Method for detecting low-frequency mutation of nucleic acid

Abstract

The invention relates to a detection method which is used for identifying a target nucleotide sequence on one or more specific sites of nucleic acid to be detected, or identifying that the original nucleotide sequence of the nucleic acid to be detected on one or more specific sites compared with reference nucleic acid is mutated into the target nucleotide sequence.

Description

Technical Field

[0001] The present application relates to a nucleic acid detection method, and particularly to a method, kit and system for detecting low-frequency mutations of nucleic acids. Background Art

[0002] Nucleic acid mass spectrometry is a recognized technology suitable for medium-throughput detection of gene mutations, and can detect gene mutations at dozens to hundreds of positions simultaneously in one reaction. The existing nucleic acid mass spectrometry detects mutation sites by designing an extension primer adjacent to the mutation site, and then performing an extension reaction. The position of the extended base is the mutation site. Depending on the molecular weight of the extended base, the base type of the mutation site can be determined. However, this method is generally difficult to detect low-frequency mutations, generally when the mutation is less than 5%. When the mutation is less than 5%, the extension peak representing the mutated base is very low and it is difficult to distinguish it from the noise peak. Therefore, there is a need in the art for a new method that can improve the sensitivity of nucleic acid mass spectrometry for detecting low-frequency mutations. Summary of the Invention

[0003] Under the condition of maintaining the original reagent system, instrument and reaction environment of the existing detection technology, the present invention application can reduce the detection limit of the mutation frequency detected by nucleic acid mass spectrometry from 5% to 0.1% without increasing other costs and labor, and can expand the sample type detected by nucleic acid mass spectrometry from tissue samples / paraffin-embedded tissue samples to plasma samples, greatly improving the application scenarios of nucleic acid mass spectrometry detection technology.

[0004] On the one hand, the present application provides a detection method for identifying a target nucleotide sequence at one or more specific positions of a nucleic acid to be detected, or identifying that the original nucleotide sequence at one or more specific positions of the nucleic acid to be detected compared with a reference nucleic acid mutates into a target nucleotide sequence. The method includes: 1) providing an extension primer, which is an oligonucleotide with a mutation recognition site at the 3'-end, wherein the mutation recognition site can be complementary paired with the target nucleotide sequence, but not with the original nucleotide sequence, and the nucleotide at the mutation recognition site is a modified nucleotide, and the modified nucleotide can increase the specificity of the extension primer; 2) hybridizing the extension primer with the nucleic acid to be detected or its amplification product to form an extension product; 3) using nucleic acid mass spectrometry to analyze the extension product in 2) to identify the presence of the target nucleotide sequence.

[0005] In some embodiments, the method includes setting the mutation recognition site at any position among the three nucleotides at the extreme 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at one nucleotide among the three nucleotides at the extreme 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at two nucleotides among the three nucleotides at the extreme 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at three nucleotides among the three nucleotides at the extreme 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at the first and second penultimate nucleotides starting from the 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at the first and third nucleotides starting from the 3' end of the extension primer. In some embodiments, the method sets the mutation recognition site at the third and second nucleotides starting from the 3' end of the extension primer.

[0006] In some embodiments, the method includes replacing other nucleotides in the extension primer with the modified nucleotides; the other nucleotides are nucleotides at any position other than the mutation recognition site.

[0007] In some embodiments, the other nucleotides are 1 to 3 nucleotides optionally selected within a range of 1 to 5 nucleotides from the mutation recognition site.

[0008] In some embodiments, the modified nucleotide is a nucleotide analogue with an altered phosphodiester-sugar backbone.

[0009] In some embodiments, the modified nucleotide is a locked nucleic acid (LNA) and / or a peptide nucleic acid (PNA).

[0010] In some embodiments, the method further includes providing reaction conditions suitable for performing an amplification reaction to generate an amplification product of the nucleic acid to be detected.

[0011] In some embodiments, the amplification reaction is a cloning reaction, a transcription-based amplification reaction, a polymerase chain reaction (PCR), a ligase chain reaction (LCR), or a strand displacement amplification (SDA) reaction.

[0012] In some embodiments, the method includes providing reaction conditions suitable for performing PCR on the nucleic acid to be detected, and the reaction conditions include an enzyme suitable for performing PCR, deoxynucleoside triphosphates (dNTPs), a buffer suitable for performing PCR, PCR amplification primers, and Mg 2+ .

[0013] On the other hand, the present application provides a method for diagnosing a disease associated with a specific gene mutation by the method described in the present application, wherein the nucleic acid to be detected is derived from a subject in need of diagnosis, and the reference nucleic acid is derived from a subject not suffering from the disease.

[0014] On the other hand, the present application provides a kit for identifying a target nucleotide sequence at one or more specific positions of a nucleic acid to be detected, or identifying that the original nucleotide sequence of the nucleic acid to be detected at one or more specific positions compared to the reference nucleic acid has mutated into the target nucleotide sequence. The kit comprises an extension reaction composition and a composition suitable for nucleic acid mass spectrometry detection; wherein, the extension reaction composition comprises an extension primer, and the extension primer is an oligonucleotide with a mutation recognition site at its 3'-end, wherein the mutation recognition site can be complementary paired with the target nucleotide sequence, but not with the original nucleotide sequence, and the nucleotide at the mutation recognition site is a modified nucleotide, and the modified nucleotide can increase the specificity of the extension primer.

[0015] In certain embodiments, the mutation recognition site is located at any position of the three nucleotides at the extreme end of the 3'-end of the extension primer.

[0016] In certain embodiments, one or more nucleotides at any position other than the mutation recognition site in the extension primer are modified nucleotides.

[0017] In certain embodiments, one to three nucleotides optionally within a range of 1 to 5 nucleotides from the mutation recognition site in the extension primer are modified nucleotides.

[0018] In certain embodiments, the modified nucleotide is a nucleotide analogue with an altered phosphodiester-sugar backbone.

[0019] In certain embodiments, the modified nucleotide is a locked nucleic acid (LNA) and / or a peptide nucleic acid (PNA).

[0020] In certain embodiments, the extension reaction composition further comprises a terminating nucleotide.

[0021] In certain embodiments, the kit further comprises a reaction composition suitable for performing an amplification reaction on the nucleic acid to be detected.

[0022] In certain embodiments, the reaction composition comprises an enzyme suitable for PCR, deoxynucleoside triphosphates (dNTPs), a buffer suitable for PCR, PCR amplification primers, and Mg 2+ .

[0023] In certain embodiments, the composition suitable for nucleic acid mass spectrometry detection comprises a MALDI matrix compound.

[0024] In certain embodiments, the extension reaction composition and the composition suitable for nucleic acid mass spectrometry detection are not mixed with each other.

[0025] In certain embodiments, the extension reaction composition, the composition suitable for nucleic acid mass spectrometry detection, and the reaction composition suitable for amplification reaction are not mixed with each other.

[0026] On the other hand, the present application provides a detection system for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or identifying that the original nucleotide sequence at one or more specific sites of the nucleic acid to be detected mutates into a target nucleotide sequence compared to a reference nucleic acid. The system comprises the kit described in the present application and a device for using the kit.

[0027] In certain embodiments, the device comprises a thermal cycler and / or a mass spectrometer.

[0028] Those skilled in the art can easily insight into other aspects and advantages of the present application from the following detailed description. Only exemplary embodiments of the present application are shown and described in the following detailed description. As those skilled in the art will recognize, the content of the present application enables those skilled in the art to make changes to the disclosed specific embodiments without departing from the spirit and scope of the invention involved in the present application. Accordingly, the descriptions in the drawings and the specification of the present application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The specific features of the invention involved in the present application are shown in the appended claims. The features and advantages of the invention involved in the present application can be better understood by referring to the exemplary embodiments and the drawings described in detail below. A brief description of the drawings is as follows:

[0030] Figure 1 A- Figure 1 E shows the results of detecting KRAS G13D genomic samples at different mutation frequencies (including wild type) by the method described in the present application.

[0031] Figure 2 A- Figure 2 E shows the results of detecting BRAF V600E genomic samples at different mutation frequencies (including wild type) by the method described in the present application.

[0032] Figure 3 A- Figure 3Panel C shows the results of detecting pure mutant, low-frequency mutant, and wild-type BRAF V600E genomic samples by qPCR using the extension primers of the present application.

[0033] Figure 4 Shown are the test results of detecting a sample with a 5% IDH1 R132H mutation frequency using the extension primer IDH1-EXTENSION-1.

[0034] Figure 5 Shown are the test results of detecting a sample with a 0.1% IDH1 R132H mutation frequency using the extension primer IDH1-EXTENSION-1.

[0035] Figure 6 Shown are the test results of detecting a sample with a 0% IDH1 R132H mutation frequency using the extension primer IDH1-EXTENSION-1.

[0036] Figure 7 Shown are the test results of detecting a sample with a 0% IDH1 R132H mutation frequency using the unmodified extension primer IDH1-EXTENSION-2.

[0037] Figure 8 Shown are the test results of detecting a sample with a 5% IDH2 R172K mutation frequency using the extension primer IDH2-EXTENSION-1.

[0038] Figure 9 Shown are the test results of detecting a sample with a 0.1% IDH2 R172K mutation frequency using the extension primer IDH2-EXTENSION-1.

[0039] Figure 10 Shown are the test results of detecting a sample with a 0% IDH2 R172K mutation frequency using the extension primer IDH2-EXTENSION-1.

[0040] Figure 11 Shown are the test results of detecting a sample with a 0% IDH2 R172K mutation frequency using the unmodified extension primer IDH2-EXTENSION-2 Detailed implementation manners

[0041] The following specific embodiments illustrate the implementation manners of the invention of the present application. Those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

[0042] Term definitions

[0043] In the present application, the terms "nucleic acid" and "nucleic acid molecule" or "polynucleotide" are used interchangeably and generally refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a combination thereof and polymers thereof in single-stranded or double-stranded form. The term "nucleic acid" also includes genes, sense or antisense strands of genomic DNA, and synthetic forms and mixed polymers thereof, cDNA, and / or mRNA. For example, a nucleic acid molecule can be synthetic (e.g., chemically synthesized) or recombinant. Unless specifically defined otherwise, the term also includes nucleic acids containing analogs or derivatives of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise stated, a particular nucleic acid sequence also implicitly includes its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, complementary sequences, and the explicitly recited sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced with a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term "nucleic acid" can also be chemically or biochemically modified, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more natural nucleotides with analogs, internucleotide modifications such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, dithiophosphates, etc.), flanking moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylating agents, and modified linkages (e.g., α-anomeric nucleic acids, etc.). The above terms are also intended to include any topological conformation, including single-stranded, double-stranded, partially double-helical, triple-helical, hairpin, circular, and padlock conformations.

[0044] In the present application, the term "nucleotide" generally includes natural and unnatural nucleotides. Nucleotides include, but are not limited to, naturally occurring nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates; deoxyadenosine monophosphate, deoxyadenosine diphosphate, and deoxyadenosine triphosphate; deoxyguanosine monophosphate, deoxyguanosine diphosphate, and deoxyguanosine triphosphate; deoxythymidine monophosphate, deoxythymidine diphosphate, and deoxythymidine triphosphate; deoxycytidine monophosphate, deoxycytidine diphosphate, and deoxycytidine triphosphate; deoxyuridine monophosphate, deoxyuridine diphosphate, and deoxyuridine triphosphate; and deoxyinosine monophosphate, deoxyinosine diphosphate, and deoxyinosine triphosphate (referred to herein as dA, dG, dT, dC, dU, and dI, respectively, or A, G, T, C, U, and I). Nucleotides also include, but are not limited to, modified nucleotides and nucleotide analogs. Modified nucleotides and nucleotide analogs include, but are not limited to, dideoxynucleotides, acyclic nucleotides, deazapurine nucleotides, such as 7-deaza-deoxyguanosine (7-deaza-dG) monophosphate, diphosphate, and triphosphate, and 7-deaza-deoxyadenosine (7-deaza-dA) monophosphate, diphosphate, and triphosphate, deuterium-deoxythymidine (deuterium-dT) monophosphate, diphosphate, and triphosphate, methylated nucleotides, such as 5-methyl deoxycytidine triphosphate, 13C / 15N-labeled nucleotides, and deoxyinosine monophosphate, diphosphate, and triphosphate. Modified nucleotides, isotope-enriched nucleotides, depleted nucleotides, labeled and tagged nucleotides, and nucleotide analogs can be obtained using various combinations of functional groups and attachment positions.

[0045] In the present application, the terms "nucleic acid to be detected" and "target nucleic acid" are used interchangeably and generally refer to any nucleic acid including the sequence to be detected, which can be DNA or RNA. The nucleic acid to be detected can be of any origin, such as genomic DNA, mRNA, cDNA, cfDNA, ctDNA, etc. The nucleic acid to be detected can be naturally occurring or synthetic (such as amplification products, vectors, etc.). The nucleic acid to be detected can be, but does not need to be, purified or isolated. Depending on the nature of the assay desired, the nucleic acid to be detected can be from plant or animal tissues, or taken from a reaction mixture. There is no limit to the length of the nucleic acid to be detected, although it can be exposed to restriction endonucleases before being detected or identified by the methods of the present application. In some embodiments of the present application, the nucleic acid to be detected can be from any source, such as a biological specimen or an environmental source. Biological specimens include any tissue or material obtained from a living or dead organism, which may contain an analyte or the nucleic acid to be detected in or obtained from the analyte. Examples of biological samples include respiratory tissue, exudates (e.g., bronchoalveolar lavage fluid), biopsy specimens, sputum, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, feces, urine, cerebrospinal fluid, tissue fluid (e.g., pleural and ascitic fluid), lavage fluid (e.g., alveolar) or other fluids, tissues or materials. Examples of environmental source samples include water, ice, soil, suspension, residue, biofilm, airborne dust particles, and aerosols. The sample can be a processed specimen or material, such as obtained by treating the sample using filtration, centrifugation, precipitation, or adsorption to a medium (e.g., a substrate or a carrier). Other treatments of the sample can include physically or mechanically disrupting tissues, cell aggregates, or cells to release intracellular components including nucleic acids into a solution that may contain other components such as enzymes, buffers, salts, detergents, etc. The sample can also include tissues, such as biopsy tissues (e.g., tissues for liquid biopsy), formalin-fixed and paraffin-embedded (FFPE) tissues, etc.

[0046] In the present application, the terms "oligonucleotide" and "oligomer" are used interchangeably and generally refer to a nucleic acid polymer generally composed of less than 1000 nucleotides (nt), including polymers with a length of about 2 nt to about 900 nt. For example, the oligonucleotide can contain 5 nt to 500 nt, such as can contain 10 nt to 150 nt. For example, the oligonucleotide can be prepared by synthesis using any known in vitro chemical or enzymatic method and can be purified after synthesis using standard methods, including, for example, high performance liquid chromatography (HPLC). In the present application, representative oligonucleotides include, for example, primers, promoters, detection probe oligonucleotides, target capture oligonucleotides, etc.

[0047] In the present application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Mutations in DNA can alter codons, resulting in changes in the amino acid sequence. DNA mutations can include substitutions, deletions, insertions, alternative splicing, or truncations. Amino acid changes can include substitutions, deletions, insertions, additions, truncations, or errors in protein processing or cleavage. Alternatively, mutations in the nucleotide sequence can result in silent mutations in the amino acid sequence, as is well understood in the art.

[0048] In the present application, the term "complementary pairing" generally refers to the ability of purine and pyrimidine nucleotides to bind through hydrogen bonds to form a double-stranded nucleic acid molecule. The following base pairs are related by complementarity: guanine (G) and cytosine (C); adenine (A) and thymine (T); adenine (A) and uracil (U). The complementary pairing relationship involved herein can be applied to the entire length of a nucleic acid molecule, meaning that substantially all base pairs of two single-stranded nucleic acid molecules are "fully complementary"; it can also refer to one of the two single-stranded nucleic acid molecules being shorter in length than the other, such that a portion of one of the molecules remains single-stranded and the other portions of the two molecules form a relationship of "partial complementarity" in base pairing.

[0049] In the present application, the term "hybridization" or "specific hybridization" refers to the association between two single-stranded nucleic acid molecules having sufficient complementary sequences to allow such hybridization under the predetermined conditions commonly used in the art (sometimes referred to as "substantially complementary"). Specifically, the term refers to the hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the present invention, substantially excluding the hybridization of the oligonucleotide with a non-complementary single-stranded nucleic acid. As used herein, the term "hybridization" is used to refer to any method for complementary pairing of nucleic acids by which one strand of a nucleic acid is joined to a complementary strand by base pairing to form a hybridization complex. The hybridization and the strength of hybridization (i.e., the strength of the association between nucleic acids) are affected by such factors as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, the T m (melting temperature, which is the temperature at which a population of double-stranded nucleic acid molecules becomes half-dissociated into single strands) and the G:C ratio within the nucleic acid.

[0050] In the present application, the term "position", when used in the context of nucleic acids, generally refers to a defined site on the nucleic acid. Such a position can be occupied by a nucleotide, for example.

[0051] In the present application, the term "locked nucleic acid (LNA)" generally refers to a synthetic nucleotide analogue containing a bridged, bicyclic sugar moiety. Exemplary LNAs are described in U.S. Patent No. 6,268,490, U.S. Patent No. 6,316,198, U.S. Patent No. 6,403,566, U.S. Patent No. 6,770,748, U.S. Patent No. 6,998,484, U.S. Patent No. 6,670,461, and U.S. Patent No. 7,034,133, which are incorporated herein by reference in their entirety. LNA is a modified nucleotide and ribonucleotide with a "locked" structure resulting from an additional bridge bond between the 2'-O- and 4'-C- of the ribose moiety, and / or a bicyclic structure. In some embodiments, the oligonucleotides provided in the present application contain one or more LNAs having the structure shown in Structure A below. Alternatively, the oligonucleotides provided in the present application may contain one or more LNAs having the structure shown in Structure B below. Still alternatively, the oligonucleotides provided in the present application contain one or more LNAs having the structure shown in Structure C below. Other suitable locked nucleic acids that can be incorporated into the oligonucleotides of the present invention include those described in U.S. Patent No. 6,403,566 and U.S. Patent No. 6,833,361, both of which are incorporated herein by reference in their entirety. In an exemplary embodiment, the locked nucleic acid has a 2'- to 4'-methylene bridge, such as shown in Structural Formula A. In other embodiments, the locked nucleic acid has a bridge containing a vinyl group, which may or may not contain an ether bond at the 2'-position.

[0052]

[0053] In the present application, the term "peptide nucleic acid (PNA)" generally refers to a class of nucleotide analogs in which the deoxyribose phosphate backbone is replaced with a pseudopeptide backbone while retaining only the four natural nucleobases. For example, it can be a nucleotide in which the phosphate backbone is replaced with a polyamide structure based on N-aminoethylglycine. The neutral backbone of PNA permits specific hybridization with DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be carried out using standard solid-phase peptide synthesis protocols (as described in, for example, Hyrup et al., 1996; Perry-O'Keefe et al., 1996, Proc. Natl. Acad. Sci. USA, 93:14670-14675). PNA has a higher affinity for complementary nucleic acids than its natural counterparts that follow the Watson-Crick base pairing rules. PNA can form highly stable triple helix structures of DNA with the following stoichiometry: (PNA)2.DNA. Although peptide nucleic acids and polyamides are not limited to any specific length, the preferred length of peptide nucleic acids and polyamides is 200 nucleotides or less, more preferably 100 nucleotides or less, and most preferably 5 to 50 nucleotides in length. Although not intended to limit the length of the nucleotide sequences to which peptide nucleic acids and polyamides specifically bind in one embodiment, the nucleotide sequences to which peptide nucleic acids and polyamides specifically bind are 1 to 100, more preferably 5 to 50, even more preferably 5 to 25, and most preferably 5 to 20 nucleotides.

[0054] In the present application, the term "amplification" generally refers to a process or reaction that produces additional copies of a nucleic acid sequence. A commonly used example is the polymerase chain reaction (PCR) technique well known in the art (Dieffenbach C.W. and G.S.Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.). As used herein, the term "polymerase chain reaction (PCR)" refers to the methods of U.S. Patent Nos. 4,683,195 and 4,683,202 to K.B. Mullis, which are hereby incorporated by reference, and which describe methods for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. The length of the amplified segment of the desired target sequence is determined by the relative positions of two oligonucleotide primers relative to each other, and thus this length is a controllable parameter. By repetition of the method, the method is referred to as "polymerase chain reaction" (hereinafter "PCR"). Because the desired amplified segment of the target sequence becomes the major sequence (in terms of concentration) in the mixture, these products are referred to as "PCR amplified". In some embodiments, it is possible using PCR to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methods (e.g., hybridization with a labeled probe; incorporation of a biotinylated primer followed by detection with an avidin-enzyme conjugate; incorporation of 32 a P-labeled deoxynucleoside triphosphate such as dCTP or dATP into the amplified segment). In addition to genomic DNA, any oligonucleotide sequence can be amplified with an appropriate set of primer molecules. Specifically, the amplified segments produced by the PCR method itself are effective templates for subsequent PCR amplification.

[0055] In the present application, a non-limiting example of the term "transcription-based amplification reaction" can be "reverse transcription polymerase chain reaction" or "RT-PCR", which generally refers to a method for reverse transcribing RNA sequences to produce a mixture of cDNA sequences, followed by increasing the concentration of the desired segments of the transcribed cDNA sequences in the mixture without cloning or purification. Typically, a single primer (e.g., an oligo-dT primer) is used to reverse transcribe the RNA before PCR amplification of the desired segments of the transcribed DNA using two primers.

[0056] In the present application, the term "primer" generally refers to an oligonucleotide that exists either naturally as a purified restriction digest or is synthetically produced, and that can act as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (i.e., in the presence of nucleotides and an inducer such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded to obtain maximum amplification efficiency, but alternatively can be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare the extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be long enough to prime the synthesis of the extension product in the presence of an inducer. The exact length of the primer will depend on many factors, including temperature, primer source, and method of use.

[0057] In the present application, the term "terminating nucleotide" can be used interchangeably with "chain terminator reagent" or "chain terminator", and generally refers to a molecule that causes an extension reaction to stop when added to the extension reaction. Chain terminators can include nucleotide analogs that prevent further extension of a chain or oligonucleotide when present in a polynucleotide chain or oligonucleotide. In certain embodiments, the terminating nucleotide is a nucleotide; in certain embodiments, the terminating nucleotide is a modified nucleotide that will not allow further incorporation of nucleotides when incorporated at the 3'-end of a nucleic acid molecule (e.g., oligonucleotide) in an extension reaction. In certain embodiments, the terminating nucleotide is not removed from the oligonucleotide or polynucleotide chain in the presence of an enzyme having 3'-5' exonuclease activity. In certain embodiments, the 3'-OH of the nucleotide pentose can be replaced by a moiety that produces a chain-terminating nucleotide and that is also resistant to removal by an enzyme having 3'-5' exonuclease activity. In certain embodiments, the pentose 3'-position of the modified terminating nucleotide is modified to replace the OH with another moiety, including but not limited to, a phosphoryl group, an acetyl group, 3'-O-methyl, 3'-O-(2-nitrobenzyl), 3'-O-allyl, 3'-azido, and 3'-amino. In certain embodiments, the 3'-OH group is replaced by hydrogen. In certain embodiments, the modified nucleotide is a dideoxynucleotide. In certain embodiments, the modified nucleotide is an acyclic nucleotide. Examples of terminating nucleotides include: dideoxynucleotides such as ddA (dideoxyadenine), ddT (dideoxythymine), ddC (dideoxycytosine), ddG (dideoxyguanine), and ddU (dideoxyuracil) and acyclic nucleotides such as acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP.

[0058] In the present application, the term "matrix compound" generally refers to a matrix material used in a form of mass spectrometry (e.g., MALDI mass spectrometry) analysis, which functions to separate analyte molecules (e.g., in the present application, the analyte is a nucleic acid sample) from each other, transfer the energy absorbed from the ion source of the mass spectrometry to the analyte molecules, so as to desorb and ionize them. Once the analyte is ionized, a mass analysis device known in the art can be used to measure the ion mass. The selection of the matrix material for mass spectrometry analysis generally depends on the type of biomolecule being analyzed. For example, when analyzing a nucleic acid sample by mass spectrometry, a commonly used matrix material can be a mixture of 3-hydroxypicolinic acid (3-HPA) and diammonium citrate (DAC). For example, another matrix material for promoting the ionization of sample analytes is 2,5-dihydroxybenzoic acid (DHB).

[0059] In the present application, the term "subject" generally refers to a human or non-human animal (including mammals) in need of diagnosis, prognosis, improvement, prevention, and / or treatment of a disease. In some embodiments, the subject is a human or non-human mammal. The non-human mammal can include any mammalian species other than humans, such as domestic animals (e.g., cows, pigs, sheep, chickens, rabbits, or horses), or rodents (e.g., rats and mice), or primates (e.g., gorillas and monkeys), or domestic pets (e.g., dogs and cats). The "subject" can be male or female and can be of different age stages. A human "subject" can be Caucasian, African, Asian, Semitic, or of other ethnicities, or a hybrid of various ethnicities. A human "subject" can be elderly, adult, adolescent, child, or infant. As used herein, when referring to a sample (such as a nucleic acid sample) derived from a subject, it can include all biological fluids, excretions, and tissues isolated from any given subject, especially a human. In the context of the present invention application, such samples include, but are not limited to, blood, blood serum, blood plasma, nipple aspirate, urine, sperm, semen, seminal plasma, prostatic fluid, excrement, tears, saliva, sweat, biopsy, ascites, cerebrospinal fluid, milk, lymph fluid, bronchial and other lavage samples, or tissue extraction samples. Preferably, the subject is an animal (including a human), more preferably a mammal, and even more preferably a human.

[0060] In the present application, the terms "comprising" and "including" are used interchangeably and generally mean including the expressly specified features but not excluding other elements. Detailed Description of the Invention

[0062] On the one hand, the present application provides a detection method for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or for identifying that the original nucleotide sequence of the nucleic acid to be detected at one or more specific sites compared to a reference nucleic acid has mutated into a target nucleotide sequence. The method includes: 1) providing an extension primer, which is an oligonucleotide with a mutation recognition site at the 3'-end, wherein the mutation recognition site can be complementary paired with the target nucleotide sequence, but not with the original nucleotide sequence, and the nucleotides at the mutation recognition site are modified nucleotides, and the modified nucleotides can increase the specificity of the extension primer; 2) hybridizing the extension primer with the nucleic acid to be detected or its amplification product to form an extension product; 3) using nucleic acid mass spectrometry to analyze the extension product in 2) to identify the presence of the target nucleotide sequence.

[0063] On the other hand, the present application provides a method for diagnosing a disease related to a specific gene mutation by the method of the present application, wherein the nucleic acid to be detected is derived from a subject in need of diagnosis, and the reference nucleic acid is derived from a subject not suffering from the disease.

[0064] On the other hand, the present application provides a kit for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or for identifying that the original nucleotide sequence of the nucleic acid to be detected at one or more specific sites compared to a reference nucleic acid has mutated into a target nucleotide sequence. The kit contains an extension reaction composition and a composition suitable for nucleic acid mass spectrometry detection; wherein, the extension reaction composition contains an extension primer, which is an oligonucleotide with a mutation recognition site at the 3'-end, wherein the mutation recognition site can be complementary paired with the target nucleotide sequence, but not with the original nucleotide sequence, and the nucleotides at the mutation recognition site are modified nucleotides, and the modified nucleotides can increase the specificity of the extension primer.

[0065] On the other hand, the present application provides a detection system for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or for identifying that the original nucleotide sequence of the nucleic acid to be detected at one or more specific sites compared to a reference nucleic acid has mutated into a target nucleotide sequence. The system contains the kit of the present application and a device for using the kit.

[0066] Nucleic acid sample to be detected

[0067] The method and products (such as kits, systems, etc.) of the present application can be used to identify one or more target nucleotide sequences in a nucleic acid sample to be detected.

[0068] In the present application, the identified nucleic acid can be an oligonucleotide or a polynucleotide, including but not limited to natural nucleic acids (e.g., deoxyribonucleic acid (DNA), ribonucleic acid (RNA)), synthetic nucleic acids, unnatural nucleic acids (e.g., peptide nucleic acid (PNA)), unmodified nucleic acids, modified nucleic acids (e.g., methylated DNA, labeled nucleic acids, nucleic acid molecules having one or more modified nucleotides), etc. In the present application, "polynucleotide" refers to two or more nucleotides or nucleotide analogs covalently linked. The nucleic acid can be any type of nucleic acid suitable for the methods described in the present application. For example, the nucleic acid can be DNA (e.g., complementary DNA (cDNA), genomic DNA (gDNA), cfDNA, ctDNA, plasmid and vector DNA, etc.), or a nucleic acid analog (e.g., containing base analogs, sugar analogs, and / or unnatural backbones, etc.). The nucleic acid can be in any form that can be used for the methods described in the present application (e.g., linear, circular, supercoiled, single-stranded, double-stranded, etc.). For example, the nucleic acid can be or can be derived from, a plasmid, a phage, an autonomously replicating sequence (ARS), a centromere, an artificial chromosome, a chromosome, a cell, a cell nucleus, or the cytoplasm of a cell. In certain cases, the nucleic acid can be from a single chromosome (e.g., the nucleic acid sample can be from one chromosome of a sample obtained from a diploid organism). In the case of fetal nucleic acids, the nucleic acid can be from a paternal allele, a maternal allele, or both a maternal and a paternal allele. For example, the nucleic acid described in the present application can be cell-free DNA, such as cfDNA in a tissue or sample, such as ctDNA from a tumor or cancerous tissue / site).

[0069] In the present application, the target nucleic acid molecule to be detected or identified can be of any length. For example, it can contain at least 1 (e.g., it can contain at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100) nucleotides.

[0070] In the present application, the target nucleic acid molecule to be detected or identified may contain one or more modifications. For example, it may contain one or more methyl groups or methylation states, one or more phosphate groups, one or more acetyl groups, and one or more deletions, additions, or substitutions of one or more nucleotides. Examples of one or more deletions, additions, or substitutions of one or more nucleotides include, but are not limited to, the presence or absence of a specific mutation, the presence or absence of a nucleotide substitution (e.g., single nucleotide polymorphism (SNP)), the presence or absence of a repeat sequence (e.g., dinucleotide, trinucleotide, tetranucleotide, pentanucleotide repeat), the presence or absence of a marker (e.g., microsatellite), and the presence or absence of a differentiating sequence (e.g., a sequence that differentiates one organism from another (e.g., a sequence that differentiates one virus strain from another virus strain)). Different nucleic acids of the target nucleic acid and different target nucleic acids can be distinguished by any known means, for example, as described in the present application, by mass, binding, distinguishable tags, etc.

[0071] In certain embodiments, variants of the target nucleic acid may be present in the sample at approximately equal (e.g., SNP) frequencies or copy numbers. In certain embodiments, variants of the target nucleic acid may be present in the sample at different frequencies or copy numbers. In certain embodiments, one variant may be present at a greater abundance than other variants. In certain embodiments, the variant with a greater abundance is referred to as the wild type, while the variant with a lower abundance is referred to as the mutant. In certain cases, the target nucleic acid contains a first and a second variant, where the first or the second variant exhibits a greater abundance than other variants, i.e., a high-abundance variant and a low-abundance variant or a major variant and a minor variant. When compared to another variant, the variant that exhibits a greater abundance is typically present at a higher concentration or represented by a higher number of molecules (e.g., copies). The higher concentration can be 2-fold or more. In certain embodiments, the higher concentration is 10-fold or more. In certain embodiments, the higher concentration is 100-fold, 1000-fold, or 10000-fold or more. In certain embodiments, one variant represents the wild-type sequence and the concentration is 100-fold or more higher than another variant. In certain embodiments, the concentration of the variant (low-abundance variant) is significantly lower than that of another variant (e.g., wild type, high-abundance variant).

[0072] In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for less than 30%, 20%, 15%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.8%, 0.75%, 0.5%, 0.1%, 0.05%, 0.01% or less of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 1% - about 10% of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 5% or less of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 5% - 0.75% of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 5% - about 0.1% of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 1% or less of the total nucleic acids in a sample. In certain embodiments, the methods of the present application can be used to detect the presence or absence of low-abundance target nucleic acids (e.g., cfDNA or ctDNA) that account for about 0.1% - about 0.001% of the total nucleic acids in a sample.

[0073] For example, the content of the target nucleic acid (e.g., DNA, such as cfDNA, ctDNA, etc.) in the sample can be less than about 100 ng (e.g., less than about 90 ng, less than about 80 ng, less than about 70 ng, less than about 60 ng, less than about 50 ng, less than about 40 ng, less than about 30 ng, less than about 20 ng, less than about 15 ng, less than about 10 ng, less than about 9 ng, less than about 8 ng, less than about 7 ng, less than about 6 ng, less than about 5 ng, less than about 4 ng, less than about 3 ng, less than about 2 ng, less than about 1 ng, less than about 0.9 ng, less than about 0.8 ng, less than about 0.7 ng, less than about 0.6 ng, less than about 0.5 ng, less than about 0.45 ng, less than about 0.4 ng, less than about 0.35 ng, less than about 0.3 ng, less than about 0.2 ng or lower).

[0074] For example, the content of the target nucleic acid (e.g., DNA such as cfDNA, ctDNA, etc.) in the sample can be about 20% or less, such as about 15% or less, about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, about 1% or less, about 0.9% or less, about 0.8% or less, about 0.7% or less, about 0.6% or less, about 0.5% or less, about 0.4% or less, about 0.3% or less, about 0.2% or less, about 0.1% or less, about 0.05% or less, about 0.04% or less, about 0.03% or less, about 0.02% or less, about 0.01% or less or lower. The percentage can be mass percentage, volume percentage, and / or molar percentage.

[0075] For example, the sample can contain a mixture of one or more target nucleic acids (each target nucleic acid can have low-abundance and high-abundance variants), or a mixture can be formed by combining more than one sample containing one or more target nucleic acids (each target nucleic acid can have low-abundance and high-abundance variants). The low-abundance variant can be a variant of the high-abundance variant and can include, but is not limited to, mutants of wild-type (high-abundance variant) alleles (low-abundance variants), variants of genes present in more than one host (e.g., viral oncogenes (low-abundance genes), which are variants of normal healthy genes (high-abundance variants)), polymorphisms, including single nucleotide polymorphisms (SNPs), insertions, deletions, or other mutant forms of high-abundance variants.

[0076] The method of the present application can be used to simultaneously identify multiple target nucleic acids that may be present in a sample. The multiple target nucleic acids may refer to more than one target nucleic acid. For example, the multiple target nucleic acids may be about 2 to about 10,000 target nucleic acids, about 2 to about 1,000 nucleic acids, about 2 to about 500 nucleic acids, or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000 or 10,000 target nucleic acids. In certain embodiments, the multiple target nucleic acids are located in one or more reaction vessels, and each reaction vessel may contain more than one target nucleic acid. In certain embodiments, the multiple target nucleic acids are all located in the same reaction vessel. In certain embodiments, the multiple target nucleic acids are about 2 to about 200 target nucleic acids. In certain embodiments, the about 2 to about 200 target nucleic acids are located in a single reaction vessel.

[0077] For example, the nucleic acid detection or identification provided by the method of the present application can detect the presence or methylation status of methylation at one or more sites (e.g., about 2 to about 10,000 sites, about 2 to about 1,000 sites, about 2 to about 500 sites, or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000 or 10,000 sites, which may include different sites of the same nucleic acid molecule or the same sites in different nucleic acid molecules) in DNA (especially cfDNA, such as ctDNA).

[0078] In the present application, a sample containing nucleic acids (e.g., target nucleic acids) can be derived from one or more sources and can contain a mixture of target nucleic acids, each of which can have one or more high-abundance variants and low-abundance variants with different copy numbers. Samples can also be combined to generate a mixture comprising different target nucleic acids, which can have different abundances and / or different copy numbers.

[0079] For example, samples of the present application can be collected from organisms, minerals, or geological sites (e.g., soil, rock, ore deposit, fossil) or forensic sites (e.g., crime scene, contraband or suspected contraband). Thus, the source can be environmental, such as geological, agricultural, battlefield, or soil source. The source can also be any type of organism, such as any plant, fungus, protozoan, prokaryote, virus, or animal, including but not limited to: human, non-human, mammal, reptile, cattle, cat, dog, goat, pig, monkey, ape, orangutan, bull, cow, bear, horse, sheep, poultry, mouse, rat, fish, dolphin, whale, and shark, etc., or any animal or organism having detectable nucleic acids. The source can also refer to different parts of an organism, such as internal, external, living or dead cells, tissues, fluids, etc. Thus, a sample can be a "biological sample", which can be any material obtained from a living or once-living source, such as an animal like a human or other mammal, plant, bacterium, fungus, protist, or virus. The source can be in any form, including but not limited to, solid materials such as tissues, cells, cell aggregates, cell extracts, or biopsy samples, or biological fluids such as urine, blood, saliva, amniotic fluid, exudate from an infected or inflamed area, or mouthwash containing oral cells, hair, cerebrospinal fluid, and synovial fluid, as well as organs. For example, examples of samples (such as biological samples) can include respiratory tissue, exudate (e.g., bronchoalveolar lavage fluid), biopsy specimens, sputum, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, feces, urine, cerebrospinal fluid, tissue fluid (e.g., pleural effusion and ascites), lavage fluid (e.g., alveolar), or other fluids, tissues, or materials. For example, a sample can be a processed specimen or material, such as obtained by processing the sample using filtration, centrifugation, precipitation, or adsorption to a medium (e.g., substrate or carrier). Other processing of the sample can include physically or mechanically disrupting tissues, cell aggregates, or cells to release intracellular components including nucleic acids into a solution that can contain other components such as enzymes, buffers, salts, detergents, and the like. The sample can also include tissues, such as biopsy tissues (e.g., tissues for liquid biopsy), formalin-fixed and paraffin-embedded (FFPE) tissues, etc.

[0080] The sample can also be obtained at a different time point from another sample, and each sample can be from the same or different sources. The nucleic acid can be from a nucleic acid library, such as a DNA library. The nucleic acid can be a product of nucleic acid purification or isolation and / or amplification of nucleic acid molecules in the sample. The nucleic acid for sequencing analysis provided in the present application can contain nucleic acids from one or from two or more samples (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 or more samples).

[0081] Among, before or after the methods provided in the present application, the nucleic acid can be processed in various ways. For example, the length or mass of the nucleic acid can be reduced (e.g., by shearing, nuclease or restriction enzyme digestion, dephosphorylation, demethylation), the size or mass of the nucleic acid can be increased (e.g., by phosphorylation, reaction with methylation-specific reagents, ligation with detectable markers, etc.), and it can be treated with nucleic acid cleavage inhibitors, etc.

[0082] In certain embodiments, untreated nucleic acid is provided for analysis according to the methods described in the present application. In certain embodiments, processed nucleic acid is provided for implementing the methods described in the present application. For example, nucleic acid can be extracted, isolated, purified or amplified from a sample. For example, the nucleic acid can be taken out of its original environment (e.g., the natural environment where nucleic acid is naturally produced or the host cell where nucleic acid is exogenously expressed), so the nucleic acid is changed by "artificial" operations from its original environment. Compared with the component content in the sample from which it is derived, the isolated nucleic acid generally carries fewer non-nucleic acid components (e.g., proteins, lipids, etc.). The composition containing the isolated nucleic acid can be substantially isolated (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% free of non-nucleic acid components). In the present application, the purified nucleic acid refers to the provided nucleic acid that contains fewer non-nucleic acid components compared with the sample source from which it is derived. The composition containing nucleic acid can be substantially purified (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater than 99% free of other nucleic acids).

[0083] Amplification reaction

[0084] In the method of the present application, the nucleic acid sample to be detected (target nucleic acid) can be subjected to an amplification reaction treatment to generate an amplification product of the nucleic acid to be detected. For example, the amplification reaction is an exponential amplification reaction, which generally refers to an amplification process in which the amount of target nucleic acid grows geometrically in the reaction.

[0085] In the exponential amplification, an amplification composition (e.g., exponential amplification composition) can be used, and the components thereof can include, but are not limited to: nucleotides (e.g., nucleoside triphosphates), modified nucleotides, oligonucleotides (e.g., primer oligonucleotides for polymerase-based amplification and oligonucleotide building blocks for ligase-based amplification), one or more salts (e.g., magnesium-containing salts), one or more buffers, one or more polymerizing agents (e.g., ligase and / or polymerase), one or more nicking enzymes (e.g., enzymes that cleave one strand of double-stranded nucleic acid), and one or more nucleases (e.g., exonuclease, endonuclease, RNase). Any polymerase suitable for amplification can be used, such as a polymerase with or without exonuclease activity, DNA polymerase, RNA polymerase, and mutant forms of these enzymes. Any ligase capable of ligating the 5'-end of one oligonucleotide to the 3'-end of another oligonucleotide can be used. The amplification conditions can also include certain reaction conditions, such as isothermal or temperature cycling conditions. Methods of cycling temperature in amplification methods are known, such as through a thermal cycler device. The term "cycling" generally refers to amplification (e.g., amplification reaction or extension reaction) using single or multiple primers with temperature cycling. In some embodiments, the amplification conditions can also include an emulsifier (e.g., oil) that is used to form multiple reaction compartments in which a single nucleic acid molecule species can be amplified.

[0086] For example, the exponential amplification reaction is a reaction carried out under conditions that allow exponential amplification of nucleic acid molecules in the sample or system. For example, the linear amplification product can be contacted with an amplification composition (e.g., exponential amplification composition) so that exponential amplification of the nucleic acid can occur under suitable conditions. The exponential amplification composition typically contains one or more components that are minimally present or lacking in the linear amplification reaction conditions and are required for exponential amplification. For example, the exponential amplification composition can contain one or more of the following components or conditions: amplification oligonucleotides, reverse transcriptase, polymerase, nuclease, phosphorylase, enzyme cofactors, chelating agents, ribonucleoside triphosphates (rNTPs), deoxynucleoside triphosphates (dNTPs), Mg 2+ 2+, optimal pH, optimal temperature, salts, and combinations thereof. The polymerase is typically selected from RNA-dependent DNA polymerases, DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, and combinations thereof. In certain embodiments, the exponential amplification composition contains reverse transcriptase and DNA polymerase.

[0087] In some cases, the exponential amplification includes polymerase chain reaction (PCR). For example, PCR generates one DNA strand for each original target strand and for each synthesized strand present. Similarly, transcription-related amplification generates multiple RNA transcripts for each original target strand and for each subsequently synthesized strand. This amplification is exponential because the synthesized strands are used as templates in subsequent rounds of amplification. In some cases, the exponential amplification reaction is an RT-PCR reaction, such as a one-step RT-PCR reaction or a two-step RT-PCR reaction. For example, reverse transcription can provide a cDNA template for PCR amplification and downstream experiments, and the selected reverse transcriptase can have the highest efficiency for all samples, including difficult-to-transcribe RNA samples such as degraded, inhibitor-residual, or highly secondary-structured RNA samples. The one-step RT-PCR can include combining first-strand cDNA synthesis (RT) and subsequent PCR reaction in a single reaction (e.g., in a single reaction tube). The two-step RT-PCR can include two independent reactions. For example, first-strand cDNA synthesis (RT) can be carried out first, and then the cDNA obtained in the first step is amplified by PCR.

[0088] In some cases, the exponential amplification is non-target-specific amplification that does not target a specific target. For example, the obtained amplification products can have different nucleic acid sequences from each other (e.g., because they are amplified separately based on different template sequences). In specific amplification, the amplified products often have the same sequence as the template sequence. For example, by using universal primers, the exponential amplification can amplify substantially all nucleic acid molecules (e.g., nucleic acid molecules with different sequences) present in a sample or system in a similar ratio or multiple. In some embodiments, the exponential amplification basically does not use specific amplification primers targeting a specific target or a specific target sequence. For example, it will not specifically amplify only some specific nucleic acid molecules or gene fragments present in a sample or reaction system, while basically not amplifying or amplifying at a significantly lower ratio some other nucleic acid molecules or gene fragments present in the sample or reaction system.

[0089] However, the exponential amplification can also be sequence-specific, that is, it can be exponential amplification targeting sequences common to multiple molecules or multiple types of molecules in a sample.

[0090] Thus, in some embodiments, polymerase-based amplification is achieved by using universal primers. In such methods, a hybridization region that hybridizes to one or more universal primers is introduced into the template nucleic acid. For example, such hybridization reagents can incorporate 1) primers that hybridize to and are extended from the target nucleic acid, 2) oligonucleotides that ligate to (e.g., using a ligase) the target nucleic acid or the product of 1), and / or 3) primers having a universal sequence engineered at the 5' end of a gene-specific sequence. Amplification methods using universal primers can provide advantages such as the ability to amplify multiple target nucleic acids using only one or two amplification primers (also referred to herein as "non-target-specific amplification that is not specific to a particular target").

[0091] In some embodiments, the exponential amplification includes repeating multiple temperature cycles to amplify the amount of the target nucleic acid. In some embodiments, the amplification reaction is cycled 2 or more times. In some embodiments, the amplification reaction is cycled 10 or more times. In some embodiments, the amplification reaction is cycled about 10, 15, 20, 50, 100, 200, 300, or more times. In some embodiments, the amplification reaction is cycled 20 to 50 times. In some embodiments, the amplification reaction is cycled 30 to 45 times.

[0092] In the methods of the present application, a strand of a single-stranded nucleic acid target can be amplified (e.g., the exponential amplification can be performed using an RNA molecule as a template), and one or both strands of a double-stranded nucleic acid target can be amplified. In some embodiments, the amplification product (amplification product) is about 10 to about 10,000 nucleotides in length, such as about 10 to about 1,000 nucleotides in length, about 10 to about 500 nucleotides in length, about 10 to about 100 nucleotides in length, and sometimes about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, or 1,000 nucleotides in length.

[0093] Extension reaction

[0094] In the methods of the present application, the amplification product of the target nucleic acid can be contacted with an extension primer provided herein under extension conditions that include a terminating nucleotide, thereby generating an extended oligonucleotide (extension product). The extension reaction of the present application can be a single-base extension reaction. For example, the extension reaction terminates after only one base of the extension primer has been extended (e.g., single-base extension using a terminating nucleotide).

[0095] In the primer extension reaction of the present application, a nucleic acid polymerase can add one or more nucleotides to the 3'-end of a primer (e.g., the oligonucleotide provided in the present application) in a template-specific manner.

[0096] Conditions suitable for primer extension reactions are known in the art. Generally, a primer is annealed (i.e., hybridized) to a target nucleic acid to form a primer-template complex. The primer-template complex is contacted with a DNA polymerase and one or more free nucleotides under suitable conditions to allow the addition of one or more nucleotides to the 3'-end of the primer. In certain embodiments, the primer does not directly hybridize to the nucleic acid site to be detected (e.g., the target site, such as the mutation recognition site of the present application), but hybridizes to an adjacent position of this position (e.g., the 5'-end of this position). In some embodiments, the primer directly hybridizes to an adjacent region of the target site. In some embodiments, terminating nucleotides can be used in the primer extension reaction to terminate primer extension.

[0097] In the present application, a "hybridization site" refers to a specific site on a target nucleic acid (e.g., a nucleic acid molecule to be detected in a sample) or its amplification product. In certain embodiments, the end of the oligonucleotide is adjacent to or substantially adjacent to a site on the amplification product or target nucleic acid that has a different sequence from another amplification product or target nucleic acid sequence. The oligonucleotide end is "adjacent" to the site when there are no nucleotides between the site and the oligonucleotide end. In certain embodiments, when there are 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides between the site and the oligonucleotide end, the oligonucleotide end is "substantially adjacent" to the site.

[0098] The extension reaction is typically carried out under extension conditions. The extension conditions can include but are not limited to: one or more oligonucleotides, extension nucleotides (e.g., nucleotide triphosphates (dNTPs)), terminating nucleotides (e.g., one or more dideoxynucleotide triphosphates (ddNTPs) or acyclic nucleotides), one or more salts (e.g., magnesium-containing salts), one or more buffers (e.g., containing β-NAD, Triton X-100), and one or more polymerases (e.g., DNA polymerase, RNA polymerase).

[0099] Any suitable extension reaction can be selected and used. For example, an extension reaction can be used to distinguish SNP alleles or specific mutation sites by incorporating deoxynucleotides and / or terminating nucleotides (e.g., dideoxynucleotides, acyclic nucleotides) into an extension oligonucleotide that hybridizes to a region adjacent to a specific site in the target nucleic acid. The primer is typically extended by a polymerase. In some embodiments, the oligonucleotide is extended by only one deoxynucleotide or terminating nucleotide (e.g., dideoxynucleotide or acyclic nucleotide) complementary to the site to be assayed. In some embodiments, the oligonucleotide is extended by incorporation of dNTPs and terminated by ddNTPs or acyclic nucleotides, or in certain embodiments, the oligonucleotide is terminated by incorporation of ddNTPs or acyclic nucleotides without dNTP extension.

[0100] In some embodiments, the oligonucleotide can be extended by any one of 5 terminating nucleotides (e.g., ddATP, ddUTP, ddTTP, ddGTP, ddCTP). The target nucleic acid or its corresponding amplification product can be used as a template and can partially determine which terminating nucleotide is added to the oligonucleotide in the extension reaction. In certain embodiments, other terminating nucleotides (e.g., acyclic nucleotides or terminators) can be utilized.

[0101] In certain embodiments, the extension can be carried out under isothermal conditions or in a non-isothermal environment (e.g., thermal cycling conditions). One or more target nucleic acids can be extended in the extension reaction, and one or more variants of each target nucleic acid can be extended. The nucleic acid can be extended by one or more nucleotides, and in some embodiments, the length of the extension product is from about 10 to about 10,000 nucleotides, from about 10 to about 1,000 nucleotides, from about 10 to about 500 nucleotides, from about 10 to about 100 nucleotides, and sometimes from about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900 or 1000 nucleotides. Incorporation of terminating nucleotides (e.g., ddNTPs), hybridization position or other factors can determine the length of oligonucleotide extension. In certain embodiments, the amplification and extension reactions can be carried out in the same detection process.

[0102] In some embodiments, the extension reaction comprises repeating a plurality of temperature cycles to amplify the amount of the extension product in the reaction. In some embodiments, the extension reaction is cycled 2 or more times. In some embodiments, the extension reaction is cycled 10 or more times. In some embodiments, the extension reaction is cycled about 10, 15, 20, 50, 100, 200, 300, 400, 500, or 600 or more times. In some embodiments, the extension reaction is cycled 20 to 50 times. In some embodiments, the extension reaction is cycled 20 to 100 times. In some embodiments, the extension reaction is cycled 20 to 300 times. In some embodiments, the extension reaction is cycled 200 to 300 times. In some embodiments, the extension reaction is cycled at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 times.

[0103] In some embodiments, an oligonucleotide (e.g., an extension primer of the present application) hybridized to a target nucleic acid (e.g., an exponential amplification product of the present application) is extended by one nucleotide in the presence of an extension composition. The extension composition can include one or more buffers, salts, enzymes (e.g., polymerase, Klenow, etc.), water, template (e.g., DNA, RNA, amplification product, etc.), primer (e.g., oligonucleotide), nucleotide triphosphates, glycerol, macromolecular exclusion molecule, and any other additives used in the art. The extension composition can include terminating nucleotides (e.g., dideoxynucleotides (e.g., ddNTP) or acyclic nucleotides), non-terminating or extending nucleotides (e.g., dNTP), or a mixture of terminating and non-terminating nucleotides. The extension composition consists essentially of one or more specific terminating nucleotides, and can contain any other components of the extension composition (e.g., buffer, salt, template, etc.), but essentially does not contain any other terminating nucleotides or nucleotide triphosphates (e.g., dNTP) other than the specified ones. For example, an extension composition consisting essentially of ddTTP and ddCTP does not contain ddATP, ddGTP, or any other dNTP. In some embodiments, the nucleotides in the extension composition are only the terminating nucleotides and oligonucleotides hybridized to the target nucleic acid, and the target nucleic acid or its amplification product is extended by one nucleotide. In some embodiments, the extension composition consists essentially of terminating nucleotides (e.g., ddNTP, acyclic nucleotides).

[0104] In some embodiments, the terminating nucleotide(s) present (or absent in some embodiments) in the extension composition determines which terminating nucleotide(s) to add to the oligonucleotide. In some embodiments, the extension composition comprises one or more terminating nucleotides (e.g., ddNTP or acyclic nucleotides). In certain embodiments having more than one terminating nucleotide, 2, 3, or 4 chain-terminating nucleotides are different terminating nucleotides (i.e., not the same substance, e.g., ddA, ddT, ddC, ddG, ddU, acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP). In some embodiments, the extension composition comprises one or more terminating nucleotides and one or more non-terminating nucleotides (e.g., dNTP). In some embodiments, the extension composition includes terminating nucleotides corresponding to a specific variant (e.g., a first variant, a low-variant or a low-abundance variant) and can thus only extend the specific variant. In some embodiments, the extension composition includes terminating nucleotides that can allow the extension of a second variant (e.g., wild-type, high-variant or high-abundance variant), thereby allowing the extension of the second variant. In some embodiments, the methods of the present application include contacting a hybridized oligonucleotide species with an extension composition comprising one or more terminating nucleotides under extension conditions to generate an extended oligonucleotide species, wherein the oligonucleotide hybridized to a first variant (e.g., low-abundance variant, less-abundant variant, low-variant) is extended by the terminating nucleotide(s), and the oligonucleotide hybridized to a second variant (e.g., wild-type, high-abundance variant, high-variant) is extended by the terminating nucleotide(s).

[0105] For example, the extension primer can specifically bind to the target nucleic acid (e.g., a specific locus or target nucleic acid to be identified). In the present application, the extension primer can comprise a nucleic acid molecule having at least about 1 nucleotide, e.g., at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more nucleotides (e.g., a single-stranded nucleic acid molecule, e.g., a single-stranded DNA molecule). The extension primer can be substantially completely complementary to its target sequence (e.g., at least 80% complementary, e.g., at least 85% complementary, at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary or at least 99% or more complementary, e.g., 100% complementary).

[0106] In certain embodiments, a DNA polymerase, such as Therminator from NEB, can be used in the extension reaction (e.g., single-base extension reaction).TM DNA polymerase, Therminator DNA polymerase is 9°N TM A mutant of DNA polymerase. The modified enzyme can recognize and incorporate some modified bases such as ddNTP. Due to the thermal stability characteristics of this enzyme, the primer usage efficiency can be fully improved by repeated denaturation, annealing, and extension, increasing the yield.

[0107] Other T7 DNA polymerases can also be used. For example, genetically engineered T7 DNA polymerase can also be used for single-base extension reactions. For example, the DNA polymerase can be a genetically engineered form of T7 DNA polymerase (e.g., Sequenase). Different from the wild-type enzyme, it can substantially lack 3’→5’ exonuclease activity. The DNA polymerase may comprise two subunits, one of which can be Escherichia coli thioredoxin and the other can be a genetically engineered version of phage T7 gene 5 protein. The genetic changes that occur in this subunit (e.g., deleting 28 amino acids by in vitro mutagenesis) can eliminate all measurable exonuclease activity without changing the DNA polymerase activity.

[0108] For example, the terminating nucleotide can be modified at the 3’ carbon of its pentose moiety. For example, at least one of the terminating nucleotides can be a dideoxynucleotide. For example, the dideoxynucleotide can be selected from: ddATP, ddGTP, ddCTP, ddTTP, and ddUTP. In certain embodiments, the terminating nucleotide is an acyclic nucleotide. For example, the acyclic nucleotide can be selected from: acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP.

[0109] Mass spectrometry detection

[0110] In the present application, the extended oligonucleotide contains a detectable label. For example, the detectable label can be a mass label. For example, the mass label can be a mass-distinguishable tag. In certain cases, the terminating nucleotide may contain the mass-distinguishable tag.

[0111] For example, in the method of the present application, the mass label can be detected by mass spectrometry. The mass spectrometry can be, for example, matrix-assisted laser desorption ionization (MALDI) mass spectrometry.

[0112] The detectable label generally refers to a tag that can be distinguished from each other and used to identify the nucleic acid to which the label is attached. A variety of types of labels can be selected and used in the methods of the present application. For example, oligonucleotides, amino acids, small organic molecules, light-emitting molecules, light-absorbing molecules, light-scattering molecules, luminescent molecules, isotopes, enzymes, etc. can be used as detectable labels. In certain embodiments, oligonucleotides, amino acids, and / or small organic molecules of various lengths, various charge-to-mass ratios, various electrophoretic mobilities (capillary electrophoresis mobilities), and / or various masses can also be used as detectable labels. Thus, fluorophores, radioisotopes, chromogenic agents, luminescent agents, chemiluminescent agents, light-scattering agents, etc. can be used as labels. The choice of label depends on the required sensitivity, ease of coupling to nucleic acids, stability requirements, and available equipment.

[0113] In some embodiments, the detectable label is linked to a terminating nucleotide. In some embodiments, a suitable detectable label can be selected and / or designed to achieve optimal flight performance in mass spectrometry and to allow the label to be distinguished at a relatively high multiplex level. In some embodiments, the label is a fluorescent label or dye detected by electrophoresis or performing PCR.

[0114] Any suitable detection device can be used to distinguish the detectable labels in a sample. Detection devices suitable for detecting mass-distinguishable tags include, but are not limited to, certain mass spectrometry and gel electrophoresis devices. Examples of mass spectrometry formats include, but are not limited to: matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry (MS), MALDI orthogonal TOF mass spectrometry (OTOF MS; two-dimensional), laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance (ICR) mass spectrometry, and Fourier transform mass spectrometry. The methods described in the present application are readily adaptable to mass spectrometry formats in which the analyte is volatilized and ionized ("ionization MS", e.g., MALDI-TOF MS, LDMS, ESMS, linear TOF, OTOF). Orthogonal ion extraction MALDI-TOF and axial MALDI-TOF can produce relatively high resolution and, therefore, a relatively high level of multiplexing. Detection devices suitable for detecting light-emitting, light-absorbing, and / or light-scattering labels include, but are not limited to, certain light detectors and photodetectors (e.g., detecting fluorescent, chemiluminescent, absorption, and / or light-scattering labels).

[0115] The extended products obtained by the methods of the present application (e.g., the extended oligonucleotides of the present application) can be detected by a variety of methods. For example, the extension primer (UEP) and / or the terminating nucleotide can be labeled with any type of chemical group or moiety that allows for the detection and / or quantification of a signal, including but not limited to, mass tags, radioactive molecules, fluorescent molecules, antibodies, antibody fragments, haptens, carbohydrates, biotin, biotin derivatives, phosphorescent moieties, luminescent moieties, electrochemiluminescent moieties, moieties that produce an electrochemical signal upon oxidation or reduction, such as complexes of iron, ruthenium or osmium, chromogenic moieties, moieties having detectable electron spin resonance, capacitance, dielectric constant or conductivity, or any combination of such labels.

[0116] In the present application, a "mass distinguishable tag" refers to a tag that is distinguishable by mass. In some embodiments, the detectable tag consists of nucleotides, and sometimes the tag is about 5 nucleotides to about 50 nucleotides in length. In certain embodiments, the detectable tag is a nucleotide complex, which can be about 5 nucleotides to about 35 nucleotides in length. In some embodiments, the detectable tag is a peptide, which can be about 5 amino acids to about 100 amino acids in length. In certain embodiments, the detectable tag is a concatemer of organic molecular units. In some embodiments, the tag is a triphenylmethyl molecular concatemer. In certain embodiments, the mass distinguishable tag is a chain-terminating nucleotide.

[0117] A variety of mass distinguishable tags, such as complexes, amino acids and / or concatemers, can be selected and used. Different lengths and / or compositions of nucleotide strings (e.g., nucleic acids, complexes), amino acid strings (e.g., peptides, polypeptides, complexes) and / or concatemers can be distinguished by mass and used as tags. Any number of units can be employed in the mass distinguishable tag, and the upper and lower limits of such units depend in part on the mass window and the resolution of the system used to detect and distinguish such tags. Thus, the length and composition of the mass distinguishable tag can be selected in part based on the mass window used to detect and distinguish the tag and the resolution of the detector.

[0118] In certain embodiments, a detectable label can be released from a nucleic acid product (e.g., an extended oligonucleotide). The linkage between the detectable label and the nucleic acid can be of any type that can be transcribed and cleaved, cleaved and allow detection of the released label(s). In certain embodiments, the label can be separated from the other portion of the label-linked molecule. For example, a linkage cleavable by a nuclease (e.g., ribonuclease, endonuclease); a linkage cleavable by chemical means; a linkage cleavable by physical treatment; and a photocleavable linker (e.g., o-nitrobenzyl, 6-nitroveratryloxycarbonyl, 2-nitrobenzyl group) cleavable by light. Photocleavable linkers are advantageous when using a detection system that emits light (e.g., matrix-assisted laser desorption ionization (MALDI) mass spectrometry involving photo-excitation of light), as cleavage and detection are combined and performed in one step.

[0119] Multiplex detection

[0120] The methods of the present application allow for high-throughput detection or quantification of the presence, absence, or amount of multiple target nucleic acids in a nucleic acid sample. Multiplexing refers to the simultaneous detection of more than one target nucleic acid (or more than one specific locus, e.g., a mutation locus). Conventional methods for multiplex reactions in combination with mass spectrometry are known (see, e.g., WO1997037041A2). Multiplexing provides the advantage of identifying multiple target nucleic acids and their variants (e.g., variants with different sequence variations) in a single mass spectrum, as compared to having to perform separate mass spectrometry analyses on each individual target nucleic acid. In some embodiments, the methods of the present application can be used in a high-throughput, highly automated process for rapid and accurate analysis of target sequences. In some embodiments, the methods of the present application can be highly multiplexed in a single reaction. Multiplexing is applicable when the genotype at a locus is unknown, and in some embodiments, the genotype at a locus is known.

[0121] In certain embodiments, the number of multiplexed target nucleic acids includes, but is not limited to, from about 2 to about 1000, from about 2 to about 500, from about 2 to about 100, for example, about 1 - 5, 5 - 9, 9 - 11, 11 - 13, 13 - 15, 15 - 17, 17 - 19, 19 - 21, 21 - 23, 23 - 25, 25 - 27, 27 - 29, 29 - 31, 31 - 33, 33 - 35, 35 - 37, 37 - 39, 39 - 41, 41 - 43, 43 - 45, 45 - 47, 47 - 49, 49 - 51, 51 - 53, 53 - 55, 55 - 57, 57 - 59, 59 - 61, 61 - 63, 63 - 65, 65 - 67, 67 - 69, 69 - 71, 71 - 73, 73 - 75, 75 - 77, 77 - 79, 79 - 81, 81 - 83, 83 - 85, 85 - 87, 87 - 89, 89 - 91, 91 - 93, 93 - 95, 95 - 97, 97 - 101, 101 - 103, 103 - 105, 105 - 107, 107 - 109, 109 - 111, 111 - 113, 113 - 115, 115 - 117, 117 - 119, 121 - 123, 123 - 125, 125 - 127, 127 - 129, 129 - 131, 131 - 133, 133 - 135, 135 - 137, 137 - 139, 139 - 141, 141 - 143, 143 - 145, 145 - 147, 147 - 149, 149 - 150, 150 - 200, 200 - 250, 250 - 300, 300 - 350, 350 - 400, 400 - 450, 450 - 500 or more.

[0122] The design methods for obtaining an analytical mass spectrum using multiplex analysis can include primer and oligonucleotide design methods and reaction design methods. For primer and oligonucleotide design in multiplex analysis, the same general primer design guidelines as in single reactions are adopted, such as avoiding false priming and primer dimers, except that multiplex reactions involve more primers. In addition, analyte peaks in the mass spectrum of one assay can be fully resolved from the products of any assay multiplexed with that assay, including pausing peaks and any other by - product peaks. Also, analyte peaks preferably fall within a user - specified mass window, for example, in the range of 5000 - 8500 Da. In some embodiments, extension oligonucleotides can be designed relative to a specific target sequence. In such embodiments, for example, the length is typically in a range that can be user - specified (e.g., between 17 - 24 bases or 17 - 26 bases) and generally does not contain ambiguous bases in the target sequence. Sometimes, by calculating the sequence - dependent melting (or hybridization / dissociation) temperature T mTo measure the hybridization intensity. Methods and software for designing extension primers are known, for example, SpectroDESIGNER (Sequenom).

[0123] In some embodiments, the multiplex assay is designed for single base extension. For example, an oligonucleotide (e.g., the oligonucleotide extended in the present application) can first be hybridized to an amplification product derived from a target nucleic acid (e.g., the amplification product in the present application, such as an exponential amplification product) at the 5' position of a single base position, and the single base position varies among different variants of the target nucleic acid.

[0124] Disease diagnosis method

[0125] The methods and products of the present application can be used for the diagnosis of diseases or disorders (including prognosis of diseases or disorders), for example, the diagnosis of the disease or disorder is performed by a non-invasive method.

[0126] For example, the disease or disorder can be a disease or disorder associated with changes (e.g., gene mutations) in genetic material (e.g., nucleic acids, such as DNA), such as tumors or cancers. The genetic material can be cfDNA, such as ctDNA, from a sample (e.g., tissue or body fluid) of a subject.

[0127] In certain embodiments, the methods and products of the present application can be used to improve, adjust, or determine a treatment regimen suitable for a specific subject.

[0128] Kit and system

[0129] On the other hand, the present application provides a kit and / or system that can be used to implement the methods described in the present application.

[0130] The kit may include: 1) an extension reaction composition containing an extension primer, which is an oligonucleotide with a mutation recognition site at the 3' end, wherein the mutation recognition site can be complementary paired with the target nucleotide sequence but not with the original nucleotide sequence, and the nucleotides at the mutation recognition site are modified nucleotides that can increase the specificity of the extension primer; and 2) a composition suitable for nucleic acid mass spectrometry detection, which contains a MALDI matrix compound. In certain embodiments, the kit further contains a reaction composition suitable for performing an amplification reaction on the nucleic acid to be detected, which contains an enzyme suitable for PCR, deoxynucleoside triphosphates (dNTPs), a buffer suitable for PCR, PCR amplification primers, and Mg 2+ .

[0131] In some cases, the extension reaction composition, the composition suitable for nucleic acid mass spectrometry detection, and the reaction composition suitable for amplification reaction are not mixed with each other in the kit. For example, in the kit, the extension reaction composition, the composition suitable for nucleic acid mass spectrometry detection, and the reaction composition suitable for amplification reaction may each independently exist in separate packages (or devices).

[0132] In some cases, in the system described in the present application, the device for using the kit may include a thermal cycler and / or a mass spectrometer.

[0133] The kit described in the present application generally includes one or more containers containing one or more components described in the present application. The kit includes one or more components in any number of separate containers, packages, tubes, vials, microplates, etc., or the components can be combined in various combinations in these containers. The kit may include, for example, one or more of the following components: 1) one or more nucleotides (e.g., terminating nucleotides and / or non-terminating nucleotides); one or more of which may contain a detection label; 2) one or more oligonucleotides, one or more of which may include a detection label (e.g., amplification primers, one or more extension primers, oligonucleotides containing labels); 3) one or more enzymes (e.g., polymerase, endonuclease, restriction enzyme, exonuclease, etc.); 4) control components (e.g., control DNA, primers, synthetic templates, target nucleic acids, etc.); 5) one or more buffers; and 6) printed matter (e.g., instructions, labels, etc.).

[0134] The kit is sometimes used in conjunction with certain methods and may include instructions for performing one or more methods and / or a description of one or more compositions. The kit can be used to perform the methods described in the present application. The instructions and / or description can be in tangible form (e.g., paper, etc.) or in electronic form (e.g., a computer-readable file on a tangible medium (e.g., a compact disc)), and can be included in the kit insert. The kit may also include written instructions for the Internet location providing such instructions or description.

[0135] In certain embodiments, the kit of the present application includes one or more terminating nucleotides that inhibit the activity of the enzyme on the oligonucleotide when it is at the 3'-end of the oligonucleotide. In certain embodiments, the terminating nucleotide is a dideoxynucleotide. In certain embodiments, the dideoxynucleotide is selected from: ddATP, ddGTP, ddCTP, ddTTP, and ddUTP. In certain embodiments, the terminating nucleotide is an acyclic nucleotide. In certain embodiments, the acyclic nucleotide is selected from: acyATP, acyCTP, acyGTP, acyTTP, and acy-bromo-UTP. In certain embodiments, the terminating nucleotide includes a mass-differentiable label.

[0136] In certain embodiments, the kit includes one or more of the following: oligonucleotides, polymerase, reverse transcriptase, one or more buffers, and one or more reaction controls.

[0137] Without being limited by any theory, the following examples are merely for illustrating the detection methods and uses of the present application, etc., and are not used to limit the scope of the invention of the present application.

[0138] Examples

[0139] Example 1

[0140] The method of the present application detects nucleic acid samples with different mutation frequencies

[0141] 1. Preparation of mutant samples and primers:

[0142] Prepare mutant samples of the human gene KRAS sequence, in which the 13th codon is mutated from G base to A base (the sequences complementary to the nucleotide sequences of wild-type and mutant KRAS are shown as SEQ ID NOs: 1 and 2 respectively); in addition, prepare mutant samples of the BRAF sequence, in which the 600th codon is mutated from G base to A base (the sequences complementary to the nucleotide sequences of wild-type and mutant BRAF are shown as SEQ ID NOs: 3 and 4 respectively). The above mutant samples are respectively purchased from the mutant genomes of KRAS G13D and BRAF V600E of Haixing Biology. Select human leukocyte DNA as the matrix DNA, and mix the mutant genomes and leukocyte DNA in proportion to prepare reference products with mutant frequencies of 5%, 1%, 0.5%, and 0.1% for standby.

[0143] Based on the above mutant gene sequences, PCR amplification primers KRAS-AMP-F, KRAS-AMP-R, BRAF-AMP-F, and BRAF-AMP-R (as shown in SEQ ID NOs: 5 - 8) were designed and synthesized. According to the extension primer design principle, extension primers were designed and synthesized: KRAS-EXTENSION (naked sequence without modification as shown in SEQ ID NO: 9), and BRAF-EXTENSION (naked sequence without modification as shown in SEQ ID NO: 10). The modifications included in the extension primers are shown as follows:

[0144] Sequence of KRAS-EXTENSION: ACTTGTGGTAGTTGGAGCTGGTGA LNA , where A LNA represents an A nucleotide modified by locked nucleic acid.

[0145] Similarly, the sequence of BRAF-EXTENSION: GGACCCACTCCATCGAGATTTCT LNA C, where T LNA represents a T nucleotide modified by locked nucleic acid.

[0146] 2. Mass spectrometry detection and analysis:

[0147] Using the MALDI-TOF mass spectrometry sample pretreatment kit purchased from Hangzhou Juzhi Biotechnology Co., Ltd., prepare the PCR amplification reaction system according to the system shown in the following table, and mix well.

[0148]

[0149]

[0150] Then place the reaction mixture on a PCR instrument and run the reaction program shown in the following table.

[0151]

[0152] After completing PCR amplification, use the MALDI-TOF mass spectrometry sample pretreatment kit purchased from Hangzhou Juzhi Biotechnology Co., Ltd., prepare the digestion reaction system according to the system shown in the following table, and mix it with the reaction mixture that has completed PCR amplification.

[0153]

[0154] Then place the reaction mixture on a PCR instrument and run the reaction program shown in the following table.

[0155]

[0156] After digestion is completed, use the flight mass spectrometry sample pretreatment kit from Hangzhou Juzhi Biotechnology Co., Ltd. to prepare an extension reaction system according to the system shown in the following table, and mix it well with the digested reaction mixture.

[0157]

[0158]

[0159] Then place the reaction mixture on a PCR instrument and run the reaction program shown in the following table.

[0160]

[0161] After the extension reaction is completed, place the reaction plate into a nucleic acid mass spectrometer (GeneTOF 3100 purchased from Hangzhou Juzhi Biotechnology Co., Ltd.) for mass spectrometry detection and analysis.

[0162] 3. qPCR Detection and Analysis:

[0163] Use the qPCR SYBR Green Master mix purchased from Yeasen Biotech Co., Ltd. for the reaction, and perform it according to the reaction system shown in the following table.

[0164]

[0165] Then run the reaction program on a Roche Lightcycler 480II real-time fluorescence quantitative PCR instrument:

[0166]

[0167]

[0168] 4. Result Analysis:

[0169] Figure 1 A- Figure 1 E are the results of nucleic acid mass spectrometry detection of KRAS G13D samples with mutation frequencies of 0.1%, 0.5%, 1%, and 5%, and wild-type (no mutation) KRAS G13D samples using the extension primer KRAS-EXTENSION. The ddc line on the right side of the spectrum indicates the extension peak, representing the presence of a template conforming to the mutation characteristics in the sample. The larger the ratio of this extension peak to the extension primer peak indicated by the UEP line on the left, the higher the abundance of the template with mutation characteristics in the sample. Therefore, it can be seen from the spectrum that in the KRAS G13D mutant samples, there is a clear and distinguishable extension peak of the extension primer at a mutation frequency of 0.1%, and the extension peaks of the samples with 0.5%, 1%, and 5% are clearer and more distinct, while Figure 1 the wild-type control sample shown in E does not show a distinguishable extension peak.

[0170] Figure 2 A- Figure 2 E are the results of nucleic acid mass spectrometry detection of BRAF V600E samples with mutation frequencies of 0.1%, 0.5%, 1%, and 5%, and without mutation (wild-type) using the extension primer BRAF-EXTENSION. It can be seen from the spectra that in the BRAF V600E mutant samples, the extension peaks of the extension primer are clear and distinguishable at a mutation frequency of 0.1%, and the extension peaks of the 0.5%, 1%, and 5% samples are clearer and more distinct, while Figure 2 the wild-type control samples shown in E do not show distinguishable extension peaks. The above results can prove that the extension primer provided in this application can reduce the detection lower limit of the nucleic acid mass spectrometry detection mutation frequency from 5% to 0.1%.

[0171] Figure 3 A- Figure 3 C are the results of qPCR detection of low-frequency mutations using BRAF-EXTENSION as the qPCR forward primer and BRAF-AMP-R as the qPCR reverse primer. It can be seen from the results that the extension primer provided in this application cannot distinguish between 0.1% low-frequency mutations and pure wild-type samples only by qPCR detection ( Figure 3 B and Figure 3 C spectra are difficult to distinguish).

[0172] Example 2

[0173] Obtained the gene sequence (IDH1 sequence) in which the G base at the 132nd codon of the human gene IDH1 was mutated to the A base, and the gene sequence (IDH2 sequence) in which the G at the 172nd codon of the IDH2 gene was mutated to the A base;

[0174] According to the gene mutation gene sequence, designed and synthesized PCR amplification primers (IDH1-AMP-F, IDH1-AMP-R, IDH2-AMP-F, IDH2-AMP-R), and according to the extension primer design principle, designed and synthesized extension primers (IDH1-EXTENSION-1, IDH1-EXTENSION-2, IDH2-EXTENSION-1, IDH2-EXTENSION-2) at Sangon Biotech (Shanghai) Co., Ltd.;

[0175] The primer sequences are as follows:

[0176]

[0177]

[0178] n LNAIt represents a nucleotide modified by locked nucleic acid, and n is A, T, C or G.

[0179] Purchase the mutant genomes of IDH1 R132H and IDH2 R172K from Starfish Biology, and then use human leukocyte DNA as the matrix DNA. Mix the mutant genomes and leukocyte DNA proportionally to construct reference products with mutation frequencies of 5% and 0.1%. Mass spectrometry detection and analysis:

[0180] Use the flight mass spectrometry sample pretreatment kit of Hangzhou Juzhi Biotechnology Co., Ltd. Prepare the PCR amplification reaction system according to the following system and mix well;

[0181]

[0182] Then put the reaction mixture on a PCR instrument and run the following reaction program:

[0183]

[0184]

[0185] After completing PCR amplification, use the flight mass spectrometry sample pretreatment kit of Hangzhou Juzhi Biotechnology Co., Ltd. Prepare the digestion reaction system according to the following system and mix it with the reaction solution in step 3;

[0186]

[0187] Then put the reaction mixture on a PCR instrument and run the following reaction program:

[0188] Temperature Time Number of cycles 37℃ 40 min 1 85℃ 1 min 1 4℃ ∞ /

[0189] After completing digestion, use the flight mass spectrometry sample pretreatment kit of Hangzhou Juzhi Biotechnology Co., Ltd. Prepare the extension reaction system according to the following system and mix it with the reaction solution in step 4;

[0190]

[0191] Then put the reaction mixture on a PCR instrument and run the following reaction program:

[0192]

[0193]

[0194] After completing the extension reaction, put the reaction plate into the nucleic acid mass spectrometer GeneTOF3100 of Hangzhou Juzhi Biotechnology Co., Ltd. for mass spectrometry detection and analysis.

[0195] The results are as Figures 4 to 11 shown.

[0196] Figure 4 The detection result of using the extension primer IDH1-EXTENSION-1 to detect a sample with an IDH1 R132H mutation frequency of 5%. The extension peaks are indicated by the ddC line, indicating that the extension primer IDH1-EXTENSION-1 can clearly detect the IDH1 R132H mutation at a frequency of 5%.

[0197] Figure 5 The detection result of using the extension primer IDH1-EXTENSION-1 to detect a sample with an IDH1 R132H mutation frequency of 0.1%. The extension peaks are indicated by the ddC line, indicating that the extension primer IDH1-EXTENSION-1 can clearly detect the IDH1 R132H mutation at a frequency of 0.1%.

[0198] Figure 6 The detection result of using the extension primer IDH1-EXTENSION-1 to detect a sample with an IDH1 R132H mutation frequency of 0. There are no extension peaks at the positions indicated by the ddC line, indicating that the extension primer IDH1-EXTENSION-1 does not have false extension and can clearly distinguish between samples with a 0.1% mutation frequency and samples without mutation.

[0199] Figure 7 The detection result of using the unmodified extension primer IDH1-EXTENSION-2 to detect a sample with an IDH1 R132H mutation frequency of 0. Obvious extension peaks appear at the positions indicated by the ddC line, indicating that the extension primer IDH1-EXTENSION-2 has false extension, which will lead to false positive results.

[0200] Figure 8 The detection result of using the extension primer IDH2-EXTENSION-1 to detect a sample with an IDH2 R172K mutation frequency of 5%. The extension peaks are indicated by the ddT line, indicating that the extension primer IDH2-EXTENSION-1 can clearly detect the IDH2 R172K mutation at a frequency of 5%.

[0201] Figure 9 The detection result of using the extension primer IDH2-EXTENSION-1 to detect a sample with an IDH2 R172K mutation frequency of 0.1%. The extension peaks are indicated by the ddT line, indicating that the extension primer IDH2-EXTENSION-1 can clearly detect the IDH2 R172K mutation at a frequency of 0.1%.

[0202] Figure 10For the test result of detecting a sample with an IDH2 R172K mutation frequency of 0 using the extension primer IDH2-EXTENSION-1, there is no extension peak at the position indicated by the ddT line, indicating that there is no false extension of the extension primer IDH2-EXTENSION-1, and samples with a 0.1% mutation frequency and samples without mutation can be clearly distinguished.

[0203] Figure 11 For the test result of detecting a sample with an IDH2 R172K mutation frequency of 0 using the unmodified extension primer IDH2-EXTENSION-2, an obvious extension peak appears at the position indicated by the ddT line, indicating that there is false extension of the extension primer IDH2-EXTENSION-2, which will lead to false positive results.

[0204] It should be understood that the embodiments and implementation schemes described herein are only for illustrative purposes, and various modifications or changes based on them have been prompted to those skilled in the art, and these modifications or changes are included within the spirit of this application and the scope of the appended claims.

Claims

1. A detection method for identifying a target nucleotide sequence at one or more specific positions of a nucleic acid to be detected, or for identifying that the original nucleotide sequence at one or more specific positions of the nucleic acid to be detected has mutated into the target nucleotide sequence compared to a reference nucleic acid, the method comprising: 1) Providing an extension primer, which is an oligonucleotide with a mutation recognition site at its 3'-end, wherein the mutation recognition site can complementary pair with the target nucleotide sequence but not with the original nucleotide sequence, and the nucleotides at the mutation recognition site are modified nucleotides, and the modified nucleotides can increase the specificity of the extension primer; 2) Hybridizing the extension primer with the nucleic acid to be detected or its amplification product to form an extension product; 3) Using nucleic acid mass spectrometry to analyze the extension product of 2) to thereby identify the presence of the target nucleotide sequence.

2. The method according to claim 1, which includes setting the mutation recognition site at any position among the outermost 3 nucleotides at the 3'-end of the extension primer.

3. The method according to claim 1 or 2, which includes replacing other nucleotides in the extension primer with the modified nucleotides; the other nucleotides are nucleotides at any position other than the mutation recognition site.

4. The method according to claim 3, wherein the other nucleotides are 1 to 3 nucleotides optionally selected within the range of 1 to 5 nucleotides away from the mutation recognition site.

5. The method according to any one of claims 1-4, wherein the modified nucleotide is a nucleotide analogue with an altered phosphodiester-sugar backbone.

6. The method according to any one of claims 1-5, wherein the modified nucleotide is a locked nucleic acid (LNA) and / or a peptide nucleic acid (PNA).

7. The method according to any one of claims 1-6, which further includes providing reaction conditions suitable for an amplification reaction to generate an amplification product of the nucleic acid to be detected.

8. The method according to claim 7, wherein the amplification reaction is a cloning reaction, a transcription-based amplification reaction, a polymerase chain reaction (PCR), a ligase chain reaction (LCR), or a strand displacement amplification (SDA) reaction.

9. The method according to claim 7 or 8, comprising providing reaction conditions suitable for subjecting the nucleic acid to be detected to PCR, said reaction conditions comprising an enzyme suitable for performing PCR, deoxynucleoside triphosphates (dNTPs), a buffer suitable for performing PCR, PCR amplification primers, and Mg 2+ .

10. A method for diagnosing a disease related to a specific gene mutation by the method according to any one of claims 1-9, wherein the nucleic acid to be detected is derived from a subject in need of diagnosis, and the reference nucleic acid is derived from a subject not suffering from the disease.

11. A kit for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or for identifying that the original nucleotide sequence at one or more specific sites of the nucleic acid to be detected, compared with a reference nucleic acid, has mutated into a target nucleotide sequence, the kit comprising an extension reaction composition and a composition suitable for nucleic acid mass spectrometry detection; wherein, The extension reaction composition contains an extension primer, which is an oligonucleotide with a mutation recognition site at its 3'-end, wherein the mutation recognition site can complementary pair with the target nucleotide sequence but not with the original nucleotide sequence, and the nucleotides at the mutation recognition site are modified nucleotides, and the modified nucleotides can increase the specificity of the extension primer.

12. The kit according to claim 11, wherein the mutation recognition site is set at any position among the outermost 3 nucleotides at the 3'-end of the extension primer.

13. The kit according to claim 11 or 12, wherein one or more nucleotides at any position other than the mutation recognition site in the extension primer are modified nucleotides.

14. The kit according to any one of claims 11-13, wherein one to three nucleotides optionally within a range of 1 to 5 nucleotides from the mutation recognition site in the extension primer are modified nucleotides.

15. The kit according to claim 13 or 14, wherein the modified nucleotide is a nucleotide analogue having an altered phosphodiester-sugar backbone.

16. The kit according to any one of claims 13-15, wherein the modified nucleotide is a locked nucleic acid (LNA) and / or a peptide nucleic acid (PNA).

17. The kit according to any one of claims 11-16, wherein the extension reaction composition further comprises terminating nucleotides.

18. The kit according to any one of claims 11-17, further comprising a reaction composition suitable for performing an amplification reaction on the nucleic acid to be detected.

19. The kit according to claim 18, wherein the reaction composition comprises an enzyme suitable for performing PCR, deoxynucleoside triphosphates (dNTPs), a buffer suitable for performing PCR, PCR amplification primers, and Mg 2+ .

20. The kit according to any one of claims 11-19, wherein the composition suitable for nucleic acid mass spectrometry detection comprises a MALDI matrix compound.

21. The kit according to any one of claims 11-20, wherein the extension reaction composition and the composition suitable for nucleic acid mass spectrometry detection are not mixed with each other.

22. The kit according to claim 18 or 19, wherein the extension reaction composition, the composition suitable for nucleic acid mass spectrometry detection, and the reaction composition suitable for performing an amplification reaction are not mixed with each other.

23. A detection system for identifying a target nucleotide sequence at one or more specific sites of a nucleic acid to be detected, or for identifying that the original nucleotide sequence at one or more specific sites of the nucleic acid to be detected, compared to a reference nucleic acid, has mutated into a target nucleotide sequence, the system comprising the kit according to any one of claims 11-22 and a device for using the kit.

24. The system according to claim 23, wherein the device comprises a thermal cycler and / or a mass spectrometer.

Images