example 18 25 50 8.0 <![CDATA[5mM Mn 2+ > 15 mM 1:1:1:1 9h 2.704 Comparative Example 1 25 37 7.5 <![CDATA[5mM Mg 2+ > 25 mM ATP \ 12h 0.937
[0133] Table 2 Space-time yield of D-allulose in Examples 19 - 32
[0134] Example Substrate concentration g / L Temperature °C pH Metal ion Glutaraldehyde concentration Chitosan concentration g / mL Crosslinking temperature °C Immobilization temperature Space-time yield g / L / h Example 19 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 15℃ 4.132 Example 20 25 50 7.0 <![CDATA[5mM Mg 2+ > 20 g / L 0.07 40 15℃ 3.801 Example 21 25 50 7.0 <![CDATA[5mM Mg 2+ > 40 g / L 0.07 40 15℃ 3.718 Example 22 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.06 40 15℃ 3.734 Example 23 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.08 40 15℃ 3.925 Example 24 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 30 15℃ 3.890 Example 25 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 45 15℃ 3.723 Example 26 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 10℃ 4.036 Example 27 25 50 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 20℃ 3.714 Example 28 25 55 7.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 15℃ 4.304 Example 29 25 55 8.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 15℃ 3.975 Example 30 25 55 6.0 <![CDATA[5mM Mg 2+ > 30 g / L 0.07 40 15℃ 4.413 Example 31 25 55 6.0 <![CDATA[5 mM Ni 2+ > 30 g / L 0.07 40 15℃ 4.570 Example 32 25 55 6.0 <![CDATA[5mM Ni 2+ > 30 g / L 0.07 40 15℃ 3.199
[0135] From the data in Table 1 and Table 2, it can be found that in the present invention, D-glucose is used as a substrate, and D-allulose is prepared through the construction of recombinant Escherichia coli, the preparation of wet bacterial cells, the preparation of crude enzyme, immobilized enzyme, and in vitro multi-enzyme one-pot reaction. Compared with the prior art, under the same substrate concentration, metal ion concentration, cofactor addition amount, and optimal pH conditions, the space-time yield of D-allulose can be greatly improved. In the in vitro multi-enzyme one-pot catalytic reaction of the free enzyme system, the space-time yield at 50 °C for 3 h is 3.526 g / L / h; in the in vitro multi-enzyme one-pot catalytic reaction of the immobilized enzyme system, the space-time yield at 55 °C for 3 h is 4.570 g / L / h. The space-time yield of the process technology of the present invention is higher than that of the comparative example of D-allulose, which is 0.937 g / L / h.
[0136] Moreover, the relatively high reaction temperature of the in vitro multi-enzyme one-pot catalytic reaction is beneficial to the forward progress of the catalytic reaction. The cofactor uses polyphosphate, and adenosine triphosphate (ATP) is not added externally, which saves costs. The immobilized enzyme technology has high repeatability and can maintain 70% of the decay activity after 5 consecutive reactions, and is suitable for industrial applications.
[0137] The above are only the preferred examples of the present invention and do not limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A method for polyphosphate-driven multi-enzyme catalytic synthesis of D-allulose with high temperature resistance, characterized in that, It is prepared by using D-glucose as a substrate through an in vitro multi-enzyme one-pot reaction. The multi-enzyme system is constructed by preparing crude enzymes from recombinant Escherichia coli. The recombinant Escherichia coli overexpresses polyphosphate glucokinase PPGK, 6-phosphoglucose isomerase PGI, D-psicose-6-phosphate 3-epimerase A6PE, and D-psicose-6-phosphate phosphatase A6PP respectively. The in vitro multi-enzyme one-pot reaction is carried out according to the following operations: the pH is 6 - 8.5, the reaction temperature is 37 - 55 °C, the reaction time is 1 - 9 h, the addition ratio of the four enzymes PPGK, PGI, A6PE, and A6PP in the multi-enzyme system is added at 1:1:(1 - 6):1, and polyphosphate and metal ions are added during the reaction.
2. The method for synthesizing D-psicose according to claim 1, wherein The multi-enzyme system is constructed by immobilizing the crude enzymes prepared from recombinant Escherichia coli. The immobilized enzyme is prepared by the chitosan-glutaraldehyde cross-linking method according to the following operations: the concentration of glutaraldehyde is 20 - 40 g / L, the concentration of chitosan is 0.06 - 0.08 g / mL, the cross-linking temperature is 30 - 45 °C, and the immobilization temperature is 10 - 20 °C.
3. The method for synthesizing D-psicose according to claim 1 or 2, characterized in that, The addition amount of the polyphosphate is 15 - 20 mM.
4. The method for synthesizing D-psicose according to claim 1 or 2, characterized in that, The recombinant Escherichia coli is constructed according to the following method: The polyphosphate glucokinase PPGK derived from Thermobifida fusca YX is inserted into the pCDFDuet-1 vector to obtain the recombinant plasmid pCDFDuet-PPGK; the 6-phosphoglucose isomerase PGI derived from Thermus thermophilus is inserted into the pET-32a(+) vector to obtain the recombinant plasmid pET-32a(+)-PGI; the D-psicose-6-phosphate 3-epimerase A6PE derived from Clostridium thermosaccharolyticum and the D-psicose-6-phosphate phosphatase A6PP derived from Clostridium thermocellum are respectively inserted into the pRSFDuet-1 vector to obtain the recombinant plasmids pRSFDuet-A6PE and pRSFDuet-A6PP. The recombinant plasmids pCDFDuet-PPGK, pET-32a(+)-PGI, pRSFDuet-A6PE, and pRSFDuet-A6PP are respectively transformed into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli.
5. The method for synthesizing D-psicose according to claim 1, characterized in that, The metal ion is Mg 2+ , Co 2+ , Ni 2+ , Mn 2+ One or more combinations.
6. The method for synthesizing D-psicose according to claim 1 or 2, characterized in that, The substrate concentration of the in vitro multi-enzyme one-pot reaction is 25 - 100 g / L, and the addition amount of metal ions is 5 mM.
7. The method for synthesizing D-psicose according to claim 1 or 2, characterized in that, The preparation method of the crude enzyme is as follows: Dilute the wet recombinant Escherichia coli cells with 1×PBS to OD 600 5 - 10, with an ultrasonic power of 180 W, working for 2 s and pausing for 3 s, and the total ultrasonic time is 10 min. Collect the crude enzyme by centrifugation.
8. The method for synthesizing D-psicose according to claim 7, wherein The preparation method of the wet cells of the recombinant Escherichia coli is as follows: The recombinant Escherichia coli is inoculated into an LB medium for culture, induced with IPTG at 18 - 20 °C for 16 - 20 h, and the wet cells are collected.
9. The method for synthesizing D-psicose according to claim 8, wherein The inoculation amount of inoculating the recombinant Escherichia coli into the LB medium is: 1%.
10. The method for synthesizing D-psicose according to claim 8, characterized in that, The LB medium is prepared according to the following component ratio: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride.