Chemical compositions and methods of use thereof

Abstract

The present disclosure relates to chemical compositions, kits and devices, and methods for using these compositions, kits and devices in various assays.

Description

[0001] This application is a divisional application of the patent application for invention with the application date of May 14, 2019, application number 201980047067.1, and invention title "Chemical Composition and Its Use Method".

[0002] Cross-reference to related applications This application claims the priority and benefits of U.S. Provisional Application No. 62 / 671,091 filed on May 14, 2018, and U.S. Provisional Application No. 62 / 836,327 filed on April 19, 2019. The entire content of the above patent applications is incorporated herein by reference. Technical field and background art

[0003] There are currently various methods for nucleic acid sequencing, that is, the process of determining the precise order of nucleotides within a nucleic acid molecule. Current methods require enzymatic amplification of nucleic acids, such as by PCR and / or cloning. Further enzymatic polymerization is required to generate a signal detectable by optical detection means. Such amplification and polymerization steps are expensive and / or time-consuming. Therefore, there is a need in the art for rapid, amplification-free, and enzyme-free nucleic acid sequencing methods. The present disclosure addresses these needs. Summary of the invention

[0004] The present disclosure provides sequencing probes, methods, kits, and devices that provide rapid enzyme-free, amplification-free, and library-free nucleic acid sequencing with long read lengths and low error rates. The sequencing probes described herein include a barcode domain, wherein each position in the barcode domain corresponds to at least two nucleotides in the target binding domain. In addition, the methods, kits, and devices have rapid sampling-response capabilities. These features are particularly useful for sequencing in a clinical setting. The present disclosure is an improvement over the disclosure in Patent Publication No. U.S. 2016 / 0194701, the content of which is incorporated herein by reference in its entirety.

[0005] The present disclosure provides a probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment site comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the synthetic backbone comprises L-DNA, wherein each of the at least three attachment sites corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment sites each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment sites determines the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain; and a first complementary primary nucleic acid molecule that hybridizes to a first attachment site of the at least three attachment sites, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment site of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the linker modification is and wherein the linker modification is located between the first domain and the second domain.

[0006] The probe may comprise about 60 nucleotides. The probe may comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. The single-stranded DNA synthetic backbone may comprise L-DNA. The single-stranded DNA synthetic backbone may comprise about 27 nucleotides. The double-stranded DNA spacer may comprise L-DNA. The double-stranded DNA spacer may comprise a length of about 25 nucleotides.

[0007] The number of nucleotides in the target binding domain of the probe may be greater than the number of attachment sites in the barcode domain of the probe. The target binding domain may comprise eight nucleotides, while the barcode domain may comprise three attachment sites. At least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule may be before at least six nucleotides in the target binding domain, and wherein at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule may be after at least six nucleotides in the target binding domain.

[0008] Attachment positions within the barcode domain can include an attachment region. At least one nucleic acid sequence of each attachment position within the barcode domain can include approximately 9 nucleotides. At least one nucleic acid sequence of the attachment position can include a 3'-terminal guanine nucleotide. At least one nucleic acid sequence of each attachment position can include at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanine nucleotide. Each nucleotide of at least one nucleic acid sequence of the attachment position can be L-DNA. Each nucleotide of at least eight nucleotides of the target binding domain can be D-DNA.

[0009] The complementary nucleic acid molecule can be a primary nucleic acid molecule, wherein the primary nucleic acid molecule can directly bind to at least one attachment region within at least one attachment position of the barcode domain. The primary nucleic acid molecule can include at least two domains: a first domain capable of binding to at least one attachment region within at least one attachment position of the barcode domain, and a second domain capable of binding to at least one complementary secondary nucleic acid molecule. The first domain of the primary nucleic acid molecule can include L-DNA. The second domain of the primary nucleic acid molecule can include D-DNA. The first domain of the primary nucleic acid molecule can include a 5'-terminal cytosine nucleotide. The first domain of the primary nucleic acid molecule can include at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof, and a 5'-terminal cytosine nucleotide. A cleavable linker can be located between the first domain and the second domain of the primary nucleic acid molecule. The cleavable linker can include at least one cleavable moiety. The cleavable moiety can be a photocleavable moiety.

[0010] The primary nucleic acid molecule can hybridize to at least one attachment region within at least one attachment position of the barcode domain and can hybridize to at least one secondary nucleic acid molecule. The primary nucleic acid molecule can hybridize to four secondary nucleic acid molecules.

[0011] The secondary nucleic acid molecule can comprise at least two domains: a first domain capable of binding to a complementary sequence in at least one primary nucleic acid molecule; and a second domain capable of binding to: (a) a first detectable label and at least a second detectable label, (b) at least one complementary tertiary nucleic acid molecule, or (c) a combination thereof. The secondary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. The cleavable linker can be photocleavable. The secondary nucleic acid molecule can hybridize to at least one primary nucleic acid molecule and to at least one tertiary nucleic acid molecule. The secondary nucleic acid molecule can hybridize to: (a) at least one primary nucleic acid molecule, (b) at least one tertiary nucleic acid molecule, and (c) a first detectable label and at least a second detectable label. Each secondary nucleic acid molecule can hybridize to one tertiary nucleic acid molecule. The first detectable label and at least the second detectable label can have the same emission spectrum or can have different emission spectra.

[0012] The tertiary nucleic acid molecule can comprise at least two domains: a first domain capable of binding to a complementary sequence in the secondary nucleic acid molecule; and a second domain capable of binding to the first detectable label and at least the second detectable label. The tertiary nucleic acid molecule comprises a cleavable linker. The cleavable linker can be located between the first domain and the second domain. The cleavable linker can be photocleavable. The tertiary nucleic acid molecule can hybridize to at least one secondary nucleic acid molecule and can comprise the first detectable label and at least the second detectable label. The first detectable label and at least the second detectable label can have the same emission spectrum or can have different emission spectra.

[0013] At least the first detectable label and the second detectable label located on the secondary nucleic acid molecule can have the same emission spectrum, and at least the first detectable label and the second detectable label located on the tertiary nucleic acid molecule can have the same emission spectrum, and wherein the emission spectrum of the detectable labels on the secondary nucleic acid molecule can be different from the emission spectrum of the detectable labels on the tertiary nucleic acid molecule.

[0014] A primary nucleic acid molecule can hybridize to four secondary nucleic acid molecules, wherein the four secondary nucleic acid molecules each comprise four first detectable labels, and wherein the four secondary nucleic acid molecules each hybridize to one tertiary nucleic acid molecule, wherein the tertiary nucleic acid molecule comprises five detectable labels. The emission spectrum of the first detectable label of the secondary nucleic acid molecule can be different from the emission spectrum of the second detectable label on the tertiary nucleic acid molecule.

[0015] The present disclosure provides methods for determining the nucleotide sequence of a nucleic acid, comprising (1) hybridizing the target-binding domain of at least one first probe of claim 1 to a first region of a target nucleic acid, the target nucleic acid optionally being immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (6) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid that hybridize to at least six nucleotides of the target-binding domain of at least one first probe, based on the identity of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label, and at least one sixth detectable label.

[0016] The foregoing method may further comprise (11) removing at least one first probe from a first region of an optionally immobilized target nucleic acid; (12) hybridizing the target-binding domain of at least one second probe of claim 1 to a second region of the optionally immobilized target nucleic acid, and wherein the target-binding domains of the first probe and of the at least second probe are different; (13) hybridizing a fourth complementary nucleic acid molecule comprising at least one seventh detectable label and at least one eighth detectable label to a first attachment position of at least three attachment positions of the barcode domain of at least one second probe; (14) identifying at least one seventh detectable label and at least one eighth detectable label of the fourth complementary nucleic acid molecule hybridized to the first attachment position; (15) removing at least one seventh detectable label and at least one eighth detectable label hybridized to the first attachment position; (16) hybridizing a fifth complementary nucleic acid molecule comprising at least one ninth detectable label and at least one tenth detectable label to a second attachment position of at least three attachment positions of the barcode domain of the at least second probe; (17) identifying at least one ninth detectable label and at least one tenth detectable label of the fifth complementary nucleic acid molecule hybridized to the second attachment position; (18) removing at least one ninth detectable label and at least one tenth detectable label hybridized to the second attachment position; (19) hybridizing a sixth complementary nucleic acid molecule comprising at least one eleventh detectable label and at least one twelfth detectable label to a third attachment position of at least three attachment positions of the barcode domain of the at least second probe; (20) identifying at least one eleventh detectable label and at least one twelfth detectable label of the sixth complementary nucleic acid molecule hybridized to the third attachment position; and (21) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid that hybridize to at least six nucleotides of the target-binding domain of the at least one second probe, based on the identities of at least one seventh detectable label, at least one eighth detectable label, at least one ninth detectable label, at least one tenth detectable label, at least one eleventh detectable label, and at least one twelfth detectable label.

[0017] The foregoing method may further comprise assembling the identified nucleotide linear order of each of at least the first region and at least the second region of the optionally immobilized target nucleic acid, thereby identifying the sequence of the optionally immobilized target nucleic acid.

[0018] Steps (4) and (5) may occur sequentially or simultaneously. Steps (7) and (8) may occur sequentially or simultaneously.

[0019] The first detectable label and the second detectable label may have the same emission spectrum, or may have different emission spectra. The third detectable label and the fourth detectable label may have the same emission spectrum, or may have different emission spectra. The fifth detectable label and the sixth detectable label may have the same emission spectrum, or may have different emission spectra.

[0020] The first complementary nucleic acid molecule, the second complementary nucleic acid molecule, and the third complementary nucleic acid molecule may comprise cleavable linkers. The cleavable linkers may be photocleavable.

[0021] The first complementary nucleic acid molecule may comprise a first-level nucleic acid, four second-level nucleic acid molecules, and four third-level nucleic acid molecules, wherein the first-level nucleic acid hybridizes with the four second-level nucleic acid molecules, wherein the four second-level nucleic acid molecules each comprise four first detectable labels, and wherein the four second-level nucleic acid molecules each hybridize with a third-level nucleic acid molecule, wherein the four third-level nucleic acid molecules each comprise five second detectable labels.

[0022] The first-level nucleic acid molecule may comprise at least two domains: a first domain that hybridizes with a first attachment position of a barcode domain, and a second domain that hybridizes with the four second-level nucleic acid molecules. The first-level nucleic acid molecule may comprise a cleavable linker located between the first domain and the second domain.

[0023] The second-level nucleic acid molecule may comprise at least two domains: a first domain that hybridizes with the second domain of the first-level nucleic acid molecule; and a second domain that comprises four first detectable labels and hybridizes with a third-level nucleic acid molecule. The second-level nucleic acid molecule may comprise a cleavable linker located between the first domain and the second domain.

[0024] Removing at least one first detectable label and at least one second detectable label that hybridize with the first attachment position may include cleaving the cleavable linker between the first domain and the second domain of the first-level nucleic acid, cleaving the cleavable linker between the first domain and the second domain of each second-level nucleic acid, or any combination thereof.

[0025] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein the first complex comprises a first partially double-stranded nucleic acid molecule, wherein one strand of the first partially double-stranded nucleic acid molecule comprises: a target-specific domain hybridized to a first portion of the target nucleic acid molecule, a duplex domain annealing to the other strand of the first partially double-stranded nucleic acid molecule, and at least one first affinity moiety, wherein the other strand of the first partially double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the first partially double-stranded nucleic acid molecule, a substrate-specific domain hybridized to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, wherein the second complex comprises a second partially double-stranded nucleic acid molecule, wherein one strand of the second partially double-stranded nucleic acid molecule comprises: a target-specific domain hybridized to a second portion of the target nucleic acid, wherein the first portion and the second portion do not overlap, and a duplex domain annealing to the other strand of the second partially double-stranded nucleic acid molecule, wherein the other strand of the second partially double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the second partially double-stranded nucleic acid molecule, a sample-specific domain identifying the biological sample from which the target nucleic acid is obtained, a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence.

[0026] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein the first complex comprises a first partial double-stranded nucleic acid molecule, wherein one strand of the first partial double-stranded nucleic acid molecule comprises: a target-specific domain hybridizing to a first part of the target nucleic acid molecule, a duplex domain annealing to the other strand of the first partial double-stranded nucleic acid molecule, and at least one first affinity moiety, wherein the other strand of the first partial double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the first partial double-stranded nucleic acid molecule and operably linked to the 3'-end of the target nucleic acid molecule, a substrate-specific domain hybridizing to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, wherein the second complex comprises a second partial double-stranded nucleic acid molecule, wherein one strand of the second partial double-stranded nucleic acid molecule comprises: a target-specific domain hybridizing to a second part of the target nucleic acid, wherein the first part and the second part do not overlap, and a duplex domain annealing to the other strand of the second partial double-stranded nucleic acid molecule, wherein the other strand of the second partial double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the second partial double-stranded nucleic acid molecule and operably linked to the 5'-end of the target nucleic acid molecule, a sample-specific domain identifying the biological sample from which the target nucleic acid is obtained, and a first cleavable moiety located between the duplex domain and the sample-specific domain.

[0027] The present disclosure provides a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecular complexes, wherein the first complex comprises a first partial double-stranded nucleic acid molecule, wherein one strand of the first partial double-stranded nucleic acid molecule comprises: a target-specific domain hybridizing to a first part of the target nucleic acid molecule, a duplex domain annealing to the other strand of the first partial double-stranded nucleic acid molecule, and at least one first affinity moiety, wherein the other strand of the first partial double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the first partial double-stranded nucleic acid molecule and operably linked to the 3'-end of the target nucleic acid molecule, a substrate-specific domain hybridizing to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, wherein the second complex comprises a second partial double-stranded nucleic acid molecule, wherein one strand of the second partial double-stranded nucleic acid molecule comprises: a target-specific domain hybridizing to a second part of the target nucleic acid, wherein the first part and the second part do not overlap, and a duplex domain annealing to the other strand of the second partial double-stranded nucleic acid molecule, wherein the other strand of the second partial double-stranded nucleic acid molecule comprises: a duplex domain annealing to the other strand of the second partial double-stranded nucleic acid molecule and operably linked to the 5'-end of the target nucleic acid molecule.

[0028] The present disclosure also provides a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, and wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0029] The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment sites determine the position and identity of at least six nucleotides in the target nucleic acid bound by the target binding domain, and wherein the at least three attachment sites each have a different nucleic acid sequence.

[0030] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein each attachment site of the at least three attachment sites corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment sites each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment sites determines the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0031] The present disclosure provides a complex comprising: a) a composition comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the position and identity of at least six nucleotides in the target nucleic acid bound by the target binding domain, and wherein the at least three attachment positions each have a different nucleic acid sequence; and a first complementary primary nucleic acid molecule that hybridizes to a first attachment position of the at least three attachment positions, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment position of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the cleavable linker is and wherein the cleavable linker is located between the first domain and the second domain.

[0032] The present disclosure provides methods for determining the nucleotide sequence of a nucleic acid, which include (1) hybridizing the target-binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid, the target nucleic acid optionally being immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (6) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to at least six nucleotides of the target-binding domain of the first sequencing probe based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label, and at least one sixth detectable label.

[0033] The present disclosure provides methods for determining the nucleotide sequence of a nucleic acid, comprising (1) hybridizing the target-binding domain of a first sequencing probe of claim 113 or 114 to a target nucleic acid optionally immobilized at one or more positions to a substrate; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) identifying the positions and identities of a first nucleotide and a second nucleotide in the optionally immobilized target nucleic acid hybridized to two of at least six nucleotides of the target-binding domain based on the identities of at least one first detectable label and at least one second detectable label; (5) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (6) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (7) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (8) identifying the positions and identities of a third nucleotide and a fourth nucleotide in the optionally immobilized target nucleic acid hybridized to two of at least six nucleotides of the target-binding domain based on the identities of at least one third detectable label and at least one fourth detectable label; (9) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (10) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of at least three attachment positions of the barcode domain; (11) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (12) identifying the positions and identities of a fifth nucleotide and a sixth nucleotide in the optionally immobilized target nucleic acid hybridized to two of at least six nucleotides of the target-binding domain based on the identities of at least one fifth detectable label and at least one sixth detectable label; thereby determining the nucleotide sequence of at least six nucleotides of an optionally immobilized target nucleic acid hybridized to at least six nucleotides of the target-binding domain of the first sequencing probe.

[0034] The present disclosure also provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, which includes: (1) hybridizing the target-binding domain of a first sequencing probe of the present disclosure to a first region of the target nucleic acid, wherein the target nucleic acid is optionally immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of at least three attachment positions of the barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (6) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby determining the presence of the predetermined nucleotide sequence based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label, and at least one sixth detectable label.

[0035] The present disclosure provides a kit comprising: (A) a first nucleic acid molecule complex comprising a first partial double-stranded nucleic acid molecule, wherein one strand of the first partial double-stranded nucleic acid molecule comprises: a target-specific domain that hybridizes to a first part of a target nucleic acid molecule, a duplex domain that anneals to the other strand of the first partial double-stranded nucleic acid molecule, and at least one first affinity moiety, and wherein the other strand of the first partial double-stranded nucleic acid molecule comprises: a duplex domain that anneals to the other strand of the first partial double-stranded nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, and (B) a second nucleic acid molecule complex comprising a second partial double-stranded nucleic acid molecule, wherein one strand of the second partial double-stranded nucleic acid molecule comprises: a target-specific domain that hybridizes to a second part of the target nucleic acid, wherein the first part and the second part do not overlap, and a duplex domain that anneals to the other strand of the second partial double-stranded nucleic acid molecule, and wherein the other strand of the second partial double-stranded nucleic acid molecule comprises: a duplex domain that anneals to the other strand of the second partial double-stranded nucleic acid molecule, a sample-specific domain that identifies the biological sample from which the target nucleic acid is obtained, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample-specific domain, and a second cleavable moiety located between the sample-specific domain and the first single-stranded purification sequence.

[0036] The present disclosure also provides a kit comprising: (A) a first single-stranded nucleic acid molecule comprising: a target-specific domain that hybridizes to a first part of a target nucleic acid molecule, a duplex domain that anneals to the duplex domain of a second single-stranded nucleic acid molecule, and at least one first affinity moiety, (B) a second single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the first single-stranded nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, (C) a third single-stranded nucleic acid molecule comprising: a target-specific domain that hybridizes to a second part of the target nucleic acid, wherein the first part and the second part do not overlap, and a duplex domain that anneals to the duplex domain of a fourth single-stranded nucleic acid molecule, (D) a fourth single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the third single-stranded nucleic acid molecule, a sample-specific domain that identifies the biological sample from which the target nucleic acid is obtained, a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample-specific domain, and a second cleavable moiety located between the sample-specific domain and the first single-stranded purification sequence.

[0037] Any of the above aspects can be combined with any other aspect.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this specification, unless the context clearly dictates otherwise, the singular forms also include the plural; for example, the terms "a", "an", and "the" are to be construed as singular or plural, and the term "or" is to be construed as inclusive. For example, "element" means one or more elements. Throughout the specification, the word "comprising" or variations such as "comprises" or "comprising" shall be understood to imply the inclusion of the stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of any other element, integer, or step, or group of elements, integers, or steps. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise explicitly stated from the context, all numerical values provided herein are modified by the term "about".

[0039] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not admitted to be prior art to the present invention. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of this disclosure will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The patent or application document contains at least one drawing in color. Copies of the patent or patent application publication with color drawings will be provided by the patent office upon request and payment of the necessary fees.

[0041] When combined with the drawings, the above and further features will be more clearly understood in light of the following detailed description.

[0042] Figure 1 is an illustration of an exemplary sequencing probe of this disclosure.

[0043] Figure 2 shows the design of the standard, three-part sequencing, and single-part adaptor probes of this disclosure.

[0044] Figure 3 is an illustration of an exemplary reporter complex of this disclosure hybridized to an exemplary sequencing probe of this disclosure.

[0045] Figure 4Shows a schematic diagram of an exemplary reporting probe of the present disclosure.

[0046] Figure 5 Is a schematic diagram of several exemplary reporting probes of the present disclosure that contain different arrangements of tertiary nucleic acids.

[0047] Figure 6 Is a schematic diagram of several exemplary reporting probes of the present disclosure that contain branched tertiary nucleic acids.

[0048] Figure 7 Shows the possible positions of cleavable linker modifications within an exemplary reporting probe of the present disclosure.

[0049] Figure 8 Is a schematic diagram of capturing a target nucleic acid using the dual-capture probe system of the present disclosure.

[0050] Figure 9 Shows the experimental results of capturing and detecting a multiplex cancer panel consisting of 100 targets using FFPE samples and the method of the present invention.

[0051] Figure 10 Is a schematic diagram of a single cycle of the sequencing method of the present disclosure.

[0052] Figure 11 Is a schematic diagram of a cycle of the sequencing method of the present disclosure and the corresponding imaging data collected during that cycle.

[0053] Figure 12 Illustrates an exemplary sequencing probe pool configuration of the present disclosure, where eight color combinations are used to design eight different sequencing probe pools.

[0054] Figure 13 Compares the barcode domain design disclosed in U.S. 2016 / 019470 with the barcode domain design of the present disclosure.

[0055] Figure 14 Is a schematic diagram of a sequencing cycle of the present disclosure, where cleavable linker modifications are used to darken barcode positions.

[0056] Figure 15 Is an illustrative example of an exemplary sequencing cycle of the present disclosure, where positions within the barcode domain are darkened by replacement of primary nucleic acids.

[0057] Figure 16 Is a schematic diagram of how the sequencing method of the present disclosure allows the same base of a target nucleic acid to be sequenced with different sequencing probes.

[0058] Figure 17Shows how multiple base calls at specific nucleotide positions on a target nucleic acid, recorded from one or more sequencing probes, can be combined to produce a consensus sequence, thereby increasing the accuracy of the final base calls.

[0059] Figure 18 Shows the results of a sequencing experiment obtained using the sequencing method of the present disclosure and analyzed using an assembly algorithm. For the graphs on the left, moving clockwise starting from the upper left graph, the sequences shown correspond to SEQ ID NO: 3, 4, 6, 8, 7, and 5. For the table on the upper right, moving down from the top, the sequences correspond to SEQ ID NO: 3, 4, 7, 8, 6, and 5.

[0060] Figure 19 Shows a schematic of the experimental design for multiplexed capture and sequencing of oncogene targets from FFPE samples.

[0061] Figure 20 Shows an illustrative schematic of direct RNA sequencing and the results of an experiment testing the compatibility of test RNA molecules with the sequencing method of the present disclosure.

[0062] Figure 21 Shows sequencing of RNA molecules and DNA molecules having the same nucleotide sequence using the sequencing method of the present disclosure.

[0063] Figure 22 Shows a performance comparison of the standard and three-part sequencing probes of the present disclosure.

[0064] Figure 23 Shows the effect of LNA substitutions within an exemplary target binding domain of the present disclosure using individual probes.

[0065] Figure 24 Shows the effect of LNA substitutions within an exemplary target binding domain of the present disclosure using a pool of nine probes.

[0066] Figure 25 Shows the effect of modified nucleotide and nucleic acid analogue substitutions within an exemplary target binding domain of the present disclosure.

[0067] Figure 26 Shows the results of an experiment quantifying the raw accuracy of the sequencing method of the present disclosure.

[0068] Figure 27 Shows the results of an experiment determining the accuracy of the sequencing method of the present disclosure when sequencing nucleotides in a target nucleic acid with more than one sequencing probe.

[0069] Figure 28Schematic diagram of a sequencing probe of the present disclosure that includes a pocket oligo.

[0070] Figure 29 Schematic diagram of a sequencing probe of the present disclosure that includes a PEG linker region between each attachment position.

[0071] Figure 30 Schematic diagram of a sequencing probe of the present disclosure that includes an abasic region between each attachment position.

[0072] Figure 31 Illustration of an exemplary reporter complex of the present disclosure that indirectly hybridizes to an exemplary sequencing probe of the present disclosure via a linker oligo.

[0073] Figure 32 Illustration of a parity scheme used in the methods of the present disclosure.

[0074] Figure 33 Schematic diagram of a capture probe, linker oligo, and lawn oligonucleotide complex of the present invention.

[0075] Figure 34 Schematic diagram of a c5 probe complex and a c3 probe complex of the present disclosure hybridized to a target nucleic acid.

[0076] Figure 35 Schematic diagram of a target nucleic acid - c3 probe - c5 probe complex of the present disclosure after digestion with FEN1.

[0077] Figure 36 Schematic diagram of a target nucleic acid - c3 probe - c5 probe complex of the present disclosure after ligation.

[0078] Figure 37 Schematic diagram of USER-mediated cleavage of a target nucleic acid - c3 probe - c5 probe complex of the present disclosure.

[0079] Figure 38 Schematic diagram of a target nucleic acid - c3 probe - c5 probe complex of the present disclosure after USER-mediated cleavage.

[0080] Figure 39 Schematic diagram of UV-mediated cleavage of a target nucleic acid - c3 probe - c5 probe complex of the present disclosure.

[0081] Figure 40Schematic of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure after UV-mediated cleavage, attached to a substrate via complementary nucleic acids.

[0082] Figure 41 Schematic of the c3.2 probe complex and c5.2 probe complex of the present disclosure hybridized to a target nucleic acid.

[0083] Figure 42 Schematic of the target nucleic acid complex of the present disclosure after ligation of the c3.2 and c5.2 probe complexes.

[0084] Figure 43 Schematic of the cleavage and release of single-stranded purification sequences in the target nucleic acid complex of the present disclosure.

[0085] Figure 44 Schematic of the target nucleic acid complex of the present disclosure immobilized on a substrate of the present disclosure.

[0086] Figure 45 Schematic of the cleavage and release of the substrate-specific domain after immobilization of the target nucleic acid complex of the present disclosure on a substrate of the present disclosure.

[0087] Figure 46 Schematic of the target nucleic acid complex of the present disclosure after release of the substrate-specific domain immobilized on a substrate of the present disclosure.

[0088] Figure 47 Schematic cross-section of an exemplary array of the present invention.

[0089] Figure 48 Schematic cross-section of an exemplary array of the present invention, the array including nanopores having a pyramid shape.

[0090] Figure 49 Schematic illustration of an exemplary array of the present disclosure, the array including a plurality of cylindrical nanopores arranged in a random pattern.

[0091] Figure 50 Schematic illustration of an exemplary array of the present disclosure, the array including cylindrical nanopores arranged in an ordered grid at a constant spacing.

[0092] Figure 51 Schematic cross-section of an exemplary array of the present invention, where a single target nucleic acid complex is immobilized in each nanopore.

[0093] Figure 52 Schematic cross-section of an exemplary array of the present invention, where a single target nucleic acid complex is immobilized in each nanopore, thereby preventing the immobilization of other target nucleic acid complexes.

[0094] Figure 53 is a schematic diagram of a sequencing probe of the present disclosure, the sequencing probe being composed entirely of L-DNA and comprising an attachment region having a 3'-terminal L-dG nucleotide.

[0095] Figure 54 is a schematic diagram of a sequencing probe of the present disclosure, the sequencing probe being composed entirely of D-DNA and comprising pocket oligonucleotides between attachment region 1 (spot 1) and attachment region 2 (spot 2), and between attachment region 2 (spot 2) and attachment region 3 (spot 3).

[0096] Figure 55 is a schematic diagram of a synthetic target nucleic acid immobilized on a solid substrate using a capture probe and a lawn oligonucleotide in combination with a protein lock.

[0097] Figure 56 is a series of graphs showing the results of a sequencing experiment using the LG-spacer sequencing probe and the D-pocket sequencing probe of the present disclosure. The x-axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, the observed sequencing diversity, and the observed sequencing coverage for the LG-spacer and D-pocket sequencing probes. The red box indicates the predicted problematic sequencing regions.

[0098] Figure 57 is a series of graphs showing the results of a sequencing experiment using the LG-spacer sequencing probe and the D-pocket sequencing probe of the present disclosure. The x-axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, the observed sequencing diversity, and the observed sequencing coverage for the LG-spacer and D-pocket sequencing probes. The red box indicates the predicted problematic sequencing regions.

[0099] Figure 58 is a series of graphs showing the results of a sequencing experiment using the LG-spacer sequencing probe and the D-pocket sequencing probe of the present disclosure. The x-axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the theoretical sequencing diversity, the observed sequencing diversity, and the observed sequencing coverage for the LG-spacer and D-pocket sequencing probes. The red box indicates the predicted problematic sequencing regions.

[0100] Figure 59 is a series of graphs showing the results of a sequencing experiment using the LG-spacer sequencing probe and the D-pocket sequencing probe of the present disclosure. The x-axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and the observed sequencing coverage for the LG-spacer and D-pocket sequencing probes.

[0101] Figure 60 A series of graphs showing the results of sequencing experiments using the LG - spacer sequencing probes and D - pocket sequencing probes of the present disclosure. The x - axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and observed sequencing coverage for the LG - spacer and D - pocket sequencing probes.

[0102] Figure 61 A series of graphs showing the results of sequencing experiments using the LG - spacer sequencing probes and D - pocket sequencing probes of the present disclosure. The x - axis indicates the specific nucleotides of the target nucleic acid to be sequenced. The top graph shows the observed sequencing diversity and observed sequencing coverage for the LG - spacer and D - pocket sequencing probes.

[0103] Figure 62 A series of histograms showing the total number of barcode events and the number of valid 3 - site reads in sequencing experiments using the LG - spacer sequencing probes and D - pocket sequencing probes of the present disclosure.

[0104] Figure 63 A series of graphs showing the total number of on - target events, invalid events, off - target events, 1 error at b1 - b6 events, 2 errors at b1 - b6 events, 3 errors at b1 - b6 events, 4 errors at b1 - b6 events, 5 errors at b1 - b6 events, and 6 errors at b1 - b6 events in sequencing experiments using the LG - spacer sequencing probes and D - pocket sequencing probes of the present disclosure.

[0105] Figure 64 A series of graphs showing the total number of on - target events, invalid events, off - target events, 1 error at b1 - b6 events, 2 errors at b1 - b6 events, 3 errors at b1 - b6 events, 4 errors at b1 - b6 events, 5 errors at b1 - b6 events, and 6 errors at b1 - b6 events in sequencing experiments using the LG - spacer sequencing probes and D - pocket sequencing probes of the present disclosure.

[0106] Figure 65 A graph showing the number of events for 1 spotter (only one of the three possible reporter probes was successfully recorded), 2 spotters (only two of the three possible reporter probes were successfully recorded), and 3 spotters (all three possible reporter probes were successfully recorded) in each cycle of a sequencing experiment using the D - pocket sequencing probes (cycles 1 - 50) and LG - spacer sequencing probes (cycles 51 - 100) of the present disclosure.

[0107] Figure 66A series of graphs showing the results of sequencing experiments using the LG-spacer sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost graph shows the number of on-target, new hexamers, redundant hexamers, off-target, and invalid events recorded in each cycle of the sequencing experiment. Cycles 1-50 were performed using D-pocket sequencing probes, and cycles 51-100 were performed using the LG-spacer sequencing probes of the present disclosure.

[0108] Figure 67 A schematic diagram of immobilizing a target nucleic acid to a solid substrate using the methods and compositions of the present disclosure. The target nucleic acid is immobilized using a protein lock between the biotin moieties located on the capture probe and the lawn oligonucleotide and the neutravidin moieties. Detailed Description The present disclosure provides sequencing probes, reporter probes, methods, kits, and devices that provide rapid enzyme-free, amplification-free, and library-free nucleic acid sequencing with long read lengths and low error rates.

[0110] Compositions of the present disclosure The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. Exemplary target binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify the corresponding nucleotides in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue, and wherein the at least two nucleotides in the target binding domain that do not identify the corresponding nucleotides in the target nucleic acid molecule can be any of the four canonical bases that are non-specific to the target determined by the at least six nucleotides in the target binding domain, or a universal base or a degenerate base. Exemplary barcode domains include a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0111] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; and wherein any of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue.

[0112] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0113] The present disclosure also provides a population of sequencing probes comprising a plurality of any of the sequencing probes disclosed herein.

[0114] The target binding domain, barcode domain and backbone of the disclosed sequencing probes, and complementary nucleic acid molecules (e.g., reporter molecules or reporter complexes), are described in more detail below.

[0115] The sequencing probes of the present disclosure comprise a target binding domain and a barcode domain. Figure 1 is a schematic diagram of an exemplary sequencing probe of the present disclosure. Figure 1 It shows that the target binding domain is capable of binding to a target nucleic acid. The target nucleic acid can be any nucleic acid to which the sequencing probe of the present disclosure can hybridize. The target nucleic acid can be DNA or RNA. The target nucleic acid can be obtained from a biological sample from a subject. The terms "target binding domain" and "sequencing domain" are used interchangeably herein.

[0116] The target binding domain can comprise a series of nucleotides (e.g., is a polynucleotide). The target binding domain can comprise DNA, RNA, or a combination thereof. Where the target binding domain is a polynucleotide, the target binding domain binds to the target nucleic acid by hybridizing to a portion of the target nucleic acid that is complementary to the target binding domain of the sequencing probe, as Figure 1as shown in

[0117] The target binding domain of a sequencing probe can be designed to control the likelihood and / or rate at which the sequencing probe hybridizes and / or dissociates from the target. Generally, the lower the Tm of a probe, the faster and more likely it is for the probe to dissociate from the target nucleic acid. Thus, using probes with a lower Tm will reduce the number of probes bound to the target nucleic acid.

[0118] The length of the target binding domain partially affects the likelihood that the probe hybridizes to and remains hybridized to the target nucleic acid. Generally, the longer the target binding domain (more nucleotides), the less likely it is that a complementary sequence is present in the target nucleotides. Conversely, the shorter the target binding domain, the more likely it is that a complementary sequence is present in the target nucleotides. For example, the probability that a tetramer sequence is located in a target nucleic acid is 1 / 256, while the probability that a hexamer sequence is located in a target nucleic acid is 1 / 4096. Thus, a set of shorter probes may bind at more positions in a given nucleic acid segment compared to a set of longer probes.

[0119] In many cases, probes with shorter target binding domains are preferred to increase the number of reads in a given nucleic acid segment, thereby enriching the coverage of the target nucleic acid or a portion of the target nucleic acid, particularly a portion of particular interest, such as when detecting mutations or SNP alleles.

[0120] The target binding domain can be any length in terms of the number or amount of nucleotides. The target binding domain can be at least 12 nucleotides in length, at least 10 nucleotides in length, at least 8 nucleotides in length, at least 6 nucleotides in length, or at least 3 nucleotides in length.

[0121] Each nucleotide in the target binding domain can identify (or code for) a complementary nucleotide of the target molecule. Alternatively, some nucleotides in the target binding domain identify (or code for) a complementary nucleotide of the target molecule, while some nucleotides in the target binding domain do not identify (or code for) a complementary nucleotide of the target molecule.

[0122] The target binding domain can include at least one natural base. The target binding domain can exclude natural bases. The target binding domain can include at least one modified nucleotide or nucleic acid analogue. The target binding domain can exclude modified nucleotides or nucleic acid analogues. The target binding domain can include at least one universal base. The target binding domain can exclude universal bases. The target binding domain can include at least one degenerate base. The target binding domain can exclude degenerate bases.

[0123] The target domain can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural bases), modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides or nucleic acid analogs), universal bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more universal bases), or degenerate bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more degenerate bases). When present in combination, the natural bases, modified nucleotides or nucleic acid analogs, universal bases, and degenerate bases of a particular target binding domain can be arranged in any order.

[0124] The term "modified nucleotide" or "nucleic acid analog" includes, but is not limited to, locked nucleic acid (LNA), bridged nucleic acid (BNA), propyne-modified nucleic acid, and zip nucleic acid isoGuanine, isoCytosine, 6-amino-1-(4-hydroxy-5-hydroxymethyl-tetrahydrofuran-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG), and 2'-modified nucleic acids such as 2'-O-methyl nucleic acids. The target binding domain can include zero to six (e.g., 0, 1, 2, 3, 4, 5, or 6) modified nucleotides or nucleic acid analogs. Preferably, the modified nucleotide or nucleic acid analog is locked nucleic acid (LNA).

[0125] As used herein, the term "locked nucleic acid (LNA)" includes, but is not limited to, modified RNA nucleotides in which the ribose moiety contains a methylene bridge connecting the 2'-oxygen and 4'-carbon. Such a methylene bridge locks the ribose in a C3'-endo conformation (also known as the North conformation, which is found in A-form RNA duplexes). The term inaccessible RNA can be used interchangeably with LNA. As used herein, the term "bridged nucleic acid (BNA)" includes, but is not limited to, modified RNA molecules that contain a five- or six-membered bridging structure with a fixed 3'-endo conformation (also known as the North conformation). The bridging structure connects the 2'-oxygen of the ribose to the 4'-carbon of the ribose. A variety of different bridging structures containing carbon, nitrogen, and hydrogen atoms are possible. As used herein, the term "propyne-modified nucleic acid" includes, but is not limited to, pyrimidines containing a propyne modification at the C5 position of the nucleic acid base, i.e., cytosine and thymine / uracil. As used herein, the term "zip nucleic acid" includes, but is not limited to, oligonucleotides conjugated to a cationic spermine moiety.

[0126] As used herein, the term "universal base" includes, but is not limited to, nucleobases that do not follow Watson-Crick base-pairing rules, but can pair with any of the four canonical bases (A, T / U, C, G) located on a target nucleic acid. As used herein, the term "degenerate base" includes, but is not limited to, nucleobases that do not follow Watson-Crick base-pairing rules, but can pair with at least two, but not all four, of the four canonical bases (A, T / U, C, G). Degenerate bases may also be referred to as wobble bases; these terms are used interchangeably herein.

[0127] Figure 1 The exemplary sequencing probe depicted in shows a target-binding domain that contains a six-nucleotide length (hexamer) sequence (b1-b2-b3-b4-b5-b6) that specifically hybridizes to complementary nucleotides 1-6 of the target nucleic acid to be sequenced. This hexameric portion (b1-b2-b3-b4-b5-b6) of the target-binding domain identifies (or encodes) the complementary nucleotides (1-2-3-4-5-6) in the target sequence. This hexamer sequence is flanked on either side by a base (N). The base indicated by (N) can independently be a universal base or a degenerate base. Typically, the base indicated by (N) is independently one of the canonical bases. The base indicated by (N) does not identify (or encode) the complementary nucleotide to which it binds in the target sequence and is independent of the nucleic acid sequence of the (hexamer) sequence (b1-b2-b3-b4-b5-b6).

[0128] Figure 1 The sequencing probe depicted in can be used in conjunction with the sequencing methods of the present disclosure to sequence a target nucleic acid using only hybridization reactions, without the need for covalent chemistry, enzymes, or amplification. To sequence all possible hexamer sequences in a target nucleic acid molecule, a total of 4096 sequencing probes (4^6 = 4096) are required.

[0129] Figure 1This is an example of one configuration of the target-binding domain of the sequence probes of the present disclosure. Table 1 provides several other configurations of the target-binding domain of the present disclosure. A preferred target-binding domain, referred to as the "6LNA" target-binding domain, contains 6 LNAs at positions b1 to b6 of the target-binding domain. These 6 LNAs are flanked on either side by bases (N). As used herein, the (N) bases can be universal / degenerate bases or canonical bases of a nucleic acid sequence independent of the (hexamer) sequence (b1-b2-b3-b4-b5-b6). In other words, although the bases b1-b2-b3-b4-b5-b6 may be specific for any given target sequence, the (N) bases can be universal / degenerate bases, or can consist of any of the four canonical bases that are not specific for the target determined by the bases b1-b2-b3-b4-b5-b6. For example, if the target sequence to be queried is CAGGCATA, the bases b1-b2-b3-b4-b5-b6 of the target-binding domain will be TCCGTA, and each (N) base of the target-binding domain can independently be A, C, T, or G, such that the resulting target-binding domain can have a sequence such as ATCCGTAG, TTCCGTAC, GTCCGTAG, or any of the other 16 possible iterations. Alternatively, two (N) bases can be before the 6 LNAs. Alternatively still, two (N) bases can be after the 6 LNAs.

[0130] Table 1 b = natural base; += modified nucleotide or nucleotide analogue (e.g., LNA, 2'-O-methyl modified base, 6-amino-1-(4-hydroxy-5-hydroxymethyl-tetrahydrofuran-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG)); N = natural, universal or degenerate base; Q is a minor groove binder (e.g., Twisted Intercaling Nucleic Acid, MGB-BP3, Brostallicin) Table 1 also describes a "decamer" target-binding domain containing 10 natural, target-specific bases. Table 1 also describes an "octamer" target-binding domain containing 8 natural, target-specific bases.

[0131] Table 1 further describes the "Natural I" target binding domain that contains 6 natural bases at positions b1 to b6. These 6 natural bases are flanked by 2 (N) bases on either side. Alternatively, all four (N) bases can be before the 6 natural bases. Alternatively still, all four (N) bases can be after the 6 natural bases. Any number (i.e., 1, 2, 3, or 4) of the four (N) bases can be before the 6 natural bases, while the remaining (N) bases are after the 6 natural bases.

[0132] Table 1 further describes the "Natural II" target binding domain that contains 6 natural bases at positions b1 to b6. These 6 natural bases are flanked by (N) bases on either side. Alternatively, both of the two (N) bases can be before the 6 natural bases. Alternatively still, both of the two (N) bases can be after the 6 natural bases. Generally, the (N) bases of the Natural II binding domain are degenerate bases.

[0133] Table 1 also describes the "2LNA" target binding domain, which contains a combination of 2 LNAs and 4 natural bases at positions b1 to b6 of the target binding domain. The 2 LNAs and 4 natural bases can be present in any order. For example, positions b3 and b4 can be LNAs, while positions b1, b2, b5, and b6 are natural bases. Bases b1 to b6 are flanked by (N) bases on either side. Alternatively, bases b1 to b6 can be preceded by two (N) bases. Alternatively still, bases b1 to b6 can be followed by two (N) bases.

[0134] Table 1 further describes the "4LNA" target binding domain, which contains a combination of 4 LNAs and 2 natural bases at positions b1 to b6 of the target binding domain. The 4 LNAs and 2 natural bases can be present in any order. For example, positions b2 to b5 can be LNAs, while positions b1 and b6 are natural bases. Bases b1 to b6 are flanked by (N) bases on either side. Alternatively, bases b1 to b6 can be preceded by two (N) bases. Alternatively still, bases b1 to b6 can be followed by two (N) bases.

[0135] Table 1 further describes the "6LNA" target binding domain, which contains 6 LNAs at positions b1 to b6 of the target binding domain. Bases b1 to b6 can be flanked by (N) bases on either side.

[0136] Table 1 further describes the "octamer with LNA" target binding domain, which individually contains natural bases or LNAs anywhere among positions b1 to b6 of the target binding domain. Bases b1 to b6 can be flanked by (N) bases on either side.

[0137] The target-binding domain can also include a minor groove binder moiety. A minor groove binder moiety is a chemical modification of an oligonucleotide that adds a chemical moiety that can bind to the minor groove of the target nucleotide to which the oligonucleotide hybridizes. Without being bound by theory, the inclusion of a minor groove binder moiety increases the affinity of the target-binding domain for the target nucleic acid and increases the melting temperature of the target-binding domain-target nucleic acid duplex. The higher binding affinity can permit the use of a smaller target-binding domain.

[0138] The target-binding domain can also include one or more tethered intercalating nucleic acids (TINA). TINA is a nucleic acid molecule that stabilizes the formation of Hoogsteen triple-stranded DNA from double-stranded oligonucleotides and triplex-forming oligonucleotides. TINA can be used to stabilize double-stranded oligonucleotides, thereby improving the specificity and sensitivity of oligonucleotide probes for target nucleic acids.

[0139] The target-binding domain can further include a nucleic acid molecule comprising 2'-O-methyl modified bases. 2'-O-methyl modified bases are nucleoside modifications of RNA in which a methyl group is added to the 2'-hydroxyl of the ribose to produce 2'-methoxy. 2'-O-methyl modified bases provide excellent protection against base hydrolysis and digestion by nucleases. Without being bound by theory, the addition of 2'-O-methyl modified bases also increases the melting temperature of the nucleic acid duplex.

[0140] The target-binding domain can also include a covalently linked stilbene modification. Stilbene modifications can increase the stability of nucleic acid duplexes.

[0141] The sequencing probes of the present disclosure comprise a synthetic backbone. The target-binding domain, also described herein as the sequencing domain, is operably linked to the barcode domain. The target-binding domain and the barcode domain can be covalently attached as part of a single synthetic backbone. The target-binding domain and the barcode domain can be attached via a linker (e.g., a nucleic acid linker, a chemical linker). The synthetic backbone can comprise any material, such as a polysaccharide, polynucleotide, polymer, plastic, fiber, peptide, peptide nucleic acid, or polypeptide. Preferably, the synthetic backbone is rigid. The synthetic backbone can comprise a single-stranded DNA molecule. The backbone can comprise a "DNA origami" of six DNA double helices (see, e.g., Lin et al., "Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA." Nature Chemistry; 2012 Oct; 4(10):832-9). The barcode can be prepared from DNA origami tiles (Jungmann et al., "Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT", Nature Methods, Volume 11, Number 3, 2014).

[0142] The sequencing probes of the present disclosure can comprise a partially double-stranded synthetic backbone. The sequencing probe can comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target-binding domain and the barcode domain. The double-stranded DNA spacer can comprise at least one modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues that can be used in the double-stranded DNA spacer are isoguanine and isocytosine. Alternatively, each nucleic acid comprising the double-stranded DNA spacer can independently be L-DNA. In some aspects, the double-stranded DNA spacer can comprise L-DNA. The double-stranded DNA spacer can consist of L-DNA. The double-stranded DNA spacer can consist essentially of L-DNA.

[0143] The double-stranded DNA spacer can comprise a length of from about 1 nucleotide to about 100 nucleotides. The double-stranded DNA spacer can comprise a length of about 25 nucleotides.

[0144] The synthetic backbone can comprise L-DNA. The synthetic backbone can consist of L-DNA. The synthetic backbone can consist essentially of L-DNA. The single-stranded DNA synthetic backbone can comprise a length of from about 10 nucleotides to about 100 nucleotides. The single-stranded DNA synthetic backbone can comprise a length of about 52 nucleotides. The single-stranded DNA synthetic backbone can comprise a length of about 27 nucleotides.

[0145] The barcode domain can comprise L-DNA. The barcode domain can consist of L-DNA. The barcode domain can consist essentially of L-DNA. The barcode domain can comprise about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides. The barcode domain can be about 27 nucleotides in length, or about 52 nucleotides in length, or about 99 nucleotides in length, or about 74 nucleotides in length.

[0146] The sequencing probe can comprise a single-stranded DNA synthesis backbone and a polymer-based spacer between the target-binding domain and the barcode domain, which has mechanical properties similar to double-stranded DNA. Common polymer-based spacers include polyethylene glycol (PEG)-type polymers.

[0147] The double-stranded DNA spacer can be from about 1 nucleotide to about 100 nucleotides in length; from about 2 nucleotides to about 50 nucleotides in length; from about 20 nucleotides to about 40 nucleotides in length. Preferably, the double-stranded DNA spacer is about 36 nucleotides in length.

[0148] In Figure 2 the left figure shows a sequencing probe of the present disclosure, referred to as a "standard probe". Figure 2 The standard probe of Figure 2 contains a barcode domain covalently attached to the target-binding domain such that the target-binding domain and the barcode domain are present within the same single-stranded oligonucleotide. In

[0149] In an alternative aspect, each nucleic acid comprising a barcode domain and a region that binds to the stem oligonucleotide of the standard probe can be a canonical base or a modified nucleotide or nucleic acid analogue. Common modified nucleotides or nucleic acid analogues useful in the barcode domain and the region that binds to the stem oligonucleotide of the standard probe are isoguanine and isocytosine. Alternatively, each nucleic acid comprising a barcode domain and a region that binds to the stem oligonucleotide of the standard probe can independently be L-DNA. For example, the barcode domain and the region that binds to the stem oligonucleotide of the standard probe can consist entirely of L-DNA. In other instances, the barcode domain and the region that binds to the stem oligonucleotide of the standard probe can consist of L-DNA segments separated by abasic single-stranded nucleic acid segments or segments of polymers (such as PEG) that have mechanical properties similar to double-stranded DNA as further described below.

[0150] In Figure 2Another sequencing probe of the present disclosure, called a "3-part probe", is shown in the middle figure of Figure 2 The 3-part probe includes a barcode domain that is attached to a target-binding domain via a linker. In this example, the linker is a single-stranded stem oligonucleotide that hybridizes to a single-stranded oligonucleotide containing the target-binding domain and a single-stranded oligonucleotide containing the barcode domain, creating a 36-nucleotide double-stranded spacer region that bridges the barcode domain (18 nucleotides) and the target-binding domain (18 nucleotides). Using this exemplary probe configuration, each barcode can be designed such that it hybridizes to a unique stem sequence to prevent barcode domain exchange. Additionally, each barcode domain can also hybridize to its corresponding stem oligonucleotide before different sequencing probes are combined together.

[0151] In an alternative aspect, each nucleic acid comprising the single-stranded stem oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues for single-stranded stem oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising the single-stranded stem oligonucleotide can independently be L-DNA.

[0152] In an alternative aspect, each nucleic acid comprising the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can be a canonical base or a modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues for single-stranded stem oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can independently be L-DNA.

[0153] In an alternative aspect, each nucleic acid comprising the region on the single-stranded oligonucleotide containing the target-binding domain to which the single-stranded stem oligonucleotide hybridizes can be a canonical base or a modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues for single-stranded stem oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising the region on the single-stranded oligonucleotide containing the target-binding domain to which the single-stranded stem oligonucleotide hybridizes can independently be L-DNA.

[0154] In Figure 2 Another sequencing probe of the present disclosure, called a "1-part linker probe", is shown in the right figure of Figure 2 The 1-part linker probe includes a barcode domain that is attached to a target-binding domain via a linker. In this example, the linker is a PEG molecule. Alternatively, the linker can be a trans-stilbene. Alternatively, the linker can be any polymer with mechanical properties similar to double-stranded DNA. Commonly used polymer-based spacers include polyethylene glycol (PEG)-type polymers.

[0155] The sequencing probes of the present disclosure can comprise about 60 nucleotides. The sequencing probes of the present disclosure can comprise about 107 nucleotides. The sequencing probes of the present disclosure can be about 60 nucleotides in length, or about 107 nucleotides in length. The nucleotides constituting the sequencing probes can each individually be canonical bases, modified nucleotides, or nucleic acid analogs, including L-DNA and D-DNA.

[0156] The barcode domain includes a plurality of attachment positions, such as one, two, three, four, five, six, seven, eight, nine, ten or more attachment positions. The number of attachment positions can be less than, equal to, or more than the number of nucleotides in the target binding domain. The target binding domain can comprise more nucleotides than the number of attachment positions in the backbone domain, such as one, two, three, four, five, six, seven, eight, nine, ten or more nucleotides. The target binding domain can comprise eight nucleotides, and the barcode domain comprises three attachment positions. The target binding domain can comprise ten nucleotides, and the barcode domain comprises three attachment positions.

[0157] The length of the barcode domain is not limited, as long as there is sufficient space for at least three attachment positions, as described below. The terms "attachment position", "position", and "site" are used interchangeably herein. The terms "barcode domain" and "reporter domain" are used interchangeably herein.

[0158] Each attachment position in the barcode domain corresponds to two nucleotides (a dinucleotide) in the target binding domain, and thus corresponds to the complementary dinucleotide in the target nucleic acid that hybridizes to the dinucleotide in the target binding domain. As a non-limiting example, the first attachment position in the barcode domain corresponds to the first and second nucleotides in the target binding domain (e.g., Figure 1 , where R1 is the first attachment position in the barcode domain, and R1 corresponds to the dinucleotide b1 and b2 in the target binding domain - which in turn identifies dinucleotides 1 and 2 of the target nucleic acid); the second attachment position in the barcode domain corresponds to the third and fourth nucleotides in the target binding domain (e.g., Figure 1 , where R2 is the second attachment position in the barcode domain, and R2 corresponds to the dinucleotide b3 and b4 in the target binding domain - which in turn identifies dinucleotides 3 and 4 of the target nucleic acid); and the third attachment position in the barcode domain corresponds to the fifth and sixth nucleotides in the target binding domain (e.g., Figure 1, where R3 is the third attachment position in the barcode domain and R3 corresponds to the dinucleotides b5 and b6 in the target binding domain - which in turn identify dinucleotides 5 and 6 of the target nucleic acid). In a further non-limiting example, the first attachment position in the barcode domain, the second attachment position in the barcode domain, and the third attachment position in the barcode domain together correspond to the first through sixth nucleotides in the target binding domain (e.g., Figure 1 , where nucleotides b1 through b6 in the target binding domain - which in turn identify six nucleotides of the target nucleic acid).

[0159] Each attachment position in the barcode domain contains at least one attachment region, e.g., one to 50 or more attachment regions. Some positions in the barcode domain may have more attachment regions than other positions (e.g., the first attachment position may have three attachment regions while the second attachment position may have two attachment positions); alternatively, each position in the barcode domain has the same number of attachment regions. Each attachment position in the barcode domain may contain one attachment region. Each attachment position in the barcode domain may contain more than one attachment region. At least one of the at least three attachment positions in the barcode domain may contain a different number of attachment regions than the other two attachment positions in the barcode domain. In some aspects, each attachment position in the barcode domain may contain one attachment region.

[0160] Each attachment region contains at least one (i.e., one to fifty, e.g., ten to thirty) copy of a nucleic acid sequence capable of reversibly binding to a complementary nucleic acid molecule (e.g., DNA or RNA). The nucleic acid sequences of the attachment regions at a single attachment position may be identical; thus, the complementary nucleic acid molecules that bind to those attachment regions are identical. Alternatively, the nucleic acid sequences of the attachment regions at a position are non-identical; thus, the complementary nucleic acid molecules that bind to those attachment regions are non-identical.

[0161] The nucleic acid sequence comprising each attachment region in the barcode domain may be about 6 nucleotides to about 20 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 12 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 16 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 14 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 8 nucleotides in length. The nucleic acid sequence comprising each attachment region in the barcode domain may be about 9 nucleotides in length.

[0162] At least one nucleic acid sequence of an attachment position, an attachment region, or an attachment region may comprise at least one super T base (5-hydroxybutynyl-2'-deoxyuridine). At least one nucleic acid sequence of an attachment position, an attachment region, or an attachment region may comprise at least one 3'-terminal super T base (5-hydroxybutynyl-2'-deoxyuridine). At least one nucleic acid sequence of an attachment position, an attachment region, or an attachment region may comprise at least one 5'-terminal super T base (5-hydroxybutynyl-2'-deoxyuridine).

[0163] Each nucleic acid comprising each attachment region in a barcode domain may independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the attachment regions of the barcode domain may be modified nucleotides or nucleotide analogues. The typical ratio of modified nucleotides or nucleotide analogues to canonical bases in the barcode domain is from 1:2 to 1:8. Modified nucleotides or nucleic acid analogues commonly used in the attachment regions of the barcode domain are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of a reporter to an appropriate attachment region in the barcode domain while minimizing binding elsewhere (including to the target).

[0164] One or more attachment regions within a barcode domain may comprise L-DNA. L-DNA is the left-handed and mirror-image version of naturally occurring right-turning D-DNA. L-DNA is more stable and resistant to enzymatic digestion. Since L-DNA cannot hybridize with D-DNA, L-DNA can improve the binding efficiency and binding accuracy of a reporter to an appropriate attachment region in the barcode domain and prevent binding of the reporter to other sites on the sequencing probe. In some aspects, each nucleotide of at least one nucleic acid sequence of an attachment position may be L-DNA.

[0165] Each nucleic acid comprising each attachment region in a barcode domain may independently comprise an adenine, cytosine, guanine, or thymine base. Alternatively, each nucleic acid comprising each attachment region in a barcode domain may independently comprise an adenine, guanine, or thymine base.

[0166] Each nucleic acid sequence comprising each attachment region in the barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3'-terminal guanine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3'-terminal guanine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3'-terminal guanine nucleotide.

[0167] Each nucleic acid sequence comprising each attachment region in the barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5'-terminal guanine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5'-terminal guanine nucleotide. Each nucleic acid sequence comprising each attachment region in the barcode domain can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5'-terminal guanine nucleotide.

[0168] In some aspects, at least one attachment region in at least one attachment position of the barcode domain can comprise a 3'-terminal guanine nucleotide. In some aspects, at least one attachment region in at least two attachment positions of the barcode domain can comprise a 3'-terminal guanine nucleotide. In some aspects, at least one attachment region in at least three attachment positions of the barcode domain can comprise a 3'-terminal guanine nucleotide. The 3'-terminal guanine nucleotide can be L-DNA.

[0169] In some aspects, at least one attachment region in at least one attachment position of the barcode domain can comprise a 3'-terminal guanine nucleotide. In some aspects, at least one attachment region in at least two attachment positions of the barcode domain can comprise a 3'-terminal guanine nucleotide. In some aspects, at least one attachment region in at least three attachment positions of the barcode domain can comprise a 5'-terminal guanine nucleotide. The 3'-terminal guanine nucleotide can be L-DNA, such as L-deoxyguanosine (L-dG). The terminal L-dG nucleotide reduces cross-linking hybridization between attachment regions and / or attachment positions and maintains stability by providing base stacking interactions.

[0170] One or more attachment regions can be integrated with the polynucleotide backbone; i.e., the backbone is a single polynucleotide and the attachment regions are part of a single polynucleotide sequence. One or more attachment regions can be linked to a modified monomer (e.g., a modified nucleotide) in the synthetic backbone such that the attachment regions branch out from the synthetic backbone. An attachment site can contain more than one attachment region, where some attachment regions branch out from the synthetic backbone and some attachment regions are integrated with the synthetic backbone. At least one attachment region in at least one attachment site can be integrated with the synthetic backbone. Each attachment region in each of at least three attachment sites can be integrated with the synthetic backbone. At least one attachment region in at least one attachment site can branch out from the synthetic backbone. Each attachment region in each of at least three attachment sites can branch out from the synthetic backbone.

[0171] Each attachment site within the barcode domain corresponds to one of sixteen dinucleotides, i.e., adenine-adenine, adenine-thymine / uracil, adenine-cytosine, adenine-guanine, thymine / uracil-adenine, thymine / uracil-thymine / uracil, thymine / uracil-cytosine, thymine / uracil-guanine, cytosine-adenine, cytosine-thymine / uracil, cytosine-cytosine, cytosine-guanine, guanine-adenine, guanine-thymine / uracil, guanine-cytosine, or guanine-guanine. Thus, one or more attachment regions in a single attachment site located within the barcode domain correspond to one of the sixteen dinucleotides and contain a nucleic acid sequence specific for the dinucleotide to which the attachment region corresponds. Even though these positions within the barcode domain correspond to the same dinucleotide, attachment regions located at different attachment sites within the barcode domain contain unique nucleic acid sequences. For example, given that a sequencing probe of the present disclosure contains a target binding domain with a hexamer having the coding sequence A-G-A-G-A-C, the barcode domain of the sequencing probe will contain three positions, where the first attachment site corresponds to the adenine-guanine dinucleotide, the second attachment site corresponds to the adenine-guanine dinucleotide, and the third attachment site corresponds to the adenine-cytosine dinucleotide. Even though both attachment site 1 and attachment site 2 correspond to the dinucleotide adenine-guanine, the attachment region located at position one in the example probe contains a nucleic acid sequence unique relative to the attachment region located at position two. The sequences of the specific attachment sites are designed and tested such that the complementary nucleic acids of a particular attachment site do not interact with different attachment sites. Additionally, the nucleotide sequence of the complementary nucleic acid is not limited; preferably, it lacks substantial homology (e.g., 50% to 99.9%) to known nucleotide sequences; this limits the undesirable hybridization of the complementary nucleic acid and the target nucleic acid.

[0172] Figure 1Depicts an illustration of an exemplary sequencing probe of the present disclosure that includes an exemplary barcode domain. Figure 1 The exemplary barcode domain depicted in Figure 1 includes three attachment positions, R1, R2, and R3. Each attachment position corresponds to a specific dinucleotide present within a hexameric sequence (b1 to b6) of the target binding domain. In this example, R1 corresponds to positions b1 and b2, R2 corresponds to positions b3 and b4, and R3 corresponds to positions b5 and b6. Thus, each position decodes the specific dinucleotide present in the hexameric sequence of the target binding domain, allowing identification of the specific two bases (A, C, G, or T) present in each specific dinucleotide.

[0173] In Figure 1 the exemplary barcode domain depicted in Figure 1 , each attachment position includes a single attachment region integrated with the synthetic backbone. Each attachment region of the three attachment positions contains a specific nucleotide sequence that corresponds to the specific dinucleotide encoded by each attachment position. For example, attachment position R1 includes an attachment region having a specific sequence corresponding to the identity of the dinucleotide b1-b2.

[0174] The barcode domain can further include one or more binding regions. The barcode domain can include at least one single-stranded nucleic acid sequence adjacent to or flanking at least one attachment position. The barcode domain can include at least two single-stranded nucleic acid sequences adjacent to or flanking at least two attachment positions. The barcode domain can include at least three single-stranded nucleic acid sequences adjacent to or flanking at least three attachment positions. These flanking portions are referred to as "Toe-Hold", which can accelerate the exchange rate of oligonucleotides hybridizing adjacent to the Toe-Hold by providing additional binding sites for single-stranded oligonucleotides (e.g., "Toe-Hold" probes; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc. 2006, 128(37), pp. 12211-12220).

[0175] At least one attachment region within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least two attachment regions within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least three attachment regions within the barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence.

[0176] Any attachment region within the barcode domain can be separated from any adjacent attachment position by a double-stranded nucleic acid sequence referred to as a "pocket oligonucleotide". Figure 28Shows an example of a sequencing probe having a barcode domain that includes three attachment positions. Attachment position 1 is separated from adjacent attachment position 2 by a pocket oligonucleotide. Attachment position 2 is further separated from adjacent attachment position 3 by another pocket oligonucleotide.

[0177] Each nucleic acid containing a pocket oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analogue. Modified nucleotides or nucleic acid analogues commonly used in pocket oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid containing a pocket oligonucleotide can independently be L-DNA. The pocket oligomer can contain at least one super T base (5-hydroxybutynyl-2'-deoxyuridine). The pocket oligonucleotide can be about 25 nucleotides in length.

[0178] In some aspects, at least one, at least two, or at least three attachment positions in the barcode domain can be adjacent to at least one flanking double-stranded polynucleotide. At least one flanking double-stranded polynucleotide can contain at least one modified nucleotide or nucleic acid analogue. At least one flanking double-stranded polynucleotide can contain L-DNA. At least one flanking double-stranded polynucleotide can contain at least one super T base (5-hydroxybutynyl-2'-deoxyuridine). At least one flanking double-stranded polynucleotide can be about 25 nucleotides in length.

[0179] At least one attachment region within the barcode domain can be flanked on at least one side by any polymer having mechanical properties similar to double-stranded DNA. Commonly used polymer-based spacers include polyethylene glycol (PEG)-type polymers. At least two attachment regions within the barcode domain can be flanked on at least one side by any polymer having mechanical properties similar to double-stranded DNA. At least three attachment regions within the barcode domain can be flanked on at least one side by any polymer having mechanical properties similar to double-stranded DNA.

[0180] Any attachment region within the barcode domain can be separated from any adjacent attachment position by any polymer having mechanical properties similar to double-stranded DNA. Commonly used polymer-based spacers include polyethylene glycol (PEG)-type polymers. Figure 29 Shows an example of a sequencing probe having a barcode domain that includes three attachment positions. Attachment position 1 is separated from adjacent attachment position 2 by a PEG-linker. Attachment position 2 is further separated from adjacent attachment position 3 by another PEG-linker.

[0181] At least one attachment region within the barcode domain can be flanked on at least one side by a base-free single-stranded nucleic acid molecule. A base-free nucleic acid molecule is a nucleic acid molecule that has neither purine bases nor pyrimidine bases. At least two attachment regions within the barcode domain can be flanked on at least one side by a base-free single-stranded nucleic acid molecule. At least three attachment regions within the barcode domain can be flanked on at least one side by a base-free single-stranded nucleic acid molecule.

[0182] Any attachment region within the barcode domain can be separated from any adjacent attachment position by a base-free single-stranded nucleic acid molecule. Figure 30 An example of a sequencing probe with a barcode domain containing three attachment positions is shown. Attachment position 1 is separated from the adjacent attachment position 2 by a base-free single-stranded nucleic acid molecule. Attachment position 2 is further separated from the adjacent attachment position 3 by another base-free single-stranded nucleic acid molecule.

[0183] Any attachment region within the barcode domain can be separated from any adjacent attachment position by a 3'-terminal guanosine nucleotide. In some aspects, at least one attachment region of at least two attachment positions in the barcode domain can contain a 3'-terminal guanosine nucleotide. Figure 53 An example of a sequencing probe with a barcode domain containing three attachment positions is shown, where each attachment position is separated by a terminal L-G nucleotide. Attachment position 1 is separated from the adjacent attachment position 2 by an L-G nucleotide. Attachment position 2 is further separated from the adjacent attachment position 3 by another L-G nucleotide. Attachment position 3 is terminated with an L-G nucleotide at the 3’ end.

[0184] The sequencing probes of the present disclosure can have an overall length of from about 20 nanometers to about 50 nanometers (including the target binding domain, the barcode domain, and any optional domains). The backbone of the sequencing probe can be a polynucleotide molecule comprising about 120 nucleotides, about 60 nucleotides, about 52 nucleotides, or about 27 nucleotides.

[0185] The sequencing probe can comprise a cleavable linker modification. The cleavable linker modification can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or any number of cleavable moieties. Any cleavable linker modification or cleavable moiety known to those of skill in the art can be utilized. Non-limiting examples of cleavable linker modifications and cleavable moieties include, but are not limited to, UV-light cleavable linkers, reducing agent cleavable linkers, and enzymatically cleavable linkers. An example of an enzymatically cleavable linker is the insertion of deoxyuridine for cleavage by the USER TM enzyme. The cleavable linker modification can be located at any position along the length of the sequencing probe, including, but not limited to, the region between the target binding domain and the barcode domain.Figure 7 The right figure depicts exemplary cleavable linker modifications that can be incorporated into the probes of the present disclosure.

[0186] Reporting probe A nucleic acid molecule that binds (e.g., hybridizes) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of a sequencing probe of the present disclosure and that includes a (directly or indirectly) detectable label is herein referred to as a "reporter probe" or "reporter probe complex," and these terms are used interchangeably herein. Reporter probes can be DNA, RNA, or PNA. Preferably, the reporter probe is DNA.

[0187] A reporter probe can include at least two domains: a first domain capable of binding to at least one first complementary nucleic acid molecule, and a second domain capable of binding to a first detectable label and at least a second detectable label. Figure 3 A schematic diagram of an exemplary reporter probe of the present disclosure is shown, which binds to a first attachment position of the barcode domain of an exemplary sequencing probe. In Figure 3 , the first domain of the reporter probe (shown in shaded maroon) binds to the complementary nucleic acid sequence within the attachment position R1 of the barcode domain, while the second domain of the reporter probe (shown in gray) binds to two detectable labels (one green label and one red label).

[0188] Alternatively, a reporter probe can include at least two domains: a first domain capable of binding to at least one first complementary nucleic acid molecule, and a second domain capable of binding to at least one second complementary nucleic acid molecule. The at least one first complementary nucleic acid molecule and the at least one second complementary nucleic acid molecule can be different (having different nucleic acid sequences).

[0189] A "primary nucleic acid molecule" is a reporter probe that includes at least two domains: a first domain capable of binding (e.g., hybridizing) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of a sequencing probe, and a second domain that binds (e.g., hybridizes) to at least one additional complementary nucleic acid. A primary nucleic acid molecule can directly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of a sequencing probe. A primary nucleic acid molecule can indirectly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of a sequencing probe via a nucleic acid linker. Such a nucleic acid linker is referred to as a "linker oligonucleotide."

[0190] The linker oligonucleotide can comprise at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one first complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain, and a second domain capable of binding (e.g., hybridizing) to the first domain of the primary nucleic acid molecule. Figure 31 Shown is a sequencing probe bound to a reporter probe via a linker oligonucleotide.

[0191] Each nucleic acid comprising the first or second domain of the linker oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues for the first or second domain of the linker oligonucleotide are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the linker oligonucleotide to at least one complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of the sequencing probe, while minimizing binding elsewhere (including to the target). For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the second domain of the linker oligonucleotide to the appropriate first domain of the reporter probe, while minimizing binding elsewhere (including to the target). Alternatively, each nucleic acid comprising the first or second domain of the linker oligonucleotide can independently be L-DNA. In one example of the linker oligonucleotide, the first domain comprises D-DNA and the second domain comprises L-DNA. In another example of the linker oligonucleotide, the first domain comprises D-DNA and the second domain comprises isoguanine and / or isocytosine.

[0192] The first domain of the linker oligonucleotide can be about 8 to about 16 nucleotides in length. Preferably, the first domain of the linker oligonucleotide is 14 nucleotides in length. The second domain of the linker oligonucleotide can be about 4 - 12 nucleotides in length. Preferably, the second domain of the linker oligonucleotide can be about 8 nucleotides in length.

[0193] In aspects comprising a linker oligonucleotide, the attachment region can be referred to as partially double-stranded. The partially double-stranded attachment region can comprise a double-stranded region and a single strand. The single-stranded region of the partially double-stranded attachment region can comprise at least one nucleic acid sequence that binds (e.g., hybridizes) to at least one complementary nucleic acid sequence. At least one complementary nucleic acid sequence that binds (e.g., hybridizes) to the single-stranded region of the partially double-stranded attachment region can be a primary nucleic acid molecule.

[0194] Each nucleic acid of the double-stranded region containing the attachment region of the partial double strand can independently be a canonical base, a modified nucleotide, or a nucleic acid analogue. At least one, two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleotides in the double-stranded region of the attachment region of the partial double strand can be modified nucleotides or nucleotide analogues. The typical ratio of modified nucleotides or nucleotide analogues to canonical bases in the barcode domain is from 1:2 to 1:8. The typical modified nucleotides or nucleic acid analogues used in the first domain of the primary nucleic acid molecule are isoguanine and isocytosine. Alternatively, each nucleic acid of the double-stranded region containing the attachment region of the partial double strand can independently be L-DNA.

[0195] Each nucleic acid of the single-stranded region containing the attachment region of the partial double strand can independently be a canonical base, a modified nucleotide, or a nucleic acid analogue. At least one, two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleotides in the single-stranded region of the attachment region of the partial double strand can be modified nucleotides or nucleic acid analogues. The typical ratio of modified nucleotides or nucleic acid analogues to canonical bases in the barcode domain is from 1:2 to 1:8. The typical modified nucleotides or nucleic acid analogues used in the single-stranded region of the attachment region of the partial double strand are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleic acid analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the single-stranded region of the attachment region of the partial double strand to the appropriate complementary nucleic acid sequence of the primary nucleic acid molecule, while minimizing binding elsewhere (including to the target). Alternatively, each nucleic acid containing the first domain of the primary nucleic acid molecule can independently be L-DNA.

[0196] The primary nucleic acid molecule can contain a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photocleavable. The cleavable linker can contain at least one or at least two cleavable moieties. The at least one or at least two cleavable moieties can be photocleavable.

[0197] The first domain of the primary nucleic acid molecule can be about 6 to 16 nucleotides in length. Preferably, the first domain of the primary nucleic acid molecule is about 8 nucleotides in length.

[0198] Each nucleic acid comprising a first domain of a first-order nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, at least six, at least seven or at least eight nucleotides in the first domain of the first-order nucleic acid molecule can be modified nucleotides or nucleotide analogues. The typical ratio of modified nucleotides or nucleotide analogues to canonical bases in the barcode domain is from 1:2 to 1:8. Modified nucleotides or nucleic acid analogues commonly used in the first domain of the first-order nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the first-order nucleic acid molecule to at least one binding region within at least one attachment position of the barcode domain of the sequencing probe, while minimizing binding elsewhere (including to the target). Alternatively, each nucleic acid comprising a first domain of a first-order nucleic acid molecule can independently be L-DNA.

[0199] In some aspects, the first domain of the first-order nucleic acid molecule can consist entirely of L-DNA, while the second domain of the first-order nucleic acid molecule can consist entirely of D-DNA.

[0200] In some aspects, the first domain of the first-order nucleic acid molecule can contain a 3'-terminal cytosine nucleotide. In some aspects, the first domain of the first-order nucleic acid molecule can contain a 3'-terminal cytosine nucleotide, wherein the 3'-terminal cytosine nucleotide is L-DNA.

[0201] In some aspects, the first domain of the first-order nucleic acid molecule can contain a 5'-terminal cytosine nucleotide. In some aspects, the first domain of the first-order nucleic acid molecule can contain a 5'-terminal cytosine nucleotide, wherein the 5'-terminal cytosine nucleotide is L-DNA.

[0202] In some aspects, the first domain of the first-order nucleic acid molecule can contain at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3'-terminal cytosine nucleotide. In some aspects, the first domain of the first-order nucleic acid molecule can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3'-terminal cytosine nucleotide. In some aspects, the first domain of the first-order nucleic acid molecule can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3'-terminal cytosine nucleotide.

[0203] In some aspects, the first domain of the first nucleic acid molecule can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof and a 5'-terminal cytosine nucleotide. In some aspects, the first domain of the first nucleic acid molecule can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof and a 5'-terminal cytosine nucleotide. In some aspects, the first domain of the first nucleic acid molecule can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof and a 5'-terminal cytosine nucleotide.

[0204] At least one additional complementary nucleic acid that binds to the first nucleic acid molecule is referred to herein as a "second nucleic acid molecule". The first nucleic acid molecule can bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, or more second nucleic acid molecules. Preferably, the first nucleic acid molecule binds (e.g., hybridizes) to four second nucleic acid molecules.

[0205] The second nucleic acid molecule can comprise at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one complementary sequence in at least one first nucleic acid molecule; and a second domain capable of binding (e.g., hybridizing) to: (a) a first detectable label and at least a second detectable label, (b) at least one additional complementary nucleic acid, or (c) a combination thereof. In some aspects, the first domain of the second nucleic acid molecule can consist entirely of L-DNA, while the second domain of the second nucleic acid molecule can consist entirely of D-DNA. In some aspects, both the first domain and the second domain of the second nucleic acid molecule can consist entirely of D-DNA.

[0206] The second nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photocleavable.

[0207] Each nucleic acid comprising the first domain of the second nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, or at least six nucleotides in the first domain of the second nucleic acid molecule can be modified nucleotides or nucleotide analogues. The usual ratio of modified nucleotides or nucleotide analogues to canonical bases in the barcode domain is from 1:2 to 1:8. Modified nucleotides or nucleic acid analogues commonly used in the first domain of the second nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the second nucleic acid molecule to the appropriate complementary nucleic acid sequence within the second domain of the first nucleic acid molecule, while minimizing binding elsewhere.

[0208] At least one additional complementary nucleic acid that binds to a secondary nucleic acid molecule is referred to herein as a "tertiary nucleic acid molecule". A secondary nucleic acid molecule can bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or more tertiary nucleic acid molecules. Preferably, at least one secondary nucleic acid molecule binds (e.g., hybridizes) to one tertiary nucleic acid molecule.

[0209] A tertiary nucleic acid molecule comprises at least two domains: a first domain capable of binding (e.g., hybridizing) to at least one complementary sequence in at least one secondary nucleic acid molecule, and a second domain capable of binding (e.g., hybridizing) to a first detectable label and at least a second detectable label. Alternatively, the second domain can comprise the first detectable label and at least the second detectable label via direct or indirect attachment of the label during oligonucleotide synthesis using, for example, phosphoramidite or NHS chemistry. In some aspects, the first domain of the tertiary nucleic acid molecule can consist entirely of L-DNA, while the second domain of the tertiary nucleic acid molecule can consist entirely of D-DNA. In some aspects, both the first domain and the second domain of the tertiary nucleic acid molecule can consist entirely of D-DNA. The tertiary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photocleavable.

[0210] Each nucleic acid comprising the first domain of the tertiary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, or at least six nucleotides in the first domain of the tertiary nucleic acid can be modified nucleotides or nucleotide analogues. The typical ratio of modified nucleotides or nucleotide analogues to canonical bases in the first domain of the tertiary nucleic acid molecule is from 1:2 to 1:8. Commonly used modified nucleotides or nucleic acid analogues for the first domain of the tertiary nucleic acid molecule are isoguanine and isocytosine. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine can improve the binding efficiency and accuracy of the first domain of the tertiary nucleic acid molecule to the appropriate complementary nucleic acid sequence within the second domain of the second nucleic acid molecule, while minimizing binding elsewhere.

[0211] The reporter probe binds to the first detectable label and at least the second detectable label to produce a two-color combination. This dual combination of fluorescent dyes can include the duality of a single color, e.g., blue - blue. As used herein, the term "label" includes a single moiety capable of producing a detectable signal, or multiple moieties capable of producing the same or substantially the same detectable signal. For example, a label includes a single yellow fluorescent dye such as ALEXA FLUOR TM, or multiple yellow fluorescent dyes such as ALEXA FLUOR TM 532.

[0212] The reporter probe can bind to a first detectable label and at least a second detectable label, where each detectable label is one of four fluorescent dyes: blue (B); green (G); yellow (Y); and red (R). The use of these four dyes results in 10 possible two-color combinations: BB; BG; BR; BY; GG; GR; GY; RR; RY; or YY. In some aspects, the reporter probe of the present disclosure is labeled with one of the following 8 possible color combinations: BB; BG; BR; BY; GG; GR; GY; or YY, as Figure 3 depicted therein. The detectable label and at least the second detectable label can have the same emission spectrum, or can have different emission spectra.

[0213] In aspects involving sequencing probes and first nucleic acid molecules, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. Exemplary target binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify the corresponding nucleotides in the target nucleic acid molecule; wherein any of at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue, and wherein at least two nucleotides in the target binding domain that do not identify the corresponding nucleotides in the target nucleic acid molecule can be any of the four canonical bases that are non-specific to the target determined by at least six nucleotides in the target binding domain, or a universal base or a degenerate base. Exemplary barcode domains include a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being bound by at least one complementary first nucleic acid molecule, wherein the complementary first nucleic acid molecule comprises a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary first nucleic acid molecule bound to each of the at least three attachment positions determine the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain. At least two nucleotides in the target binding domain that do not identify the corresponding nucleotides in the target nucleic acid molecule can be any base of the four canonical bases that are non-specific to the target determined by at least six nucleotides in the target binding domain, or a universal base or a degenerate base.

[0214] In some aspects, at least one nucleotide in the target binding domain that does not identify the corresponding nucleotide in the target nucleic acid molecule can be before the nucleotide in the target binding domain that identifies the corresponding nucleotide in the target nucleic acid molecule. In some aspects, at least one nucleotide in the target binding domain that does not identify the corresponding nucleotide in the target nucleic acid can be after the nucleotide in the target binding domain that identifies the corresponding nucleotide in the target nucleic acid molecule.

[0215] In other aspects, exemplary target binding domains can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none or any one of at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue.

[0216] In aspects that include sequencing probes and primary nucleic acid molecules, the present disclosure also provides a sequencing probe that includes a target binding domain and a barcode domain; wherein the target binding domain includes at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify the corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain includes a synthetic backbone, the barcode domain includes at least three attachment positions, each attachment position includes at least one attachment region that includes at least one nucleic acid sequence, the at least one nucleic acid sequence is bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule includes a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary primary nucleic acid molecule that binds to each of the at least three attachment positions determine the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid that are bound by the target binding domain.

[0217] In aspects involving sequencing probes, first nucleic acid molecules, and second nucleic acid molecules, the present disclosure provides sequencing probes comprising a target-binding domain and a barcode domain; wherein the target-binding domain comprises any of the constructs described in Table 1. Exemplary target-binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target-binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target-binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein any of at least six nucleotides in the target-binding domain can be a modified nucleotide or nucleotide analogue, and wherein at least two nucleotides in the target-binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of the four canonical bases that are non-specific to the target determined by at least six nucleotides in the target-binding domain, or a universal base or a degenerate base. Exemplary barcode domains comprise a synthetic backbone, the barcode domain comprising at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence, the at least one nucleic acid sequence being bound by at least one complementary first nucleic acid molecule, wherein the at least one complementary first nucleic acid molecule is further bound by at least one complementary second nucleic acid molecule, the at least one complementary second nucleic acid molecule comprising a first detectable label and at least a second detectable label, wherein each of the at least three attachment sites corresponds to two nucleotides of at least six nucleotides in the target-binding domain, and the at least three attachment sites each have a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary second nucleic acid molecule bound to each of the at least three attachment sites determine the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target-binding domain.

[0218] In other aspects, exemplary target-binding domains can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target-binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none or any of at least six nucleotides in the target-binding domain can be a modified nucleotide or nucleotide analogue.

[0219] In aspects that include sequencing probes, first nucleic acid molecules, and second nucleic acid molecules, the present disclosure also provides a sequencing probe that includes a target binding domain and a barcode domain; wherein the target binding domain includes at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain includes a synthetic backbone, the barcode domain includes at least three attachment positions, each attachment position includes at least one attachment region that includes at least one nucleic acid sequence, the at least one nucleic acid sequence is bound by at least one complementary first nucleic acid molecule, wherein the at least one complementary first nucleic acid molecule is further bound by at least one complementary second nucleic acid molecule, the at least one complementary second nucleic acid molecule includes a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary second nucleic acid molecule that binds to each of the at least three attachment positions determine the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid that are bound by the target binding domain.

[0220] In aspects that include sequencing probes, first nucleic acid molecules, second nucleic acid molecules, and third nucleic acid molecules, the present disclosure provides a sequencing probe that includes a target binding domain and a barcode domain; wherein the target binding domain includes any of the constructs described in Table 1. Exemplary target binding domains include at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify the corresponding nucleotides in the target nucleic acid molecule; wherein any of at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue, and wherein at least two nucleotides in the target binding domain that do not identify the corresponding nucleotides in the target nucleic acid molecule can be any of the four canonical bases that are non-specific to the target determined by at least six nucleotides in the target binding domain, or a universal base or degenerate base. Exemplary barcode domains include a synthetic backbone, the barcode domain including at least three attachment sites, each attachment site including at least one attachment region that includes at least one nucleic acid sequence that is bound by at least one complementary first nucleic acid molecule, wherein the at least one complementary first nucleic acid molecule is further bound by at least one complementary second nucleic acid molecule, and wherein the at least one complementary second nucleic acid molecule is further bound by at least one complementary third nucleic acid molecule, the complementary third nucleic acid molecule including a first detectable label and at least a second detectable label, wherein each of the at least three attachment sites corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment sites each have a different nucleic acid sequence, and wherein the at least first detectable label and the at least second detectable label of each complementary third nucleic acid molecule that binds to each of the at least three attachment sites determine the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid that are bound by the target binding domain.

[0221] In other aspects, exemplary target binding domains can include at least six nucleotides that are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying the corresponding (complementary) nucleotides in the target nucleic acid molecule; wherein none or any one of at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue.

[0222] In aspects that include sequencing probes, first nucleic acid molecules, second nucleic acid molecules, and third nucleic acid molecules, the present disclosure also provides a sequencing probe that includes a target binding domain and a barcode domain; wherein the target binding domain includes at least ten nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and wherein at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain includes a synthetic backbone, the barcode domain includes at least three attachment positions, each attachment position includes at least one attachment region that includes at least one nucleic acid sequence, the at least one nucleic acid sequence is bound by at least one complementary first nucleic acid molecule, wherein the at least one complementary first nucleic acid molecule is further bound by at least one complementary second nucleic acid molecule, and wherein the at least one complementary second nucleic acid molecule is further bound by at least one complementary third nucleic acid molecule, the complementary third nucleic acid molecule includes a first detectable label and at least a second detectable label, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, wherein the at least first detectable label and the at least second detectable label of each complementary third nucleic acid molecule that binds to each of the at least three attachment positions determine the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that are bound by the target binding domain.

[0223] The present disclosure also provides a sequencing probe and a reporter probe that each have detectable labels on both the second nucleic acid molecule and the third nucleic acid molecule. For example, the second nucleic acid molecule can bind to the first nucleic acid molecule, and the second nucleic acid molecule can include both a first detectable label and at least a second detectable label, and further binds to at least one third molecule that includes a first detectable label and at least a second detectable label. The first detectable label and the at least second detectable label located on the second nucleic acid molecule can have the same emission spectrum, or can have different emission spectra. The first detectable label and the at least second detectable label located on the third nucleic acid molecule can have the same emission spectrum, or can have different emission spectra. The emission spectrum of the detectable label on the second nucleic acid molecule can be the same as or different from the emission spectrum of the detectable label on the third nucleic acid molecule.

[0224] Figure 4Illustrative schematic of an exemplary reporter probe of the present disclosure, the reporter probe comprising an exemplary primary nucleic acid molecule, secondary nucleic acid molecule, and tertiary nucleic acid molecule. At the 3' end, the primary nucleic acid comprises a first domain, wherein the first domain comprises a twelve nucleotide sequence that hybridizes to a complementary attachment region within the attachment location of a sequencing probe barcode domain. At the 5' end is a second domain that hybridizes to six secondary nucleic acid molecules. The depicted exemplary secondary nucleic acid molecules in turn each comprise a first domain that hybridizes to the primary nucleic acid molecule at the 5' end, and a domain that hybridizes to five tertiary nucleic acid molecules in the 3' portion.

[0225] The tertiary nucleic acid molecule comprises at least two domains. The first domain is capable of binding to the secondary nucleic acid molecule. The second domain of the tertiary nucleic acid is capable of binding to a first detectable label and at least a second detectable label. By direct incorporation of one or more fluorescently labeled nucleotide monomers into the sequence of the second domain of the tertiary nucleic acid, the second domain of the tertiary nucleic acid can be made to bind to the first detectable label and at least the second detectable label. By hybridizing a labeled short polynucleotide to the second domain of the secondary nucleic acid molecule, the second domain of the secondary nucleic acid molecule can be made to bind to the first detectable label and at least the second detectable label. These short polynucleotides, referred to as "labeled oligonucleotides", can be labeled by direct incorporation of fluorescently labeled nucleotide monomers, or by other methods of labeling nucleic acids known to those of skill in the art. Figure 4 The depicted exemplary tertiary nucleic acid molecule (which can be considered a "labeled oligonucleotide") comprises a first domain and a second domain that hybridize to the secondary nucleic acid molecule, the second domain being fluorescently labeled by indirect attachment of a label during oligonucleotide synthesis using, for example, NHS chemistry, or by incorporation of one or more fluorescently labeled nucleotide monomers during the synthesis of the tertiary nucleic acid molecule. The labeled oligonucleotide can be DNA, RNA, or PNA.

[0226] The labeled oligonucleotide can comprise a cleavable linker between the fluorescent moiety and the polynucleotide molecule. Preferably, the cleavable linker is photocleavable. The cleavable linker can also be chemically or enzymatically cleavable.

[0227] In an alternative aspect, the second domain of the secondary nucleic acid is capable of binding to a first detectable label and at least a second detectable label. Binding of the second domain of the secondary nucleic acid to the first detectable label and at least the second detectable label can be achieved by direct incorporation of one or more fluorescently labeled nucleotide monomers into the sequence of the second domain of the secondary nucleic acid. By hybridizing a labeled short polynucleotide to the second domain of the secondary nucleic acid, the second domain of the secondary nucleic acid molecule can be bound by the first detectable label and at least the second detectable label. These short polynucleotides, referred to as labeled oligonucleotides, can be labeled by direct incorporation of fluorescently labeled nucleotide monomers or by other methods of labeling nucleic acids known to those skilled in the art.

[0228] The primary nucleic acid molecule can comprise about 100, about 95, about 90, about 85, about 80, or about 75 nucleotides. The primary nucleic acid molecule can comprise from about 100 to about 80 nucleotides. The primary nucleic acid molecule can comprise about 90 nucleotides. The secondary nucleic acid molecule can comprise about 90, about 85, about 80, about 75, or about 70 nucleotides. The secondary nucleic acid molecule can comprise from about 90 to about 80 nucleotides. The secondary nucleic acid molecule can comprise about 87 nucleotides. The secondary nucleic acid molecule can comprise about 25, about 20, about 15, or about 10 nucleotides. The tertiary nucleic acid molecule can comprise from about 20 to about 10 nucleotides. The tertiary nucleic acid molecule can comprise about 15 nucleotides.

[0229] The reporter probes of the present disclosure can have various designs. For example, a primary nucleic acid molecule can hybridize to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) secondary nucleic acid molecules. Each secondary nucleic acid molecule can hybridize to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) tertiary nucleic acid molecules. To produce a reporter probe labeled with a specific two-color combination, the reporter probe is designed such that the probe comprises a secondary nucleic acid molecule, a tertiary nucleic acid molecule, a labeled oligonucleotide, or any combination of a secondary nucleic acid molecule, a tertiary nucleic acid molecule, and a labeled oligonucleotide, which is labeled with each color of the specific two-color combination. For example, Figure 4 A reporter probe of the present disclosure is depicted that comprises a total of 30 dyes, with 15 dyes for color 1 and 15 dyes for color 2. To prevent color exchange or cross-hybridization between different fluorescent dyes, each tertiary nucleic acid or labeled oligonucleotide that binds to a specific label or fluorescent dye comprises a unique nucleotide sequence.

[0230] In some aspects, the present disclosure provides 5x5 reporter probes. The 5x5 reporter probes comprise a first nucleic acid, wherein the first nucleic acid comprises a first domain of 12 nucleotides. The first nucleic acid further comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize to 5 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 5 tertiary nucleic acids bound by a detectable label can hybridize to each secondary nucleic acid.

[0231] In some aspects, the present disclosure provides 4x3 reporter probes. The 4x3 reporter probes comprise a first nucleic acid, wherein the first nucleic acid comprises a first domain of 12 nucleotides. The first nucleic acid further comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize to 4 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 3 tertiary nucleic acids bound by a detectable label can hybridize to each secondary nucleic acid.

[0232] In some aspects, the present disclosure provides 3x4 reporter probes. The 3x4 reporter probes comprise a first nucleic acid, wherein the first nucleic acid comprises a first domain of 12 nucleotides. The first nucleic acid further comprises a second domain, wherein the second domain comprises a nucleotide sequence that can hybridize to 3 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 4 tertiary nucleic acids bound by a detectable label can hybridize to each secondary nucleic acid.

[0233] In some aspects, the present disclosure provides spacer 3x4 reporter probes. The spacer 3x4 reporter probes comprise a first nucleic acid, wherein the first nucleic acid comprises a first domain of 12 nucleotides. Located between the first domain and the second domain of the first nucleic acid is a spacer region consisting of 20 to 40 nucleotides. The spacer is identified as being 20 to 40 nucleotides in length; however, the length of the spacer is non-limiting and it can be shorter than 20 nucleotides or longer than 40 nucleotides. The second domain of the first nucleic acid comprises a nucleotide sequence that can hybridize to 3 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 4 tertiary nucleic acids bound by a detectable label can hybridize to each secondary nucleic acid.

[0234] In some aspects, the first nucleic acid can comprise a first domain that is 12 nucleotides in length. However, the length of the first domain of the first nucleic acid is not restricted and can be fewer than 12 or more than 12 nucleotides. In one instance, the first domain of the first nucleic acid is 14 nucleotides. In another instance, the first domain of the first nucleic acid is 9 nucleotides. In a further instance, the first domain of the first nucleic acid is 8 nucleotides. Exemplary sequences of the 9-nucleotide first domain of the first nucleic acid of the reporter probes are those in Table 15.

[0235] Table 15 Any feature of the specific reporter probe design of the present disclosure can be combined with any feature of another reporter probe design of the present disclosure. For example, a 5x5 reporter probe can be modified to contain a spacer region of about 20 to 40 nucleotides between the complementary nucleic acid and the primary nucleic acid. In another example, a 4x3 reporter probe can be modified such that the 4 secondary nucleic acids contain nucleotide sequences that allow 5 tertiary nucleic acids that can bind to a detectable label to hybridize to each secondary nucleic acid, resulting in a 4x5 reporter probe.

[0236] Without wishing to be bound by theory, the 5x5 reporter (25) contains more fluorescent labels than the 4x3 reporter (12), and thus the fluorescence intensity of the 5x5 reporter will be greater. The fluorescence detected in any given field of view (FOV) is a function of various variables, including the fluorescence intensity of a given reporter probe and the number of target molecules optionally bound within that FOV. The number of target molecules optionally bound per field of view (FOV) can be from 1 to 2.5 million targets / FOV. The typical number of bound target molecules per FOV is 20,000 to 40,000, 220,000 to 440,000, or 1 million to 2 million target molecules. A typical FOV is from.05 mm 2 to 1 mm 2 . Further examples of typical FOVs are from.05 mm 2 to.65 mm 2 .

[0237] In some aspects, the present disclosure provides reporter probe designs in which the secondary nucleic acid molecules contain "extra handles" that do not hybridize to the tertiary nucleic acid molecules and are distal to the primary nucleic acid molecules. In some aspects, the "extra handles" can be 12 nucleotides in length ("12-mers"); however, their length is not limited and can be fewer or more than 12 nucleotides. The "extra handles" can each contain the nucleotide sequence of the first domain of the primary nucleic acid molecule to which the secondary nucleic acid molecule hybridizes. Thus, when a reporter probe contains an "extra handle", the reporter probe can hybridize to a sequencing probe via the first domain of the primary nucleic acid molecule or via the "extra handle". Accordingly, the likelihood of binding of the reporter probe to the sequencing probe is increased. The "extra handle" design can also improve hybridization kinetics. Without being bound by any theory, the "extra handle" can increase the effective concentration of the complementary nucleic acid of the reporter probe. It is expected that a 5x4 "extra handle" reporter probe produces approximately 4750 fluorescence counts / standard FOV. It is expected that 5x3 "extra handle" reporter probes, 4x4 "extra handle" reporter probes, 4x3 "extra handle" reporter probes, and 3x4 "extra handle" reporter probes all produce approximately 6000 fluorescence counts / standard FOV. Any reporter probe design of the present disclosure can be modified to include an "extra handle".

[0238] Each of the secondary nucleic acid molecules of the reporter probe can hybridize to a tertiary nucleic acid molecule, and all of the tertiary nucleic acid molecules are labeled with the same detectable label. For example, Figure 5 The left figure of depicts a "5x6" reporter probe. The 5x6 reporter probe includes one primary nucleic acid containing a second domain, where the second domain contains a nucleotide sequence that hybridizes to 6 secondary nucleic acid molecules. Each secondary nucleic acid contains a nucleotide sequence such that 5 tertiary nucleic acid molecules that bind to a detectable label hybridize to each secondary nucleic acid. The 5 tertiary nucleic acid molecules that bind to a particular secondary nucleic acid molecule are each labeled with the same detectable label. For example, three secondary nucleic acid molecules bind to tertiary nucleic acid molecules labeled with a yellow fluorescent dye, while the other three secondary nucleic acids bind to tertiary nucleic acid molecules labeled with a red fluorescent dye.

[0239] Each of the secondary nucleic acid molecules of the reporter probe can hybridize to a tertiary nucleic acid molecule, and the tertiary nucleic acid molecules are labeled with different detectable labels. For example, Figure 5The middle figure depicts the "3x2x6" reporter probe design. The "3x2x6" reporter probe includes a primary nucleic acid containing a second domain, wherein the second domain contains a nucleotide sequence that hybridizes to six secondary nucleic acid molecules. Each secondary nucleic acid contains a nucleotide sequence such that five tertiary nucleic acids that bind to a detectable label hybridize to each secondary nucleic acid. Each secondary nucleic acid binds to both a tertiary nucleic acid molecule labeled with a yellow fluorescent dye and a tertiary nucleic acid molecule labeled with a red fluorescent dye. In this specific example, three secondary nucleic acid molecules bind two red and three yellow tertiary nucleic acid molecules, while the other three secondary nucleic acid molecules bind two red and three yellow tertiary nucleic acid molecules. Each secondary nucleic acid molecule can bind to any number of tertiary nucleic acid molecules, which are bound by different detectable labels. In Figure 5 the middle figure, the tertiary nucleic acid molecules that bind to each secondary nucleic acid molecule are arranged such that the colors of the labels alternate (i.e., red - yellow - red - yellow - red or yellow - red - yellow - red - yellow).

[0240] In any of the described reporter probe designs, the tertiary nucleic acids labeled with different detectable labels can be arranged along the secondary nucleic acid in any order. For example, Figure 5 the right figure depicts the "Fret - resistant 3x2x6" reporter probe, which is similar to the 3x2x6 reporter probe design, except for the arrangement (e.g., linear order or grouping) of the red and yellow tertiary nucleic acid molecules along each secondary nucleic acid molecule.

[0241] Figure 6 Depicts more exemplary reporter probe designs of the present disclosure, which include individual secondary nucleic acid molecules that bind to different tertiary nucleic acid molecules. The left figure depicts the "6x1x4.5" reporter probe containing a primary nucleic acid molecule, wherein the primary nucleic acid molecule contains a second domain, and the second domain contains a nucleotide sequence that hybridizes to six secondary nucleic acid molecules. Each secondary nucleic acid molecule hybridizes to five tertiary nucleic acid molecules. Four of the five tertiary nucleic acid molecules that hybridize to each secondary nucleic acid molecule are directly labeled with a detectable label of the same color. The fifth tertiary nucleic acid, indicated as a branched tertiary nucleic acid, binds to five labeled oligonucleotides of the other color of a two - color combination. Of the six secondary nucleic acids, three of them bind to the branched tertiary nucleic acid labeled with one color of the two - color combination (in this example, red), while the other three secondary nucleic acid molecules bind to the branched tertiary nucleic acid labeled with the other color of the two - color combination (in this example, yellow). Overall, the 6x1x4.5 reporter probe is labeled with a total of 54 dyes, 27 dyes of each color. Figure 6The middle figure depicts a "4x1x4.5" reporter probe, which shares the same overall structure as the 6x1x4.5 reporter probe, except that the primary nucleic acid of the 4x1x4.5 reporter probe binds only 4 secondary nucleic acids, such that there are a total of 36 dyes, 18 of each color.

[0242] For each color of a two-color combination, the reporter probe can contain the same number of dyes. For each color of a two-color combination, the reporter probe can contain a different number of dyes. A choice of which color has more dyes within the reporter probe can be made based on the energy levels of the light absorbed by the two dyes. For example, Figure 6 The right figure depicts a "5x5 energy-optimized" reporter probe design. This reporter probe design contains 15 yellow dyes (which have a higher energy) and 10 red dyes (which have a lower energy). In this example, the 15 yellow dyes can constitute a first label, and the 10 red dyes can constitute a second label.

[0243] The detectable moiety, label or reporter can be bound to the secondary nucleic acid molecule, tertiary nucleic acid molecule or labeled oligonucleotide in a variety of ways, including directly or indirectly attaching the detectable moiety, such as a fluorescent moiety, a colorimetric moiety, etc. Those skilled in the art can consult references related to labeled nucleic acids. Examples of fluorescent moieties include, but are not limited to, yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, cyanine, dansyl chloride, phycocyanin, phycoerythrin, etc.

[0244] Fluorescent labeling and its attachment to nucleotides and / or oligonucleotides have been described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Specific methodologies applicable to the present disclosure are disclosed in the following reference examples: U.S. Patent Nos. 4,757,141; 5,151,507; and 5,091,519. One or more fluorescent dyes can be used as labels for the target sequences to be labeled, for example, as disclosed by U.S. Patent No. 5,188,934 (4,7-dichlorofluorescein dye); 5,366,860 (spectrally resolvable rhodamine dyes); 5,847,162 (4,7-dichlororhodamine dyes); 4,318,846 (ether-substituted fluorescein dyes); 5,800,996 (energy transfer dyes); Lee et al. 5,066,580 (xanthine dyes); 5,688,648 (energy transfer dyes); etc. Labeling can also be performed with quantum dots, as disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002 / 0045045; and 2003 / 0017264. As used herein, the term "fluorescent label" encompasses a signal transduction moiety that conveys information through the fluorescence absorption and / or emission characteristics of one or more molecules. Such fluorescent characteristics include fluorescence intensity, fluorescence lifetime, emission spectral characteristics, energy transfer, and the like.

[0245] Commercially available fluorescent nucleotide analogs that are easily incorporated into nucleotide and / or oligonucleotide sequences include, but are not limited to, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein-12-dUTP, tetramethylrhodamine 6-dUTP, TEXAS RED TM -5-dUTP, CASCADE BLUE TM -7-dUTP, BODIPY TM FL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TM TR-14-dUTP, RHODAMINE GREEN TM -5-dUTP, OREGON GREENR TM 488-5-dUTP, TEXAS RED TM -12-dUTP, BODIPY TM 630 / 650-14-dUTP, BODIPY TM 650 / 665-14-dUTP, ALEXA FLUOR TM 488-5-dUTP, ALEXA FLUOR TM 532-5-dUTP, ALEXA FLUOR TM 568-5-dUTP, ALEXA FLUOR TM 594-5-dUTP, ALEXA FLUOR TM 546-14-dUTP, fluorescein-12-UTP, tetramethylrhodamine-6-UTP, TEXAS RED TM -5-UTP, mCherry, CASCADEBLUE TM -7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHODAMINE GREEN TM -5-UTP, ALEXA FLUOR TM 488-5-UTP, LEXAFLUOR TM546-14-UTP (Molecular Probes, Inc., Eugene, OR), etc. Alternatively, the above-mentioned fluorophores and those mentioned herein can be added during oligonucleotide synthesis using, for example, phosphoramidite or NHS chemistry. Protocols for custom synthesis of nucleotides with other fluorophores are known in the art (see, Henegariu et al. (2000) Nature Biotechnol. 18:345). 2-Aminopurine is a fluorescent base that can be directly incorporated during the synthesis of oligonucleotide sequences. Nucleic acids can also be pre-stained with intercalating dyes such as DAPI, YOYO-1, ethidium bromide, cyanine dyes (e.g., SYBR Green), etc.

[0246] Other fluorophores that can be used for post-synthesis attachment include, but are not limited to, ALEXA FLUOR TM 350, ALEXAFLUOR TM 405, ALEXAFLUOR TM 430, ALEXAFLUOR TM 532, ALEXAFLUOR TM 546, ALEXAFLUOR TM 568, ALEXAFLUOR TM 594, ALEXA FLUOR TM 647, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, Lissamine Rhodamine B, Ocean Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Tetramethylrhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ), etc. FRET tandem fluorophores can also be used, including but not limited to PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC-Cy7, PE-Alexa dyes (610, 647, and 680), APC-Alexa dyes, etc.

[0247] Silver or gold metal particles can be used to enhance the signal from fluorescently labeled nucleotides and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).

[0248] Other suitable labels for oligonucleotide sequences can include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phospho - amino acids (e.g., P - tyr, P - ser, P - thr), and the like. The following hapten / antibody pairs can be used for detection, where each antibody is derivatized with a detectable label: biotin / α - biotin, digoxigenin / α - digoxigenin, dinitrophenol (DNP) / α - DNP, 5 - carboxyfluorescein (FAM) / α - FAM.

[0249] The detectable labels described herein are spectrally resolvable. By "spectrally resolvable" with reference to multiple fluorescent labels is meant that the fluorescence emission spectral bands of the labels are sufficiently different, i.e., sufficiently non - overlapping, such that the molecular tags to which the respective labels are attached can be distinguished by a standard light detection system based on the fluorescence signals generated by the respective labels, such as a system employing band - pass filters and photomultiplier tubes, etc., as exemplified by the systems described in U.S. Patent Nos. 4,230,558; 4,811,218; etc., or as described on pages 21 - 76 of Wheeless et al., Flow Cytometry: Instrumentation and Data Analysis (Academic Press, New York, 1985). Spectrally resolvable organic dyes, such as fluorescein, rhodamine, etc., mean that the wavelength emission maxima are spaced at least 20 nm apart, and in another aspect, at least 40 nm apart. For chelated lanthanide compounds, quantum dots, etc., spectrally resolvable means that the wavelength emission maxima are spaced at least 10 nm or at least 15 nm apart.

[0250] There are three attachment positions in the barcode domain, each position having at most 10 potential two - color combinations, allowing for at most 1000 color combinations. If the reporter probes are pooled in fewer than 1000 probes / pool, the ability to use parity checking to overcome errors can be utilized. There can be many potential parity schemes that allow for parity checking, Figure 32An exemplary scheme is shown. In this example, the actual colors present are not used for parity checking, but rather a single (S) color reporting probe (e.g., red) and a multicolor (M) reporting probe (e.g., red / yellow) present at each attachment position in the barcode domain are used. As can be seen in the parity design, knowledge of the state (S or M) of any two reporter positions allows prediction of the third position. In the example shown, observing S in any two positions requires the unobserved position to be M, observing S and M in any two positions means the other position must be S, and observing two M reporting probes requires the other position to be M. This means that in order to obtain the code for three reporting probes with incorrectly detected reporter colors, two incorrect identifications must be made. Figure 32 The simulation results at 5% reporter probe error are shown, which show an increase in error filtering when parity checking is applied. There are multiple parity systems that can be applied, and this is just one example.

[0251] Another error correction procedure is to exchange the color palettes for each reporter probe pool. The color palette is the set of reporter probes actually used to measure the pool. No multiple reporter probes are used in any one pool, and if there are 500 reporter probes in a pool, only 1 / 2 of the possible color combinations are needed. The simplest way to achieve this is to have two palettes, palette A containing 500 reporter probes and palette B containing the other 500 reporter probes. Thus, if sequencing pools 1, 3, 5, 7 have palette A and pools 2, 4, 6, 8 have palette B, running the pools in the order 1, 2, 3, 4, 5, 6, 7, 8 means that each successive sequencing pool has a separate palette. Thus, the barcodes from pool 2 are not present in the previous and subsequent pools (e.g., pools 1 and 3). This allows for simple automated troubleshooting and limits the detection of errors.

[0252] The reporter probe can include one or more cleavable linker modifications. One or more cleavable linker modifications can be placed at any position in the reporter probe. The cleavable linker modification can be located between the first domain and the second domain of the first nucleic acid molecule of the reporter probe. The cleavable linker modification can be present between the first domain and the second domain of the second nucleic acid molecule of the reporter probe. The cleavable linker modification can be present between the first nucleic acid molecule of the reporter probe and the first and second domains of the second nucleic acid molecule. Figure 7 The left figure depicts an exemplary reporter probe of the present disclosure, which includes cleavable linker modifications between the first domain and the second domain of the first nucleic acid and between the first domain and the second domain of the second nucleic acid. In such a case illustrated in the left figure as Figure 7 In the case illustrated in the left figure, the cleavable linker modification can include one or more cleavable moieties, such as Figure 7 those illustrated in the left figure.

[0253] The cleavable linker modifier can be a compound of formula (I), or a stereoisomer or salt thereof: Wherein: R1 is hydrogen, halogen, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, wherein the C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl are each independently optionally substituted by at least one substituent R 10 ; R2 is O, NH or N(C 1-6 alkyl); R3 is cycloalkyl, heterocycloalkyl, aryl or heteroaryl, each optionally substituted by at least one substituent R 10 ; Each of R4 and R7 is independently C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, wherein the C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl are each independently optionally substituted by at least one substituent R 10 ; R5 and R9 are each independently cycloalkyl, heterocycloalkyl, aryl or heteroaryl, each optionally substituted by at least one substituent R 10 ; R6 is O, NH or N(C 1-6 alkyl); R8 is O, NH or N(C 1-6 alkyl); Each R 10 is independently hydrogen, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, halo C 1-6 alkyl, halo C 2-6 alkenyl, halo C 2-6 alkynyl, cycloalkyl, heterocyclic, aryl, heteroaryl, -CN, -NO2, oxo, -OR 11 , -SO2R 11 , -SO3 - , -COR 11 , -CO2R 11 , -CONR 11 R 12 , -C(=NR 11 )NR 12 R 13 , -NR 11 R 12 , -NR 12 COR 12 , -NR 11 CONR12 R 13 、 -NR 11 CO2R 12 、 -NR 11 SONR 12 R 13 、 -NR 11 SO2NR 12 R 13 or -NR 11 SO2R 12 ; and R can be the same or different 11 、R 12 and R 13 each independently is hydrogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, halo -C 1-6 alkyl, halo -C 2-6 alkenyl, halo -C 2-6 alkynyl, C 1-6 alkoxy -C 1-6 alkyl -, cycloalkyl, heterocyclic group, aryl or heteroaryl.

[0254] In one aspect, R1 is C 1-6 alkyl, preferably C 1-3 alkyl, such as methyl, ethyl, propyl or isopropyl; R2 is NH or N(C 1-6 alkyl); R3 is 5 - to 6 - membered cycloalkyl, preferably cyclohexyl; R4 is C 1-6 alkyl, preferably C 1-3 alkylene, such as methylene, ethylene, propylene or isopropylene; R5 is a 5 - to 6 - membered heterocyclic group containing 1 nitrogen atom and 0 or 1 additional heteroatom selected from N, O and S, wherein the heterocyclic group is optionally substituted by 1 or 2 R 10 ; R6 is O; R7 is C 1-6 alkyl, preferably C 1-3 alkylene, such as methylene, ethylene, propylene or isopropylene; R8 is O; R9 is a 5 - to 6 - membered heterocyclic group containing 1 nitrogen atom and 0 or 1 additional heteroatom selected from N, O and S, wherein the heterocyclic group is optionally substituted by 1 or 2 R 10 ; and each R 10 independently is halogen, C 1-6 alkyl, halo -C 1-6 alkyl, oxo, -SO2H or -SO3 - .

[0255] In one aspect, R3 is cyclohexyl, R4 is methylene, R5 is 1H - pyrrole - 2,5 - dione, and R9 is pyrrolidine - 2,5 - dione, optionally substituted by SO3- Substituted.

[0256] The linker compound can be or its stereoisomers or salts.

[0257] The linker compound can be or its stereoisomers or salts.

[0258] The linker compound or linker modification can be

[0259] The linker compound or linker modification can be

[0260] The cleavable linker modification or cleavable moiety can be

[0261] The reporter probe can be assembled by mixing three stock solutions together with water. One stock solution contains a first nucleic acid molecule, one stock solution contains a second nucleic acid molecule, and the last stock solution contains a third nucleic acid molecule. Table 2 depicts exemplary amounts of each stock solution that can be mixed to assemble a particular reporter probe design.

[0262] Table 2 Target nucleic acid The present disclosure provides methods for sequencing nucleic acids using the sequencing probes disclosed herein. The nucleic acid to be sequenced using the methods of the present disclosure is referred to herein as the "target nucleic acid". The term "target nucleic acid" shall mean a nucleic acid molecule (DNA, RNA, or PNA) whose sequence is to be determined by the probes, methods, and devices of the present disclosure. Generally, the terms "target nucleic acid", "target nucleic acid molecule", "target nucleic acid sequence", "target nucleic acid fragment", "target oligonucleotide", and "target polynucleotide" may be used interchangeably and are intended to include, but are not limited to, nucleotides (deoxyribonucleotides or ribonucleotides) or their analogs in polymeric form that can have various lengths. Non-limiting examples of nucleic acids include genes, gene fragments, exons, introns, intergenic DNA (including, but not limited to, heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, small interfering RNA (siRNA), non-coding RNA (ncRNA), cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of a sequence, isolated RNA of a sequence, nucleic acid probes, and primers. The identity and / or sequence of the target nucleic acid is known prior to sequencing using the methods of the present disclosure. Alternatively, the identity and / or sequence is unknown. It is also possible that a portion of the sequence of the target nucleic acid is known prior to sequencing using the methods of the present disclosure. For example, the method can involve determining a point mutation in a known target nucleic acid molecule.

[0263] The method directly sequences nucleic acid molecules obtained from a sample (e.g., a sample from a biological organism) and preferably without a conversion (or amplification) step. For example, for direct RNA-based sequencing, the method does not require conversion of the RNA molecule to a DNA molecule (i.e., via cDNA synthesis) prior to obtaining the sequence. Since no amplification or conversion is required, the nucleic acids sequenced in the present disclosure will retain any unique bases and / or epigenetic markers present in the nucleic acid when the nucleic acid is in the sample or when it is obtained from the sample. Such unique bases and / or epigenetic markers are lost in sequencing methods known in the art.

[0264] The method can be used to sequence at single-molecule resolution. In other words, the method allows the user to generate a final sequence based on data collected from a single target nucleic acid molecule rather than having to combine data from different target nucleic acid molecules, preserving any unique features of that particular target.

[0265] The target nucleic acid can be obtained from any sample or source of nucleic acids, such as any cell, tissue, or biological organism, in vitro, a chemical synthesizer, etc. The target nucleic acid can be obtained by any method recognized in the art. Nucleic acids can be obtained from a blood sample of a clinical subject. Nucleic acids can be extracted, isolated, or purified from the source or sample using methods and kits well known in the art.

[0266] The target nucleic acid can be fragmented by any means known in the art. Preferably, fragmentation is carried out by enzymatic or mechanical means. Mechanical means can be sonication or physical shearing. Enzymatic means can be carried out by digestion with a nuclease (e.g., deoxyribonuclease I (DNase I)), or one or more restriction endonucleases.

[0267] When the nucleic acid molecule containing the target nucleic acid is a complete chromosome, measures should be taken to avoid fragmenting the chromosome.

[0268] The target nucleic acid can include natural or unnatural nucleotides, including modified nucleotides or nucleic acid analogs, as is well known in the art.

[0269] The target nucleic acid molecule can include DNA, RNA, and PNA molecules with lengths up to hundreds of kilobases (e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 500 or more kilobases). The target nucleic acid molecule can contain from about 50 to about 400 nucleotides, or from about 90 to about 350 nucleotides.

[0270] Capture probe The target nucleic acid can be immobilized (e.g., at one, two, three, four, five, six, seven, eight, nine, ten or more positions) to a substrate.

[0271] Exemplary useful substrates include those substrates containing a binding moiety selected from ligands, antigens, carbohydrates, nucleic acids, receptors, lectins, and antibodies. The capture probe contains a substrate-binding moiety capable of binding to the binding moiety of the substrate. Exemplary useful substrates containing a reactive moiety include, but are not limited to, surfaces containing epoxy groups, aldehydes, gold, hydrazides, thiols, NHS-esters, amines, alkynes, azides, thiols, carboxylates, maleimides, hydroxymethylphosphines, imidates, isocyanates, hydroxyls, pentafluorophenyl esters, psoralens, pyridyl disulfides, or vinyl sulfones, polyethylene glycol (PEG), hydrogels, or mixtures thereof. Such surfaces can be obtained from commercial sources or prepared according to standard techniques. Exemplary useful substrates containing a reactive moiety include, but are not limited to, OptArray-DNA NHS groups (Accler8), Nexterion Slide AL (Schott), and Nexterion Slide E (Schott).

[0272] The substrate can be any solid support known in the art, such as coated slides and microfluidic devices, which are capable of immobilizing the target nucleic acid. The substrate can be a surface, a membrane, a bead, a porous material, an electrode, or an array. For example, the substrate can be a polymeric material, a metal, silicon, glass, or quartz. The target nucleic acid can be immobilized to any substrate that is obvious to those skilled in the art.

[0273] When the substrate is an array, the substrate can include holes, the size and spacing of which vary according to the target nucleic acid molecules to be attached. In one example, the substrate is constructed such that an ultra-dense, ordered array of target nucleic acids is attached. Examples of the density of the target nucleic acid array on the substrate include 500,000 to 10,000,000 target nucleic acid molecules / mm 2 、1,000,000 to 4,000,000 target nucleic acid molecules / mm 2 、or 850,000 to 3,500,000 target nucleic acid molecules / mm 2 。

[0274] The holes in the substrate are the locations for the attachment of target nucleic acid molecules. The surface of the holes can be functionalized with the reactive moieties described above to attract and bind specific chemical groups present on the target nucleic acid molecules, or to capture probes that bind to the target nucleic acid molecules to attract, immobilize, and bind the target nucleic acid molecules. It is well known that these functional groups can specifically attract and bind biomolecules through various conjugation chemistries.

[0275] For the sequencing of individual nucleic acid molecules on a substrate such as an array, a universal capture probe or a universal sequence complementary to the substrate-binding portion of the capture probe is attached to each hole. Then, the individual target nucleic acid molecules are bound to the universal capture probe or the universal sequence complementary to the substrate-binding portion of the capture probe to which the capture probe is bound, and sequencing can be initiated.

[0276] For the sequencing of individual nucleic acid molecules on a substrate such as an array, the individual target nucleic acid molecules can be bound to a capture probe. The substrate-binding portion of the capture probe can then be bound to an adaptor oligonucleotide. The adaptor nucleotide then binds to the lawn oligonucleotide attached to each hole, and sequencing can be initiated. Exemplary sequences of the lawn oligonucleotides are shown in Table 8.

[0277] Table 8 5amMC6 = 5'-amine with a 6-carbon linker; isodG = isoguanine; 3AmMO = 3’ 5[biotin-TEG] = 5'-biotin-TEG Each nucleic acid comprising a lawn oligonucleotide or an adaptor oligonucleotide can independently be a canonical base or a modified nucleotide or nucleic acid analogue. Commonly used modified nucleotides or nucleic acid analogues that can be used in lawn oligonucleotides or adaptor oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid comprising a lawn oligonucleotide can independently be L-DNA. In some aspects, a lawn oligonucleotide can comprise L-DNA. A lawn oligonucleotide can consist of L-DNA. A lawn oligonucleotide can consist essentially of L-DNA. For example, the use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine or L-DNA can improve the binding efficiency and accuracy of an adaptor oligonucleotide to a proper complementary nucleic acid sequence within a lawn oligonucleotide while minimizing binding elsewhere.

[0278] A lawn oligonucleotide can further comprise what is referred to herein as 5AmMC6, a 5'-amine with a 6-carbon linker. 5AmMC6 can be used to attach a lawn oligonucleotide to a substrate.

[0279] Examples of capture probes, adaptor oligonucleotides, and lawn oligonucleotide complexes are shown in Figure 33 In this figure, the exemplary adaptor sequence in hybridization and the exemplary capture probe sequence are green, the sequence that is the reverse complement of the exemplary lawn oligonucleotide is blue, and the exemplary sequence on the capture probe that hybridizes to the target gene, which is gene TP53.1 in this example, is red. The sequence of the exemplary capture probe is 3’-CCGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTCACTCACTAGCCTCCAGTACCGA AAGC-5’ (SEQ ID No: 111). The sequence of the exemplary adaptor sequence is 5’-GAGTGATCGGAGGTCATGGCTTTCGAC / iMe-isodC / CTA / iMe-isodC / AAA / iMe-isodC / TCA / iMe-isodC / TA / iMe-isodC / TA / iMe-isodC / CAA / iMe-isodC / AAC / iMe-isodC / TCA / iMe-isodC / CA-3’ (SEQ ID No: 110). The sequence of the exemplary lawn oligonucleotide is TG / iisodG / GAT / iisodG / TTT / iisodG / AGT / iisodG / AT / iisodG / AT / iisodG / GTT / iisodG / TTG / iisodG / AGT / iisodG / GT / 5AmMC6 (SEQ ID NO: 108).

[0280] In some aspects, the lawn oligonucleotide can comprise at least one affinity moiety, at least two affinity moieties, at least three affinity moieties, at least four affinity moieties, at least five affinity moieties, at least six affinity moieties, at least seven affinity moieties, at least eight affinity moieties, at least nine affinity moieties, or at least ten affinity moieties. The affinity moiety can be biotin. Thus, the lawn oligonucleotide can comprise at least one biotin moiety, at least two biotin moieties, at least three biotin moieties, at least four biotin moieties, at least five biotin moieties, at least six biotin moieties, at least seven biotin moieties, at least eight biotin moieties, at least nine biotin moieties, or at least ten biotin moieties.

[0281] In some aspects, a capture probe of the present disclosure that hybridizes to a target nucleic acid can comprise at least one first affinity moiety, such as but not limited to a biotin moiety. Then, the capture probe that hybridizes to the target nucleic acid can hybridize directly or indirectly to at least one lawn oligonucleotide on a substrate, wherein the at least one lawn oligonucleotide comprises at least one first affinity moiety, such as but not limited to a biotin moiety. After the capture probe hybridizes to the lawn oligonucleotide, the resulting capture probe-target nucleic acid-lawn oligonucleotide complex can be incubated with a second affinity moiety, wherein the second affinity moiety is capable of binding to the first affinity moiety located on the capture probe, as well as the first affinity moiety located on the lawn oligonucleotide. In a non-limiting example, if the first affinity moiety located on the capture probe, as well as the first affinity moiety located on the lawn oligonucleotide, are both biotin, then neutravidin can be used as the second affinity moiety. The second affinity moiety will bind to the first affinity moiety located on the capture probe, as well as the first affinity moiety located on the lawn oligonucleotide, resulting in a protein bridge referred to herein as a "protein lock". The protein lock can be used to more stably immobilize the target nucleic acid to the substrate. Figure 67 A schematic diagram showing the protein lock using biotinylated capture probes and lawn oligonucleotides and neutravidin is shown.

[0282] The target nucleic acid can be bound by one or more capture probes (i.e., two, three, four, five, six, seven, eight, nine, ten, or more capture probes). The capture probe comprises a domain complementary to a portion of the target nucleic acid, and a domain comprising a substrate-binding portion. The portion of the target nucleic acid to which the capture probe is complementary can be the end of the target nucleic acid or not towards the end. The capture probe can comprise a cleavable portion between the domain complementary to a portion of the target nucleic acid and the domain comprising the substrate-binding portion.

[0283] Alternatively, the capture probe can comprise a first domain complementary to a portion of the target nucleic acid, a second domain comprising a moiety for binding to a substrate, and a third domain comprising a different moiety for binding to a substrate. The capture probe can comprise a cleavable portion between any of the domains.

[0284] The capture probe can be phosphorylated at the 5'-end. Alternatively, the capture probe can comprise at least one phosphorothioate bond. The capture probe can comprise at least two phosphorothioate bonds. Preferably, at least one or at least two phosphorothioate bonds are located at the 5'-end of the capture probe.

[0285] The moiety for binding to a substrate of the capture probe can be biotin, and the substrate can be avidin (e.g., streptavidin). Useful substrates comprising avidin are commercially available, including TB0200 (Accelr8), SAD6, SAD20, SAD100, SAD500, SAD2000 (Xantec), SuperAvidin (Array-It), streptavidin slides (Catalog #MPC 000, Xenopore), and STREPTAVIDINn slides (Catalog #439003, Greiner Bio-one). The moiety for binding to a substrate of the capture probe can be avidin (e.g., streptavidin), and the substrate can be biotin. Useful substrates comprising biotin that are commercially available include, but are not limited to, Optiarray-biotin (Accler8), BD6, BD20, BD100, BD500, and BD2000 (Xantec).

[0286] The moiety for binding to a substrate of the capture probe can be a reactive moiety capable of binding to a substrate by photoactivation. The substrate can comprise a photoreactive moiety, or the first portion of the nanoreporter can comprise a photoreactive moiety. Some examples of photoreactive moieties include aryl azides, such as N-((2-pyridyldithio)ethyl)-4-azidosalicylamide; fluorinated aryl azides, such as 4-azido-2,3,5,6-tetrafluorobenzoic acid; benzophenone-based reagents, such as the succinimidyl ester of 4-benzoylbenzoic acid; and 5-bromo-deoxyuridine.

[0287] The substrate-binding portion of the capture probe can be a nucleic acid, which can hybridize with the binding portion of a complementary substrate. Each nucleic acid comprising the substrate-binding portion of the capture probe can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, at least two, at least three, at least four, at least five or at least six nucleotides in the substrate-binding portion of the capture probe can be modified nucleotides or nucleotide analogues. The typical ratio of modified nucleotides or nucleotide analogues to canonical bases in the substrate-binding portion of the capture probe is from 1:2 to 1:8. Commonly used modified nucleotides or nucleic acid analogues in the substrate-binding portion of the capture probe are isoguanine and isocytosine.

[0288] The substrate-binding portion of the capture probe can be immobilized to the substrate via other binding pairs that are obvious to those skilled in the art. After binding to the substrate, the target nucleic acid can be elongated by applying a force sufficient to extend the target nucleic acid (e.g., gravity, hydrodynamic force, electromagnetic force "electro-stretching", flow stretching, receding meniscus technique, and combinations thereof). The capture probe can comprise a detectable label or be associated with a detectable label, i.e., a fiducial site.

[0289] The target nucleic acid can be bound by a second capture probe comprising a domain complementary to a second portion of the target nucleic acid. The second portion of the target nucleic acid bound by the second capture probe is different from the first portion of the target nucleic acid bound by the first capture probe. This portion can be the end of the target nucleic acid or not towards the end. The binding of the second capture probe can occur after or during the elongation of the target nucleic acid, or to a target nucleic acid that has not been elongated. The second capture probe can have the binding as described above.

[0290] The target nucleic acid can be bound by a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe comprising a domain complementary to a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth portion of the target nucleic acid. This portion can be the end of the target nucleic acid or not towards the end. The binding of the third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can occur after or during the elongation of the target nucleic acid, or to a target nucleic acid that has not been elongated. The third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can have the binding as described above.

[0291] The capture probe is capable of separating the target nucleic acid from a sample. Here, the capture probe is added to a sample containing the target nucleic acid. The capture probe binds the target nucleic acid via a region of the capture probe that is complementary to a region of the target nucleic acid. When the target nucleic acid contacts the substrate comprising the portion containing the substrate-binding portion of the bound capture probe, the nucleic acid becomes immobilized to the substrate.

[0292] Figure 8Shows target nucleic acid capture using the dual-capture probe system of the present disclosure. Genomic DNA is denatured at 95° C. and hybridized to a pool of capture reagents. The pool of capture reagents includes oligonucleotide probe A, probe B, and an antisense blocking probe. Probe A includes a biotin moiety at the 3'-end of the probe and a sequence complementary to the 5'-end of the target nucleic acid. Probe B includes a purification binding sequence that can be bound to a paramagnetic bead at the 5'-end of the probe and a nucleotide sequence complementary to the 3'-end of the target nucleic acid. The antisense blocking probe includes a nucleotide sequence complementary to the antisense strand of a portion of the target nucleic acid to be sequenced. After hybridization with the capture reagents, a sequencing window is generated on the target nucleic acid between the hybridized probe A and probe B. The target nucleic acid is purified using paramagnetic beads that bind to the 5'-sequence of probe B. Any excess capture reagents or complementary antisense DNA strands are washed away, resulting in purification of the desired target nucleic acid. The purified target nucleic acid is then flowed through a flow chamber that includes a surface, such as streptavidin, that can bind to the biotin moiety on the hybridized probe A. This results in tethering of one end of the target nucleic acid to the surface of the flow chamber. To capture the other end, the target nucleic acid is flow-stretched and a biotinylated probe complementary to the purification binding sequence of probe B is added. After hybridization with the purification binding sequence of probe B, the biotinylated probe can bind to the surface of the flow chamber, resulting in elongation of the captured target nucleic acid molecule and binding to the flow chamber surface at both ends.

[0293] To ensure that the user “captures” as many target nucleic acid molecules as possible from a highly fragmented sample, it is helpful to include multiple capture probes, each complementary to a different region of the target nucleic acid. For example, there can be three pools of capture probes, where the first pool is complementary to a region of the target nucleic acid near its 5'-end, the second pool is complementary to the middle region of the target nucleic acid, and the third pool is complementary to a region near the 3'-end. This can be extrapolated to the “n regions of interest” of each target nucleic acid. In this example, each individual pool of fragmented target nucleic acid binds to a capture probe that includes or is conjugated to a biotin tag. For each pool chamber, 1 / n of the input sample is partitioned (where n = the number of different regions in the target nucleic acid). The capture probe binds to the target nucleic acid of interest. The target nucleic acid is then immobilized via the biotin of the capture probe to avidin molecules that are adhered to a substrate. Optionally, the target nucleic acid is stretched, for example, via flow or electrostatic forces. All n pools can be stretched and bound simultaneously, or, to maximize the number of fully stretched molecules, pool 1 (which captures the most 5'-region) can be stretched and bound first; then pool 2 (which captures the middle region of the target) can be stretched and bound; and finally pool 3 can be stretched and bound.

[0294] The "two-bead based step purification" system of the present disclosure can be used to capture target nucleic acids. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A contains an OA sequence, a nucleic acid sequence complementary to the 5' end of the target nucleic acid, and a nucleic acid sequence attached to a biotin moiety. The OA sequence can contain the nucleotide sequence CGAAAGCCATGACCTCCGATCACTC (SEQ ID NO: 109) and can bind to a lawn oligonucleotide. The nucleic acid sequence attached to the biotin moiety is linked to the nucleic acid sequence complementary to the 5' end of the target nucleic acid via a cleavable linker. Probes B and C contain a nucleic acid sequence complementary to the target nucleic acid and a nucleic acid sequence attached to a biotin moiety. The nucleic acid sequence attached to the biotin moiety is linked to the nucleic acid sequence complementary to the target nucleic acid via a cleavable linker. Probe D contains a nucleic acid sequence complementary to the 3' end of the target nucleic acid, a purification binding sequence called the G sequence, and a biotin moiety. The biotin moiety is linked to the G sequence via a cleavable linker. First, the four capture probes are hybridized to the target nucleic acid. All probes hybridize to the target nucleic acid at non-overlapping positions, where probes B and C hybridize between probes A and D. Then, the target nucleic acid is purified using streptavidin paramagnetic beads that bind to the biotin moieties on the capture probes. Excess non-target genomic DNA is washed away from the beads. Then, the target nucleic acid-capture probe complex is released from the streptavidin paramagnetic beads by cleaving the cleavable linker within each capture probe. The target nucleic acid-capture probe complex is further purified using paramagnetic beads that bind to the purification G sequence on probe D. Excess capture probes are washed away, and the target nucleic acid-capture probe complex is eluted from the paramagnetic beads.

[0295] The "single-bead based step purification with λ exonuclease" system of the present disclosure can be used to capture target nucleic acids. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A contains a sequence complementary to the 5' end of the target nucleic acid sequence. The 5' end of probe A contains two phosphorothioate bonds. Probes B, C, and D contain a nucleic acid sequence attached to a biotin moiety at the 3' end of the probe and a nucleic acid sequence complementary to the target nucleic acid at the 5' end of the probe. The 5' ends of probes B, C, and D are phosphorylated. Probes A, B, C, and D hybridize to the target nucleic acid at non-overlapping positions. After the probes are hybridized to the target nucleic acid, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess gDNA and capture probes are washed away. The target nucleic acid-capture probe complex is eluted from the beads. Then, probes B, C, and D are digested using λ exonuclease, which preferentially degrades double-stranded DNA phosphorylated at the 5' end.

[0296] The "single-bead-based step purification using FEN1" system of the present disclosure can be used to capture target nucleic acids. There are four capture probes: probe A, probe B, probe C, and probe D. Probe A contains a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence complementary to the 5' end of the nucleic acid, and a 5' nucleic acid sequence that does not hybridize to the target nucleic acid and contains a biotin moiety. Probe B and probe C contain a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence complementary to the target nucleic acid, and a 5' nucleic acid sequence that does not hybridize to the target nucleic acid and contains a biotin moiety. Probe D contains a 3' sequence that does not hybridize to the target nucleic acid and a 5' sequence complementary to the target nucleic acid. Probes A, B, C, and D hybridize to the target nucleic acid such that probe A is adjacent to probe B, such that the 5' nucleic acid sequence on probe A that does not hybridize to the target nucleic acid sequence and contains a biotin moiety, and the 3' nucleic acid sequence on probe B that does not hybridize to the target nucleic acid, form a branched double-stranded DNA substrate with a 5' DNA flap, and probe B is adjacent to probe C, such that the 5' nucleic acid sequence on probe B that does not hybridize to the target nucleic acid sequence and contains a biotin moiety, and the 3' nucleic acid sequence on probe C that does not hybridize to the target nucleic acid, form a branched double-stranded DNA substrate with a 5' DNA flap, and probe C is adjacent to probe D, such that the 5' nucleic acid sequence on probe C that does not hybridize to the target nucleic acid sequence and contains a biotin moiety, and the 3' nucleic acid sequence on probe D that does not hybridize to the target nucleic acid, form a branched double-stranded DNA substrate with a 5' DNA flap. After the probes hybridize to the target nucleic acid sequence, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess genomic DNA and excess probes are washed off the beads. The target nucleic acid is eluted from the beads by incubation with thermostable flap endonuclease 1 (FEN1). FEN1 cleaves the 5' DNA flap, thereby separating the biotin moiety from the hybridized capture probe and releasing the target nucleic acid-capture probe complex.

[0297] The present disclosure also allows a user to capture and simultaneously sequence multiple target nucleic acids, and multiple capture probes can hybridize to a mixed sample of target nucleic acids. The multiple target nucleic acids can include a group of more than one nucleic acid in which each nucleic acid contains the same sequence, or a group of more than one nucleic acid in which each nucleic acid does not necessarily contain the same sequence. Similarly, the multiple capture probes can include a group of more than one capture probe that is equivalent in sequence, or a group of more than one capture probe that is not necessarily equivalent in sequence. For example, using multiple capture probes all containing the same sequence can allow a user to capture multiple target nucleic acids all containing the same sequence. By sequencing such multiple target nucleic acids containing the same sequence, a higher level of sequencing accuracy can be achieved due to data redundancy. In another example, a group of capture probes including capture probes complementary to each gene of interest can be used to simultaneously capture and sequence two or more specific genes of interest. This allows a user to perform multiplexed sequencing of specific genes. Figure 9Shows the results from an experiment using FFPE samples, captured using this method and detecting a multiplex cancer panel consisting of 100 targets.

[0298] The capture probe can also include a domain that binds (e.g., hybridizes) to a "multiplex oligonucleotide". The multiplex oligonucleotide can include at least three domains. The first domain can include a nucleic acid sequence that hybridizes to the capture probe. The second domain can include a unique nucleic acid sequence that identifies the sample. The third domain can include a moiety that binds to a substrate. Multiple multiplex oligonucleotides can be used in combination with the capture probes of the present disclosure to simultaneously sequence multiple target nucleic acids from at least two samples. Multiplex oligonucleotides can be used to simultaneously sequence multiple target nucleic acids from at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 100, or at least 1000 samples.

[0299] An example of simultaneously sequencing three target nucleic acid molecules from three samples using a multiplex oligonucleotide is as follows: The target nucleic acids from each of three samples (Sample 1, Sample 2, and Sample 3) hybridize to two capture probes: Probe A and Probe B. Probe A includes two domains. The first domain includes a moiety that binds to a substrate. The second domain includes a sequence complementary to the 5' end of the target nucleic acid. Probe B includes two domains. The first domain includes a sequence complementary to the 3' end of the target nucleic acid. The second domain includes a sequence complementary to the multiplex oligonucleotide. After the two capture probes have hybridized to the target nucleic acid, the second domain of Probe B hybridizes to the multiplex oligonucleotide. The multiplex oligonucleotide includes three domains. The first domain includes a sequence complementary to the second domain of Probe B. The second domain includes a unique nucleic acid sequence that identifies the sample. The third domain includes a moiety that binds to a substrate. After the multiplex oligonucleotide has hybridized, an endonuclease cleavage step is performed to remove any overhanging DNA on the target nucleic acid such that Probe A hybridizes to the 5' end of the target nucleic acid and Probe B hybridizes to the 3' end of the target nucleic acid. After the endonuclease treatment, the multiplex oligonucleotide is ligated to the 3' end of the target nucleic acid and then Probe B is removed. The target nucleic acid - Probe A complex is further purified and subsequently sequenced. Since each target nucleic acid from each sample is ligated to the multiplex oligonucleotide, the sample from which the target nucleic acid is derived can be identified by sequencing the multiplex oligonucleotide.

[0300] When complete sequencing coverage is desired, the number of different capture probes required is inversely proportional to the size of the target nucleic acid fragment. In other words, more capture probes will be required for highly fragmented target nucleic acids. For sample types with highly fragmented and degraded target nucleic acids (such as formalin-fixed paraffin-embedded tissues), including a multiplexed pool of capture probes can be useful. On the other hand, for samples with long target nucleic acid fragments, such as isolated nucleic acids obtained in vitro, a single capture probe at the 5' end may be sufficient.

[0301] The region of the target nucleic acid between two capture probes, or after a capture probe and before the end of the target nucleic acid, is referred to herein as a "sequencing window". Figure 8 shows the sequencing window generated when two capture probes are used to capture the target nucleic acid. The sequencing window is a portion of the target nucleic acid that can be used for binding by sequencing probes. The minimum sequencing window is the length of the target binding domain (e.g., 4 to 10 nucleotides), while the maximum sequencing window is most of the entire chromosome.

[0302] When sequencing large target nucleic acid molecules using the present method, a "blocking oligonucleotide" or a plurality of blocking oligonucleotides can hybridize along the length of the target nucleic acid to control the size of the sequencing window. The blocking oligonucleotide hybridizes to the target nucleic acid at specific positions, thereby preventing the binding of sequencing probes at those positions, resulting in a smaller desired sequencing window. By generating a smaller sequencing window, the sequencing reaction is confined to a specific target region on the target DNA molecule, increasing the speed and accuracy of sequencing. The use of blocking oligonucleotides is particularly useful when sequencing specific mutations at known positions within the target nucleic acid, as it is not necessary to sequence the entire target nucleic acid. In non-limiting examples, the methods of the present disclosure can be used for targeted sequencing of two heterozygous loci to distinguish between two different haplotypes.

[0303] The capture probe can comprise a nucleic acid molecule complex. The nucleic acid molecule complex can comprise a partially double-stranded nucleic acid molecule. In some aspects, the partially double-stranded nucleic acid molecule can comprise a target-specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0304] In some aspects, either strand of the partially double-stranded nucleic acid molecule can comprise from about 40 to about 150 nucleotides, or from about 60 to about 135 nucleotides, or from about 10 to about 90 nucleotides, or from about 25 to about 75 nucleotides, about 60 nucleotides, or from about 50 to about 100 nucleotides.

[0305] In some aspects, either strand of a partially double-stranded nucleic acid molecule can comprise at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten affinity moieties.

[0306] In some aspects, either strand of a partially double-stranded nucleic acid molecule can comprise at least one crosslinking moiety. The crosslinking moiety can be a chemical crosslinking moiety or a photoreactive crosslinking moiety.

[0307] The capture probe can comprise a single-stranded nucleic acid molecule. In various aspects, the single-stranded nucleic acid molecule can comprise a target-specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0308] The target-specific domain, the duplex domain, the single-stranded purification sequence, the cleavable moiety, the single-stranded overhang domain, the sample-specific domain, or the substrate-specific domain, can comprise at least one natural base or can be devoid of natural bases. In some aspects, the target-specific domain, the duplex domain, the single-stranded purification sequence, the cleavable moiety, the single-stranded overhang domain, the sample-specific domain, or the substrate-specific domain, can comprise at least one modified nucleotide or nucleic acid analogue or can be devoid of modified nucleotides.

[0309] The target-specific domain, the duplex domain, the single-stranded purification sequence, the cleavable moiety, the single-stranded overhang domain, the sample-specific domain, or the substrate-specific domain, can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural bases) and modified nucleotides or nucleic acid analogues (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified). When present in combination, the natural bases and the modified nucleotides or nucleic acid analogues can be arranged in any order.

[0310] The target-specific domain can comprise a nucleic acid sequence that is complementary to and hybridizes with a portion of the target nucleic acid molecule. In some aspects, the target-specific domain can comprise from about 10 to about 150 nucleotides, or from about 25 to about 100 nucleotides, or from about 35 to about 100 nucleotides, or from about 25 to about 125 nucleotides, or from about 15 to about 100 nucleotides.

[0311] In some aspects, the target-specific domain can hybridize within at least about 100 base pairs of the 3' end of the target nucleic acid molecule. In some aspects, the target-specific domain can hybridize within at least about 100 of the 5' end of the target nucleic acid molecule.

[0312] The duplex domain can comprise a nucleic acid sequence that is capable of annealing to another nucleic acid strand to form a partially or fully double-stranded nucleic acid molecule. In some aspects, the duplex domain can comprise from about 14 to about 45 nucleotides, or from about 25 to about 35 nucleotides, or about 30 nucleotides, or from about 10 to about 60 nucleotides, or from about 30 to about 50 nucleotides.

[0313] The single-stranded purification sequence can comprise a nucleic acid sequence suitable for use in purification. The single-stranded purification sequence can comprise an F-tag. The single-stranded purification can comprise an F-like tag. The single-stranded purification sequence can comprise the nucleotide sequence AACATCACACAGACC (SEQ ID NO: 112). The single-stranded purification sequence can comprise the nucleotide sequence GTCTATCATCACAGC (SEQ ID NO: 113).

[0314] The single-stranded purification sequence can comprise at least one affinity moiety, or at least two affinity moieties, or at least three affinity moieties, or at least four affinities, or at least five affinity moieties, or at least six affinity moieties, or at least seven affinity moieties, or at least eight affinity moieties, or at least nine affinity moieties or at least ten affinity moieties. The affinity moiety can be biotin. Thus, in some aspects, the single-stranded purification sequence can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten biotin moieties.

[0315] The single-stranded purification sequence can comprise at least 50 nucleotides, or from about 15 to about 50 nucleotides.

[0316] The cleavable portion can comprise an enzymatically cleavable portion. The enzymatically cleavable can comprise a USER sequence for cleavage by the USER enzyme. Alternatively, the cleavable portion can comprise a photocleavable portion.

[0317] The single-stranded overhang domain can comprise a single-stranded nucleic acid sequence that is capable of forming a 5'-overhanging flap structure together with a target nucleic acid molecule.

[0318] The sample-specific domain can comprise a nucleic acid sequence that identifies the biological sample from which the target nucleic acid molecule was obtained. The sample-specific domain can comprise L-DNA. The sample-specific domain can comprise D-DNA. The sample-specific domain can comprise a combination of L-DNA and D-DNA. The sample-specific domain can hybridize to any probe of the present disclosure. The sample-specific domain can comprise about 28 nucleotides.

[0319] In some aspects, the sample-specific domain can comprise at least one attachment site or at least two attachment sites. In aspects where the sample-specific domain comprises at least one attachment site or at least two attachment sites, the attachment site can comprise about 14 nucleotides, or about 10 nucleotides, or about 8 nucleotides.

[0320] The substrate-specific domain can comprise a nucleic acid sequence that hybridizes to a complementary nucleic acid molecule attached to the substrate. The substrate can be an array. The substrate-specific domain can comprise a nucleic acid sequence that hybridizes to a lawn oligonucleotide.

[0321] The substrate-specific domain can comprise a polyA sequence. The substrate-specific domain can comprise a polyT sequence. The substrate-specific domain can comprise an L-polyA sequence, wherein the nucleotides of the polyA sequence are L-DNA. The substrate-specific domain can comprise an L-polyT sequence, wherein the nucleotides of the polyT sequence are L-DNA. The substrate-specific domain can comprise L-DNA. The substrate-specific domain can comprise about 30 nucleotides.

[0322] Figure 34 A schematic diagram of an exemplary capture probe is shown, which comprises a nucleic acid molecule complex called "c5 probe complex" that binds to a target nucleic acid. The c5 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid, a duplex domain annealed to the other strand of the partially double-stranded nucleic acid molecule, a first single-stranded purification sequence, and a cleavable moiety located between the target-specific domain and the duplex domain. In this non-limiting example, the single-stranded purification sequence comprises an F-like tag, and the cleavable moiety comprises an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain annealed to the other strand of the partially double-stranded nucleic acid molecule, and a single-stranded overhang domain. In this non-limiting example, the single-stranded overhang domain and the target nucleic acid molecule form a 5'-overhanging flap structure.

[0323] Figure 34Also shown is a schematic diagram of an exemplary capture probe, which comprises a nucleic acid molecular complex called "c3 probe complex" that binds to a target nucleic acid. The c3 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid, a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, and a cleavable moiety located between the target-specific domain and the duplex domain. In this non-limiting example, the cleavable moiety comprises an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, a substrate-specific domain, a single-stranded purification sequence, and a cleavable moiety located between the single-stranded purification sequence and the substrate-specific domain. In this non-limiting example, the sample-specific domain comprises L-DNA, the substrate-specific domain comprises L-DNA, the single-stranded purification sequence comprises an F-tag, and the cleavable moiety is a photocleavable moiety.

[0324] Figure 41 Shown is a schematic diagram of an exemplary capture probe, which comprises a nucleic acid molecular complex called "c3.2 probe complex" that binds to a target nucleic acid molecule. The c3.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid, and a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand may optionally comprise at least one first affinity moiety. In some aspects, this strand may optionally comprise a cleavable moiety located between the target-specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, and a substrate-specific domain. In some aspects, this strand may optionally comprise at least one, or at least two, or at least three second affinity moieties.

[0325] Figure 41Also shown is a schematic diagram of an exemplary capture probe that includes a nucleic acid molecule complex called a "c5.2 probe complex" that binds to a target nucleic acid molecule. The c5.2 probe complex includes a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule includes a target-specific domain that hybridizes to the target nucleic acid and a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand may optionally include a cleavable portion located between the target-specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule includes a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, and a first single-stranded purification sequence, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence. In some aspects, the first single-stranded purification sequence may include at least one affinity moiety, such as at least one biotin moiety. In some aspects, the first single-stranded purification sequence may be replaced by at least one biotin moiety such that the other strand of the partially double-stranded nucleic acid molecule includes a duplex domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, at least one biotin moiety, a first cleavable portion located between the duplex domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the at least one biotin moiety.

[0326] Sample preparation method of the present disclosure The present disclosure provides methods of sample preparation that include immobilizing a target nucleic acid molecule to a substrate.

[0327] The sample preparation method of the present invention may include a CRISPR-based fragmentation step (see, for example, Baker and Mueller, "CRISPR-mediated isolation of specific megabase segments of genomic DNA", Nucleic Acids Research 2017, 45(19), e165; Tsai et al., "Amplification-free, CRISPR-Cas9 targeted enrichment and SMRT sequencing of repeat-expansion disease causative genomic regions", bioRxiv 203919; doi: https: / / doi.org / 10.1101 / 203919; Nachmanson et al., "Targeted genome fragmentation with CRISPR / Cas9 improves hybridization capture, reduces PCR bias, and enables efficient high-accuracy sequencing of small targets", bioRxiv 207027; doi: https: / / doi.org / 10.1101 / 207027). CRISPR fragmentation may include in vitro fragmented genomic DNA (gDNA) obtained from a biological sample by proximal cleavage at a protospacer adjacent motif (PAM) site located within the gDNA. The PAM site may comprise the nucleotide sequence NGG, where N is any nucleobase. Alternatively, the PAM site may comprise the nucleotide sequence NGA, where N is any nucleobase. Fragments generated by CRISPR-based fragmentation may be purified using a biotinylated CRISPR complex or an anti-CAS9 antibody.

[0328] The method for capturing a target nucleic acid may include: (1) fragmenting gDNA using a CRISPR-based fragmentation step; (2) contacting the fragmented gDNA with at least two capture probes, wherein at least one of the at least two capture probes is a c5 probe complex as described above, and at least one of the at least two capture probes is a c3 probe complex as described above, such that the c3 probe complex and the c5 probe complex hybridize to the target nucleic acid to form Figure 34the complex shown in; (3) removing the 5' overhanging flap structure by contacting the composition with FEN1; (4) ligating the 3' end of the target nucleic acid to the 5' end of the strand of the c3 probe complex comprising the substrate-specific domain; (5) binding the single-stranded purification sequence of the c5 probe complex to the first substrate; (6) cleaving the cleavable portion located between the duplex domains and the target-specific domains of the c3 and c5 probe complexes, respectively; (7) binding the single-stranded purification sequence of the c3 probe complex to the second substrate; (8) cleaving the cleavable portion located between the single-stranded purification sequence of the ligated c3 probe complex and the substrate-specific domain; and (9) hybridizing the substrate-specific domain to a complementary nucleic acid molecule attached to a third substrate.

[0329] In some aspects of the foregoing method, step (9) may be performed before step (8).

[0330] In some aspects of the foregoing method, steps (3) and (4) may be performed simultaneously. In some aspects of the foregoing method, steps (3) and (4) may be performed simultaneously.

[0331] In some aspects, the foregoing method may optionally include a step between steps (6) and (7), wherein target nucleic acid-capture probe complexes derived from different biological samples are combined. In this aspect, the target nucleic acid-capture probe complexes derived from different samples will include c3 probe complexes comprising unique sample-specific domains such that the target-specific domain identifies the biological sample from which each target nucleic acid is obtained.

[0332] Figure 34 - 40 Examples of the sample preparation method of the present disclosure are shown. In this non-limiting example, first, the gDNA obtained from a biological sample is fragmented using CRISPR-based fragmentation. After fragmentation, the target nucleic acid is hybridized to two capture probes, as Figure 34 shown. In this non-limiting example, the two capture probes are the c3 probe complex and the c5 probe complex as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c3 probe complex hybridizes to the target nucleic acid within no more than 8 nucleotides of the 3' end of the target nucleic acid via the target-specific domain, while the c5 probe complex hybridizes to the target nucleic acid via the target-specific domain such that the c5 probe complex hybridizes 5' to the c3 probe complex. The single-stranded overhang domain of the c5 probe complex and the target nucleic acid molecule form a 5' overhanging flap structure. After the two capture probes are hybridized, the target nucleic acid-capture probe complex is incubated with FEN1 and ligase. FEN1 removes the 5' overhanging flap structure, and the 3' end of the target nucleic acid is ligated by ligase to the strand of the c3 probe complex comprising the substrate-specific domain, as Figure 35 shown.Figure 36 The resulting complex shown binds to the F-like beads, which hybridize to the F-like tag present in the c5 probe complex. The beads are washed and USER enzyme is added. The USER enzyme cleaves the cleavable portion located between the target-specific domain and the duplex domain of both the c3 probe complex and the c5 probe complex, thereby releasing the target nucleic acid from the F-like beads, as Figure 37 shown. As Figure 38 The eluted complex shown is further purified using SPRI beads. The purified complex is then bound to F beads, which hybridize to the F tag present in the c3 probe complex. After washing, the target nucleic acid is eluted from the F beads by exposing the beads to UV light, thereby cleaving the photocleavable portion of the c3 probe complex located between the substrate-specific domain and the F tag, as Figure 39 shown. The resulting complex is then bound to the substrate by hybridizing the substrate-specific domain of the ligated c3 probe complex to a complementary nucleic acid attached to the substrate, as Figure 40 shown.

[0333] Figure 41 - 46 An example of another sample preparation method of the present disclosure is shown. In this non-limiting example, first, for example, by CRISPR-based fragmentation, the gDNA obtained from a biological sample is fragmented. After fragmentation, the target nucleic acid is hybridized to two capture probes, as Figure 41 shown. In this non-limiting example, the two capture probes are the c3.2 probe complex and the c5.2 probe complex as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c5.2 probe complex hybridizes to the target nucleic acid via the target-specific domain such that the c5.2 probe complex is 5' to the c3.2 probe complex. After the two capture probes are hybridized, the target nucleic acid is ligated to one strand of the c3.2 probe complex and one strand of the c5.2 complex, as Figure 42 shown. Ligation can include enzymatic ligation, self-ligation, chemical ligation, or any combination thereof. In aspects including enzymatic ligation, a high-fidelity, template-directed nick ligase can be used to perform the enzymatic ligation. Then the Figure 42 resulting complex shown is bound to beads comprising at least one oligonucleotide that hybridizes to a single-stranded purification sequence. The beads can be washed and the cleavable portion located between the sample-specific domain and the single-stranded purification sequence can be cleaved, thereby releasing the target nucleic acid from the beads, as Figure 43 shown. The resulting complex can then be immobilized on the substrate by hybridizing the substrate-specific domain to an oligonucleotide attached to the substrate, as Figure 44 shown. The substrate / oligonucleotide complex can be any array of the present disclosure.

[0334] The foregoing method can further include hybridizing at least one reporter probe to the sample-specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first detectable label and the second detectable label can then be identified, such that the sample from which the target nucleic acid is derived can be identified based on the identities of the first detectable label and the second detectable label.

[0335] Alternatively, the foregoing method can further include hybridizing a first reporter probe to the sample-specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first detectable label and the second detectable label can then be identified. The first detectable label and the second detectable label can then be removed, and a second reporter probe comprising a third detectable label and a fourth detectable label can be hybridized to the sample-specific domain. The third detectable label and the fourth detectable label can then be identified, such that the sample from which the target nucleic acid is derived can be identified based on the identities of the first detectable label, the second detectable label, the third detectable label, and the fourth detectable label.

[0336] After identifying the sample from which the target nucleic acid is derived, a cleavable portion located between the sample-specific domain and the duplex domain can be cleaved, as Figure 45 shown, to release the sample-specific domain.

[0337] Method of the present disclosure The sequencing method of the present disclosure includes reversibly hybridizing at least one sequencing probe disclosed herein to a target nucleic acid.

[0338] Methods for sequencing nucleic acids can include (1) hybridizing a sequencing probe as described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized to a substrate at one or more positions. Exemplary sequencing probes can comprise a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs described in Table 1. Exemplary target binding domains comprise at least eight nucleotides that hybridize to the target nucleic acid, wherein at least six nucleotides in the target binding domain can identify the corresponding nucleotide in the target nucleic acid molecule (e.g., these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes), and wherein at least two nucleotides in the target binding domain do not identify the corresponding nucleotide in the target nucleic acid molecule (e.g., these at least two nucleotides do not identify the complementary two nucleotides of the target molecule to which it hybridizes); wherein any nucleotide of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue, and wherein the at least two nucleotides in the target binding domain that do not identify the corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that are non-specific for the target determined by the at least six nucleotides in the target binding domain, or a universal base or degenerate base. Exemplary barcode domains include a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that can be bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid bound by the target binding domain.

[0339] In other aspects, exemplary target binding domains can comprise at least six nucleotides that hybridize to the target nucleic acid, wherein at least six nucleotides in the target binding domain can identify the corresponding nucleotide in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes); wherein none or any one of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue.

[0340] After hybridization of the sequencing probe with the target nucleic acid, the method includes (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment site of at least three attachment sites of the barcode domain; (3) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the positions and identities of at least two nucleotides in the immobilized target nucleic acid. For example, when the first complementary nucleic acid molecule comprises two detectable labels, the two detectable labels identify at least two nucleotides in the immobilized target nucleic acid.

[0341] After detecting at least two detectable labels, at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further includes (5) binding a first hybridized nucleic acid molecule lacking a detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising a detectable label, or contacting the first complementary nucleic acid molecule comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label. Thus, after step (5), no detectable label is bound to the first attachment site. The method further includes (6) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment site of at least three attachment sites of the barcode domain; (7) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the positions and identities of at least two nucleotides in the optionally immobilized target nucleic acid; (9) repeating steps (5) to (8) until each attachment site of at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides of at least a first region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe; and (10) removing the sequencing probe from the optionally immobilized target nucleic acid.

[0342] The method can further comprise (11) hybridizing a second sequencing probe to a target nucleic acid optionally immobilized at one or more positions, and wherein the target binding domains of the first and second sequencing probes are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (13) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the positions and identities of at least two nucleotides in the optionally immobilized target nucleic acid; (15) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment position, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising a detectable label, or contacting the first complementary nucleic acid molecule or complex comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (16) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (17) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the positions and identities of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each of the at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe; and (20) removing the second sequencing probe from the optionally immobilized target nucleic acid.

[0343] The method can further comprise assembling the identified nucleotide linear orders in at least a first region and at least a second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0344] Steps (5) and (6) can occur sequentially or simultaneously. The first detectable label and at least the second detectable label can have the same emission spectrum, or can have different emission spectra. The third detectable label and at least the fourth detectable label can have the same emission spectrum, or can have different emission spectra.

[0345] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first and second complementary nucleic acid molecules can each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The releasing force can be light. Preferably, UV light. The light can be provided by a light source selected from arc lamps, lasers, focused UV light sources, and light emitting diodes.

[0346] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is the same as a portion of the first complementary nucleic acid molecule, the portion binding to the first attachment position of at least three attachment positions of the barcode domain. The first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide that is adjacent to the first attachment position in the barcode domain.

[0347] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide that is adjacent to the second attachment position in the barcode domain.

[0348] The present disclosure also provides a method for sequencing a nucleic acid, which includes (1) hybridizing a sequencing probe as described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized to a substrate at one or more positions. Exemplary sequencing probes can comprise a target-binding domain and a barcode domain; wherein the target-binding domain comprises any of the constructs described in Table 1. Exemplary target-binding domains comprise at least eight nucleotides that hybridize to the target nucleic acid, wherein at least six nucleotides in the target-binding domain can identify the corresponding nucleotide in the target nucleic acid molecule (e.g., these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes), and wherein at least two nucleotides in the target-binding domain do not identify the corresponding nucleotide in the target nucleic acid molecule (e.g., these at least two nucleotides do not identify the complementary two nucleotides of the target molecule to which it hybridizes); wherein any nucleotide of the at least six nucleotides in the target-binding domain can be a modified nucleotide or nucleotide analogue, and wherein the at least two nucleotides in the target-binding domain that do not identify the corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that are non-specific for the target determined by the at least six nucleotides in the target-binding domain, or a universal base or a degenerate base. Exemplary barcode domains include a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that can be bound by a complementary nucleic acid molecule, wherein each of the at least three attachment positions corresponds to two nucleotides of at least six nucleotides in the target-binding domain, and the at least three attachment positions each have a different nucleic acid sequence, and wherein the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of at least six nucleotides in the target nucleic acid bound by the target-binding domain.

[0349] In other aspects, an exemplary target binding domain can comprise at least six nucleotides that hybridize to a target nucleic acid, wherein at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify the complementary six nucleotides of the target molecule to which it hybridizes); and wherein none or any one of at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analogue.

[0350] After the sequencing probe hybridizes to the target nucleic acid, the method comprises (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment site of at least three attachment sites of the barcode domain; (3) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule.

[0351] After detecting and recording at least two detectable labels, at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further comprises (4) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment site, thereby releasing the binding of the first complementary nucleic acid molecule comprising a detectable label, or contacting the first complementary nucleic acid molecule comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label. Thus, after step (4), no detectable label is bound to the first attachment site. The method further comprises (5) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment site of at least three attachment sites of the barcode domain; (6) detecting and recording the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each attachment site of at least three attachment sites in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) using the detectable labels recorded in step (3), step (6), and step (7) to identify the positions and identities of at least six nucleotides of at least a first region of the immobilized target nucleic acid that hybridize to the target binding domain of the sequencing probe; and (9) removing the sequencing probe from the optionally immobilized target nucleic acid.

[0352] The method can further comprise (10) hybridizing a second sequencing probe to a target nucleic acid optionally immobilized at one or more positions, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of the barcode domain; (12) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (13) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment position so as to displace the bound first complementary nucleic acid molecule or complex comprising a detectable label, or contacting the first complementary nucleic acid molecule or complex comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (14) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (15) detecting and recording the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (16) repeating steps (13) to (15) until each of the at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) using the detectable labels recorded in step (12), step (15) and step (16) to identify the positions and identities of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe; and (18) removing the second sequencing probe from the optionally immobilized target nucleic acid.

[0353] The method can further comprise assembling the identified nucleotide linear order of each of at least a first region and at least a second region of the immobilized target nucleic acid so as to identify the sequence of the immobilized target nucleic acid.

[0354] Steps (4) and (5) can occur sequentially or simultaneously. The first detectable label and at least the second detectable label can have the same emission spectrum, or can have different emission spectra. The third detectable label and at least the fourth detectable label can have the same emission spectrum, or can have different emission spectra.

[0355] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The releasing force can be light. Preferably, UV light. The light can be provided by a light source selected from arc lamps, lasers, focused UV light sources and light emitting diodes.

[0356] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is the same as a portion of the first complementary nucleic acid molecule, the portion binding to the first attachment position of at least three attachment positions of the barcode domain. The first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is complementary to a flanking single-stranded polynucleotide that is adjacent to the first attachment position in the barcode domain.

[0357] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence that is complementary to a flanking single-stranded polynucleotide that is adjacent to the second attachment position in the barcode domain.

[0358] The foregoing method can further comprise a medium suitable for recording a detectable label. Such a medium can be a suitable computer-readable medium.

[0359] The present disclosure further provides methods of sequencing nucleic acids using the various sequencing probes disclosed herein. For example, a target nucleic acid is hybridized to more than one sequencing probe, and each probe can sequence a portion of the target nucleic acid to which it hybridizes.

[0360] The present disclosure also provides methods for sequencing nucleic acids, which include: (1) hybridizing at least one first population of first sequencing probes comprising a plurality of sequencing probes described herein to a target nucleic acid optionally immobilized at one or more positions to a substrate; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (3) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the positions and identities of at least two nucleotides in the immobilized target nucleic acid; (5) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment position, thereby releasing the binding of the first complementary nucleic acid molecule comprising a detectable label, or contacting the first complementary nucleic acid molecule comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (6) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (7) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the positions and identities of at least two nucleotides in the optionally immobilized target nucleic acid; (9) repeating steps (5) to (8) until each attachment position of at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides of at least a first region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe; and (10) removing at least one first population of first sequencing probes from the optionally immobilized target nucleic acid.

[0361] The method can further comprise (11) hybridizing at least one second population of a second sequencing probe comprising a plurality of sequencing probes disclosed herein to a target nucleic acid optionally immobilized at one or more positions, and wherein the target binding domains of the first and second sequencing probes are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (13) detecting the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the positions and identities of at least two nucleotides in the optionally immobilized target nucleic acid; (15) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment position, thereby releasing the binding of the first complementary nucleic acid molecule or complex comprising a detectable label, or contacting the first complementary nucleic acid molecule or complex comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (16) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (17) detecting the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the positions and identities of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each attachment position of at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the sequencing probe; and (20) removing at least one second population of the second sequencing probe from the optionally immobilized target nucleic acid.

[0362] The method can further comprise assembling the identified nucleotide linear order in each of at least a first region and at least a second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0363] Steps (5) and (6) can occur sequentially or simultaneously. The first detectable label and at least the second detectable label can have the same emission spectrum, or can have different emission spectra. The third detectable label and at least the fourth detectable label can have the same emission spectrum, or can have different emission spectra.

[0364] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The releasing force can be light. Preferably, UV light. The light can be provided by a light source selected from arc lamps, lasers, focused UV light sources, and light emitting diodes.

[0365] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The first hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a first attachment position in a barcode domain.

[0366] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label may comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label may comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to a second attachment position in a barcode domain.

[0367] The present disclosure also provides methods for sequencing nucleic acids, which include (1) hybridizing at least one first population of a first sequencing probe comprising a plurality of sequencing probes described herein to a target nucleic acid optionally immobilized to a substrate at one or more positions; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of a barcode domain; (3) detecting and recording the first detectable label and the at least second detectable label of the bound first complementary nucleic acid molecule; (4) binding the first hybrid nucleic acid molecule lacking a detectable label to the first attachment position to release the binding of the first complementary nucleic acid molecule comprising a detectable label, or contacting the first complementary nucleic acid molecule comprising a detectable label with a force sufficient to release the first detectable label and the at least second detectable label; (5) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (6) detecting and recording the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each attachment position of at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) using the detectable labels recorded in step (3), step (6), and step (7) to identify the positions and identities of at least six nucleotides of at least a first region of the immobilized target nucleic acid hybridized by the target-binding domain of the sequencing probe; and (9) removing at least one first population of the first sequencing probe from the optionally immobilized target nucleic acid.

[0368] The method can further comprise (10) hybridizing at least one second population of a second sequencing probe comprising a plurality of sequencing probes disclosed herein to a target nucleic acid optionally immobilized at one or more positions, and wherein the target binding domains of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment position of at least three attachment positions of the barcode domain; (12) detecting and recording the first detectable label and at least the second detectable label of the bound first complementary nucleic acid molecule; (13) binding a first hybrid nucleic acid molecule lacking a detectable label to the first attachment position to displace the bound first complementary nucleic acid molecule or complex comprising a detectable label, or contacting the first complementary nucleic acid molecule or complex comprising a detectable label with a force sufficient to release the first detectable label and at least the second detectable label; (14) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment position of at least three attachment positions of the barcode domain; (15) detecting and recording the third detectable label and at least the fourth detectable label of the bound second complementary nucleic acid molecule; (16) repeating steps (13) to (15) until each of at least three attachment positions in the barcode domain has been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) using the detectable labels recorded in steps (12), (15) and (16) to identify the positions and identities of at least six nucleotides of at least a second region of the immobilized target nucleic acid hybridized by the target binding domain of the second sequencing probe; and (18) removing at least one second population of the second sequencing probe from the optionally immobilized target nucleic acid.

[0369] The method can further comprise assembling the identified nucleotide linear order of each of at least a first region and at least a second region of the immobilized target nucleic acid to identify the sequence of the immobilized target nucleic acid.

[0370] Steps (4) and (5) can occur sequentially or simultaneously. The first detectable label and at least the second detectable label can have the same emission spectrum, or can have different emission spectra. The third detectable label and at least the fourth detectable label can have the same emission spectrum, or can have different emission spectra.

[0371] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photocleavable. The releasing force can be light. Preferably, UV light. The light can be provided by a light source selected from arc lamps, lasers, focused UV light sources, and light emitting diodes.

[0372] The first complementary nucleic acid molecule and the first hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The first hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide that is adjacent to a first attachment position in a barcode domain.

[0373] The second complementary nucleic acid molecule and the second hybrid nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybrid nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide that is adjacent to a second attachment position in a barcode domain.

[0374] The foregoing method can further comprise a medium suitable for recording the detectable label. Such a medium can be a suitable computer-readable medium.

[0375] Sequencing methods are further described herein.

[0376] Figure 10 A schematic overview of a single exemplary sequencing cycle of the present disclosure is shown. Although the method does not require immobilization of the target nucleic acid prior to sequencing, in this example, the method begins with a target nucleic acid that has been captured and bound to the surface of a flow cell using a capture probe, as shown in the upper leftmost figure. Then a pool of sequencing probes is flowed into the flow cell to allow the sequencing probes to hybridize to the target nucleic acid. In this example, the sequencing probes are Figure 1 those depicted in. These sequencing probes comprise a hexamer sequence that hybridizes to the target nucleic acid within a target binding domain. The hexamer is flanked on either side by (N) bases, which can be universal / degenerate bases or any of the four canonical bases that are not specific for the target determined by bases b1-b2-b3-b4-b5-b6. Using the hexamer sequence, a collection of 4096 (4^6) sequencing probes enables sequencing of any target nucleic acid. For this example, a collection of 4096 sequencing probes is hybridized to the target nucleic acid in 8 pools of 512 sequencing probes each. The hexamer sequence in the target binding domain of the sequencing probes will hybridize along the length of the target nucleic acid at positions where there is a perfect complementary match between the hexamer and the target nucleic acid, as shown in Figure 10 the upper middle figure of. In this example, a single sequencing probe hybridizes to the target nucleic acid. Any unbound sequencing probes are washed out of the flow cell.

[0377] These sequencing probes also contain a barcode domain having three attachment positions R1, R2, and R3 as described above. The attachment region within attachment position R1 contains one or more nucleotide sequences that correspond to the first dinucleotide of the hexamer of the sequencing probe. Thus, only a reporter probe containing a complementary nucleic acid corresponding to the identity of the first dinucleotide present in the target binding domain of the sequencing probe hybridizes to attachment position R1. Similarly, the attachment region within attachment position R2 of the sequencing probe corresponds to the second dinucleotide present in the target binding domain, and the attachment region within attachment position R3 of the sequencing probe corresponds to the second dinucleotide present in the target binding domain.

[0378] The method continues with Figure 10 the upper rightmost figure of. A pool of reporter probes is flowed into the flow cell. Each reporter probe in the pool of reporter probes contains a detectable label in the form of a two-color combination, and a complementary nucleic acid that can hybridize to the corresponding attachment region within attachment position R1 of the sequencing probe. As described above, the two-color combination and the complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. Each pool of reporter probes is designed such that the two-color combination corresponding to a specific dinucleotide is established prior to sequencing. For example, in Figure 10 the sequencing experiment shown in, for the first pool of reporter probes that hybridizes to attachment position R1, the two-color combination yellow - red can correspond to the dinucleotide adenine - thymine. After the reporter probe hybridizes to attachment position R1, as shown in Figure 10 the upper right figure of, any unbound reporter probes are then washed out of the flow cell, and the detectable label of the bound reporter probes is recorded to determine the identity of the first dinucleotide of the hexamer.

[0379] The detectable label attributed to the reporter probe that hybridized to attachment position R1 is removed. To remove the detectable label, the reporter probe can include a cleavable linker, and an appropriate cleavage reagent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to attachment position R1 of the sequencing probe and displaces the reporter probe having the detectable label. Regardless of the method of removing the detectable label, attachment position R1 no longer emits a detectable signal. The attachment position of the barcode domain that previously emitted a detectable signal is, in this article, referred to as "darkened" by the process that causes it to no longer be able to emit a detectable signal.

[0380] Flow a second reporting probe pool into the flow cell. Each reporting probe in the reporting probe pool contains a detectable label in a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment region within the attachment location R2 of the sequencing probe. The two-color combination and complementary nucleic acid of a particular reporting probe correspond to one of 16 possible dinucleotides. It is possible that a particular two-color combination corresponds to one dinucleotide in the context of the first reporting probe pool and a different dinucleotide in the context of the second reporting probe pool. After the reporting probe hybridizes to the attachment location R2, as shown in the lower right figure of Figure 10 Then, any unbound reporting probes are washed out of the flow cell, and the detectable label is recorded to determine the identity of the second dinucleotide of the hexamer present in the sequencing probe.

[0381] To remove the detectable label at position R2, the reporting probe can include a cleavable linker, and an appropriate cleavage reagent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to the attachment location R2 of the sequencing probe and displaces the reporting probe having the detectable label. Regardless of the method for removing the detectable label, the attachment location R2 no longer emits a detectable signal.

[0382] Then flow a third reporting probe pool into the flow cell. Each reporting probe in the third reporting probe pool contains a detectable label in a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment region within the attachment location R3 of the reporting probe. The two-color combination and complementary nucleic acid of a particular reporting probe correspond to one of 16 possible dinucleotides. After the reporting probe hybridizes to position R3, as shown in the middle lower figure of Figure 10 Then, any unbound reporting probes are washed out of the flow cell, and the detectable label is recorded to determine the identity of the third dinucleotide of the hexamer present in the sequencing probe. In this way, all three dinucleotides of the target binding domain are identified and can be assembled together to reveal the sequence of the target binding domain and thus the sequence of the target nucleic acid.

[0383] To continue sequencing the target nucleic acid, any bound sequencing probes can be removed from the target nucleic acid. The sequencing probes can be removed from the target nucleic acid even if the reporting probes remain hybridized to position R3 of the barcode domain. Alternatively, the reporting probes hybridized to position R3 can be removed from the barcode domain before removing the sequencing probes from the target binding domain, for example, by using the darkening procedure described above for the reporters at positions R1 and R2.

[0384] Figure 10The sequencing cycles shown can be repeated any number of times, and each sequencing cycle begins with the hybridization of the same pool of sequencing probes to the target nucleic acid molecule, or the hybridization of different pools of sequencing probes to the target nucleic acid. It is possible for the location where the second pool of sequencing probes binds to the target nucleic acid to overlap the location where the first sequencing probe or pool of sequencing probes bound during the first sequencing cycle. Thus, certain nucleotides within the target nucleic acid can be sequenced more than once and with more than one sequencing probe.

[0385] Figure 11 Depicts a schematic diagram of a complete cycle of the sequencing method of the present disclosure, and the corresponding imaging data collected during that cycle. In this example, the sequencing probes used are Figure 1 those depicted in Figure 10 and those depicted and described above. After the sequencing domain of the sequencing probe hybridizes to the target nucleic acid, a reporter probe is hybridized to the first attachment position (R1) of the sequencing probe. The first reporter probe is then imaged to record a colored dot. In Figure 11 the colored dots are marked with dashed circles. The colored dots correspond to a single sequencing probe recorded during the complete cycle. In this example, 7 sequencing probes (1 to 7) are recorded. The first attachment position of the barcode domain is then darkened, and a dual-fluorescent reporter probe is hybridized to the second attachment position (R2) of the sequencing probe. The second reporter probe is then imaged to record a colored dot. The second attachment position of the barcode domain is then darkened, and a dual-fluorescent reporter probe is hybridized to the third attachment position (R3) of the sequencing probe. The third reporter probe is then imaged to record a colored dot. The three colored dots from each of the sequencing probes 1 to 7 are then arranged in order. A decoding matrix is then used to map each colored patch to a specific dinucleotide to reveal the sequence of the target binding domain of the sequencing probes 1 to 7.

[0386] During a single sequencing cycle, the number of pools of reporter probes required to determine the sequence of the target binding domain of any sequencing probe that binds to the target nucleic acid is equal to the number of attachment positions in the barcode domain. Thus, for a barcode domain with three positions, three pools of reporter probes are cycled through the sequencing probes.

[0387] A pool of sequencing probes can contain multiple sequencing probes that are all identical in sequence, or multiple sequencing probes that are not all identical in sequence. When a pool of sequencing probes includes multiple sequencing probes that are not all identical in sequence, each different sequencing probe can be present in the same number, or different sequencing probes can be present in different numbers.

[0388] Figure 12Shows an exemplary sequencing probe pool configuration of the present disclosure, where when the sequencing probe contains the following, the 8 color combinations specified above are used to design 8 different sequencing probe pools: (a) a target binding domain having 6 nucleotides (hexamer) that specifically binds to the target nucleic acid, and (b) three attachment positions (R1, R2, and R3) in the barcode domain. There are 4096 possible unique hexamer sequences (4x4x4x4x4x4 = 4096). Given that each of the three attachment positions in the barcode domain can hybridize with a complementary nucleic acid bound by one of 8 different color combinations, there are 512 unique sets of 3-color combinations possible (8*8*8 = 512). For example, for a probe where R1 hybridizes with a complementary nucleic acid bound by the color combination GG, R2 hybridizes with a complementary nucleic acid bound by the color combination BG, and R3 hybridizes with a complementary nucleic acid bound by the color combination YR, the set of 3-color combinations is accordingly GG-BG-YR. Within a sequencing probe pool, each unique set of 3-color combinations corresponds to a unique hexamer within the target binding domain. Given that each pool contains 512 unique hexamers and there are a total of 4096 possible hexamers, 8 pools are needed to sequence all possible hexamers (4096 / 512 = 8). Specific sequencing probes are determined to be placed in each of the 8 pools to ensure optimal hybridization of each sequencing probe with the target nucleic acid. To ensure optimal hybridization, several precautions are taken, including: (a) dividing complete hexamer complements into different pools; (b) dividing hexamers with high Tm and low Tm into different pools; and (c) dividing hexamers into different pools based on empirically known hybridization patterns.

[0389] Figure 13 Shows the differences between the sequencing probes described in U.S. Patent Publication No. 20160194701 and the sequencing probes of the present disclosure. As Figure 13 shown in the left figure of Figure 13 , U.S. Patent Publication No. 20160194701 describes a sequencing probe having a barcode domain that contains six attachment positions that hybridize with complementary nucleic acids. Each complementary nucleic acid is bound to one of four different fluorescent dyes. In this configuration, each color (red, blue, green, yellow) corresponds to a nucleotide (A, T, C, or G) in the target binding domain. This probe design results in 4096 unique probes (4^6). As Figure 13depicted in the right panel of. Different from U.S. Patent Publication No. 20160194701, these complementary nucleic acids are bound by one of eight different color combinations (GG, RR, GY, RY, YY, RG, BB, and RB). Each color combination corresponds to a specific dinucleotide in the target binding domain. This configuration results in 512 unique probes (8^3). To cover all possible hexamer combinations (4096) within the target binding domain, eight separate pools of these 512 unique probes are required to sequence the entire target nucleic acid. Since eight color combinations are used to label the complementary nucleic acids, but there are 16 possible dinucleotides, certain color combinations will correspond to different dinucleotides, depending on which sequencing probe pool is to be used. For example, in Figure 13 , in the first, second, third, and fourth sequencing probe pools, the color combination BB corresponds to the dinucleotide AA, while the color combination GG corresponds to the dinucleotide AT. In the fifth, sixth, seventh, and eighth sequencing probe pools, the color combination BB corresponds to the dinucleotide CA, while the color combination CT corresponds to the dinucleotide AT.

[0390] Multiple sequencing probes (i.e., more than one sequencing probe) can hybridize within the sequencing window. During sequencing, the identity and spatial location of the detectable labels bound to each of the multiple hybridized sequencing probes are recorded. This allows subsequent identification of both the positions and identities of multiple dinucleotides. In other words, by hybridizing multiple sequencing probes to a single target nucleic acid molecule simultaneously, multiple positions along the target nucleic acid can be sequenced concurrently, increasing the sequencing speed.

[0391] In some aspects, a single sequencing probe can hybridize to a captured target nucleic acid molecule. In some aspects, multiple sequencing probes can hybridize to a captured target nucleic acid molecule. The sequencing window between two hybridized 5' and 3' capture probes can allow hybridization of a single sequencing probe or multiple sequencing probes along the length of the target nucleic acid molecule. By hybridizing multiple sequencing probes along the length of the target nucleic acid molecule, more than one position on the target nucleic acid molecule can be sequenced simultaneously, increasing the sequencing speed. The fluorescence signals of individual probes from multiple probes bound along the length of the target nucleic acid can be spatially resolved.

[0392] In some aspects, the sequencing probes can bind at uniform intervals along the length of the target nucleic acid. In some aspects, the sequencing probes do not need to bind at uniform intervals along the length of the target nucleic acid. The signals from multiple sequencing probes bound along the length of the target nucleic acid can be spatially resolved to obtain sequencing information at multiple positions on the target nucleic acid simultaneously.

[0393] The distribution of probes along the length of the target nucleic acid is crucial for the resolution of detectable signals. Sometimes, too many probes in a given region can result in overlap of their detectable labels, preventing the resolution of two nearby probes. This is explained as follows. Given that a nucleotide has a length of 0.34 nm and given that the lateral (x-y) spatial resolution of the sequencing device is approximately 200 nm, the resolution limit of the sequencing device is approximately 588 base pairs (i.e., 1 nucleotide / 0.34 nm x 200 nm). That is, when two probes are within approximately 588 base pairs of each other, the above-mentioned sequencing device will not be able to resolve the signals from two probes hybridized to the target nucleic acid. Thus, depending on the resolution of the sequencing device, two probes will need to be spaced apart by approximately 600 bp before their detectable labels can be resolved as distinct "sites". Therefore, at optimal spacing, there should be a single probe per 600 bp of target nucleic acid. Preferably, each sequencing probe in the probe population will not bind closer than 600 nucleotides to each other. Various software methods (e.g., utilizing fluorescence intensity values and wavelength-dependent ratios) can be used to monitor, limit, and potentially deconvolve the number of probes hybridized within resolvable regions of the target nucleic acid and, accordingly, design the probe population. Additionally, detectable labels that provide more discrete signals (e.g., fluorescent labels) can be selected. Further, methods in the literature (e.g., Small and Parthasarthy: "Superresolution localization methods." Annu. Rev. Phys Chem., 2014; 65:107-25) describe structured illumination and various superresolution methods that reduce the resolution limit of the sequencing microscope down to 10 nm. Using a sequencing device with higher resolution allows the use of probes with shorter target-binding domains.

[0394] As mentioned above, the design of probe Tm can affect the number of probes hybridized to the target nucleic acid. Alternatively or additionally, the concentration of sequencing probes in the population can be increased to increase the probe coverage in specific regions of the target nucleic acid. The concentration of sequencing probes can be decreased to reduce the probe coverage in specific regions of the target nucleic acid, e.g., above the resolution limit of the sequencing device.

[0395] Although the resolution limit for two detectable labels is about 600 nucleotides, this does not prevent the powerful sequencing methods of the present disclosure. In some aspects, multiple sequencing probes in any population are not separated by 600 nucleotides on the target nucleic acid. However, statistically (following a Poisson distribution), there are target nucleic acids that have only one sequencing probe bound to them, and that sequencing probe is the optically resolvable kind. For target nucleic acids with multiple probes that bind within 600 nucleotides (and thus are not optically resolvable), data regarding these indistinguishable sequencing probes may be discarded. Importantly, the methods of the present disclosure provide multiple rounds of binding and detection of multiple sequencing probes. Thus, signals from all sequencing probes may be detected in several rounds, signals from only a subset of the sequencing probes may be detected in several rounds, and signals from any of the sequencing probes may not be detected in several rounds. In some aspects, the distribution of sequencing probes bound to the target nucleic acid can be manipulated (e.g., by controlling concentration or dilution) such that each target nucleic acid binds only one sequencing probe.

[0396] Randomly, but in part depending on the length of the target binding domain, the Tm of the probe, and the applied probe concentration, it is possible for two different sequencing probes in a population to bind within 600 nucleotides of each other.

[0397] Alternatively or additionally, the concentration of sequencing probes in the population can be reduced to lower the probe coverage in specific regions of the target nucleic acid, e.g., above the resolution limit of the sequencing device, so as to generate a single read from a resolution-limited site.

[0398] If the sequence or a portion of the sequence of the target nucleic acid is known prior to sequencing the target nucleic acid using the methods of the present disclosure, the sequencing probes can be designed and selected such that no two sequencing probes bind to the target nucleic acid within 600 nucleotides of each other.

[0399] Prior to hybridization of a sequencing probe to a target nucleic acid, one or more complementary nucleic acid molecules can be conjugated by a first detectable label, and at least a second detectable label can hybridize to one or more attachment sites within the barcode domain of the sequencing probe. For example, prior to hybridization to the target nucleic acid, one or more complementary nucleic acid molecules conjugated by the first detectable label and at least the second detectable label can be hybridized to a first attachment site of each sequencing probe. Thus, when contacted with its target nucleic acid, the sequencing probe is capable of emitting a detectable signal from the first attachment site and does not require provision of a first pool of complementary nucleic acids or reporter probes directed to a first position on the barcode domain. In another example, one or more complementary nucleic acid molecules conjugated by the first detectable label and at least the second detectable label can be hybridized to all attachment sites within the barcode domain of the sequencing probe. Thus, in this example, a six-nucleotide sequence can be read without sequentially replacing the complementary nucleic acids. Since many steps of the method are omitted, use of such pre-hybridized sequencing probe-reporter probe complexes will reduce the time to obtain sequence information. However, such probes would benefit from non-overlapping detectable labels, such as fluorophores excited by non-overlapping wavelengths of light or fluorophores emitting non-overlapping wavelengths of light.

[0400] In some aspects of the methods of the present disclosure, the signal intensity from the recorded color dots can be used to more accurately sequence the target nucleic acid. In some aspects, the site intensity of a particular color within a color dot can be used to determine the probability that the specific color dot corresponds to a color combination for which it is a repeat (i.e., BB, GG, YY, or RR).

[0401] Darkening of a position within the barcode domain can be achieved by cleavage of a strand at a cleavable linker modification present within the reporter probe hybridized to that position. Figure 14 Depicted is darkening of a barcode position using a cleavable linker modification during a sequencing cycle. In Figure 14 The first step depicted on the leftmost figure, includes hybridizing a primary nucleic acid of a reporter probe to a first attachment site of a sequencing probe. The primary nucleic acid hybridizes to a specific complementary sequence within an attachment region of a first position of the barcode domain. A first domain and a second domain of the primary nucleic acid are covalently linked by a cleavable linker modification. In the second step, the detectable label is then recorded to determine the identity and position of a specific dinucleotide in the target binding domain of the sequencing probe. In the third step, the first position of the barcode domain is darkened by cleavage of the reporter probe at the cleavable linker modification. This releases the second domain of the primary nucleic acid, thereby releasing the detectable label. The first domain of the primary nucleic acid molecule, now lacking any detectable label, remains hybridized to the first attachment site of the barcode domain, such that the first position of the barcode domain no longer emits a detectable signal and will not be able to hybridize to any other reporter probe in subsequent sequencing steps. InFigure 14 In the last step depicted in the rightmost figure, the reporter probe is hybridized to the second position of the barcode domain to continue sequencing.

[0402] The attachment position of the barcode domain can be darkened by: displacing any secondary or tertiary nucleic acid in the reporter probe that is bound by a detectable label while still allowing the primary nucleic acid molecule of the reporter probe to remain hybridized to the sequencing probe. This displacement can be achieved by hybridization with a primary, secondary, or tertiary nucleic acid that is not bound by the detectable label. Figure 15 is an illustrative example of an exemplary sequencing cycle of the present disclosure, in which positions within the barcode domain are darkened by displacement of labeled secondary nucleic acids. Figure 15 The leftmost figure of depicts the start of a sequencing cycle, in which the primary nucleic acid molecule of the reporter probe hybridizes to the first attachment position of the barcode domain of the sequencing probe. A secondary nucleic acid molecule bound to a detectable label is then hybridized to the primary nucleic acid molecule, and the detectable label is recorded. To darken the first position of the barcode domain, the secondary nucleic acid molecule bound to the detectable label is displaced by a secondary nucleic acid molecule lacking the detectable label. In the next step of the sequencing cycle, a reporter probe containing the detectable label is hybridized to the second position of the barcode domain.

[0403] The attachment positions of the barcode domain can be darkened by hybridizing the sequencing probe at the corresponding barcode domain attachment positions where the nucleic acid is not bound by the detectable label to displace any primary nucleic acid molecules of the reporter probe. In cases where the barcode domain contains at least one single-stranded nucleic acid sequence adjacent to or flanking at least one attachment position, the nucleic acid not bound by the detectable label can displace the primary nucleic acid molecule by hybridizing to the flanking sequence and a portion of the barcode domain occupied by the primary nucleic acid molecule. When needed, the rate of detectable label exchange can be accelerated by incorporating small single-stranded oligonucleotides (e.g., "toehold" probes; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc. 2006, 128(37), pp. 12211-12220) that accelerate the exchange rate of the detectable label.

[0404] Rather than replacing the complementary nucleic acid or reporter probe containing the detectable label, the complementary nucleic acid or reporter probe containing the detectable label can be removed from the attachment region. For example, this can occur by adding chaotropes, raising the temperature, changing the salt concentration, adjusting the pH, and / or applying hydrodynamic forces. In these instances, fewer reagents (i.e., hybridizing nucleic acids lacking the detectable label) are required.

[0405] The methods of the present disclosure can be used to simultaneously capture and sequence RNA and DNA molecules from the same sample, including mRNA and gDNA. Capture and sequencing of both RNA and DNA molecules from the same sample can be performed in the same flow cell. In some aspects, the methods of the present disclosure can be used to simultaneously capture, detect, and sequence both gDNA and mRNA from FFPE samples.

[0406] The sequencing methods of the present disclosure further include the step of assembling the linear order of each identified nucleotide for each region of the immobilized target nucleic acid to identify the sequence of the immobilized target nucleic acid. The assembly step uses a non-transitory computer-readable storage medium on which an executable program is stored. The program instructs a microprocessor to arrange the linear order of each identified nucleotide for each region of the target nucleic acid to obtain the sequence of the nucleic acid. Assembly can occur "in real time," i.e., while data is being collected from the sequencing probes, rather than after all data has been collected or after data acquisition has been completed.

[0407] The raw specificity of the sequencing methods of the present disclosure is approximately 94%. By sequencing the same base in the target nucleic acid with more than one sequencing probe, the accuracy rate of the sequencing methods of the present disclosure can be increased to approximately 99%. Figure 16 Illustrated how the sequencing methods of the present disclosure allow the same base of the target nucleic acid to be sequenced with different sequencing probes. The target nucleic acid in this example is a fragment of NRAS exon 2 (SEQ ID NO: 1). The specific base of interest is the cytosine (C) highlighted in the target nucleic acid. The base of interest will hybridize to two different sequencing probes, each with a unique footprint for hybridizing to the target nucleic acid. In this example, sequencing probes 1 to 4 (barcodes 1 to 4) bind to 3 nucleotides to the left of the base of interest, while sequencing probes 5 to 8 (barcodes 5 to 8) bind to 5 nucleotides to the left of the base of interest. Thus, the base of interest will be sequenced by two different probes, thereby increasing the amount of base identification for that specific position and thus increasing the overall accuracy rate at that specific position. Figure 17 Shows how multiple different base identifications at specific nucleotide positions on the target nucleotide, recorded from one or more sequencing probes, can be combined to form a consensus sequence (SEQ ID NO: 2), thereby increasing the accuracy rate of the final base identification.

[0408] The terms "Hyb&Seq chemistry," "Hyb&Seq sequencing," and "Hyb&Seq" refer to the methods of the present disclosure described above.

[0409] Arrays of the present disclosure and methods of using the same The present disclosure provides compositions and methods for immobilizing nucleic acid molecules, including arrays and methods of using the arrays, as described in detail herein.

[0410] The present disclosure provides a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, and wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0411] The present disclosure provides a composition comprising: a planar solid support substrate; a first layer in contact with a first surface of the planar solid support substrate, on the planar solid support substrate; a second layer on the first layer in contact with a second surface of the first layer, wherein the second surface of the first layer is not in contact with the surface of the planar solid support substrate; wherein the second layer comprises a plurality of nanopores, wherein each nanopore provides access to an exposed portion of the first layer, and wherein each nanopore comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.

[0412] The first layer may include a first surface in contact with the surface of the planar solid support substrate, and a second surface in contact with the second layer but not in contact with the surface of the planar solid support substrate.

[0413] The second layer may include a first surface in contact with the surface of the first layer, and a second surface exposed to the environment.

[0414] Figure 47 is a schematic cross-section of an exemplary array of the present invention. The array includes a planar solid support substrate 101, a first layer 102 on the planar solid support substrate 101, and a second layer 103 on the first layer 102. The second layer 103 includes a plurality of nanopores 104. Each nanopore 104 opens on both sides, thereby exposing a portion of the first layer in each nanopore 105. A plurality of first oligonucleotides 106 are covalently attached to the exposed first layer 105 in each nanopore.

[0415] In some aspects, the planar solid support substrate may be a surface, a membrane, a bead, a porous material, or an electrode. For example, the planar solid support substrate may comprise, but is not limited to, a polymeric material, a metal, silicon, glass, or quartz.

[0416] In some aspects, the first layer 102 may comprise an oxide film, such as, but not limited to, silica.

[0417] In some aspects, the first layer 102 may have a thickness of about 50 to about 150 nm. The first layer 102 may have a thickness of about 90 nm.

[0418] In some aspects, the second layer 103 may comprise, but is not limited to, bis(trimethylsilyl)amine, also known as hexamethyldisilazane (HMDS or HDMS).

[0419] In some aspects, the second layer 103 can comprise a material that is not chemically reactive such that the second layer does not bind biological macromolecules.

[0420] In some aspects, the second layer 103 can have a thickness of from about 1 nm to about 10 nm. The second layer 103 can have a thickness of from about 3 nm to about 4 nm.

[0421] In some aspects, the planar solid support substrate comprises silicon, the first layer comprises silica, and the second layer comprises HMDS.

[0422] In some aspects, the planar solid support substrate comprises glass, the first layer comprises silica, and the second layer comprises HMDS.

[0423] In some aspects, the second layer can comprise from about 0.1×10 5 to about 100×10 7 nanopores per square millimeter. The second layer can comprise from about 0.1×10 6 to about 100×10 6 nanopores per square millimeter. The second layer can comprise from about 1×10 6 to about 10×10 6 nanopores per square millimeter. The second layer can comprise from about 2×10 6 to about 5×10 6 nanopores per square millimeter. The second layer can comprise about 3×10 6 nanopores per square millimeter.

[0424] As used herein, "density of nanopores" refers to the number of nanopores present within a specified surface area. For example, a second layer having a surface area of 1.0 mm 2 and comprising 1.0×10 6 nanopores is said to have a nanopore density of 1.0×10 6 nanopores / mm 2 .

[0425] In some aspects, the density of nanopores can be from about 0.1×10 5 to about 100×10 7 nanopores / mm 2 . The density of nanopores can be from about 0.1×10 6 to about 100×10 6 nanopores / mm 2 . The density of nanopores can be from about 1×10 6 to about 10×10 6 nanopores / mm 2 . The density of nanopores can be from about 2×10 6 to about 5×106 nanopores / mm 2 The density of the nanopores can be about 3×10 6 nanopores / mm 2 .

[0426] In some aspects, the surface area of the exposed portion of the first layer in the nanopore can be about 200 to about 50,000 nm 2 The surface area of the exposed portion of the first layer in each nanopore can be about 300 to about 40,000 nm 2 The surface area of the exposed portion of the first layer in each nanopore can be about 700 to about 8,000 nm 2 The surface area of the exposed portion of the first layer in each nanopore can be about 2,000 to about 3,000 nm 2 .

[0427] In some aspects, the exposed portion of the first layer in each nanopore is circular. In some aspects, the exposed portion of the first layer in each nanopore is elliptical. In some aspects, the exposed portion of the first layer in each nanopore is rectangular. In some aspects, the exposed portion of the first layer in each nanopore is square. In some aspects, the exposed portion of the first layer in each nanopore is hexagonal or octagonal. In some aspects, the exposed portion of the first layer in each nanopore has the shape of a regular polygon. In some aspects, the exposed portion of the first layer in each nanopore has the shape of an irregular polygon.

[0428] In some aspects where the exposed portion of the first layer in the nanopore is circular, the exposed portion of the first layer can have a diameter of about 10 nm to about 200 nm. The exposed portion of the first layer can have a diameter of about 20 nm to about 200 n...

Claims

1. A probe comprising a target binding domain and a barcode domain; wherein the target binding domain is at least 12 nucleotides in length and the target binding domain hybridizes to a target nucleic acid; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the synthetic backbone comprises L-DNA, wherein the at least three attachment sites each have a different nucleic acid sequence; and wherein each nucleotide of the at least one nucleic acid sequence of each attachment region is L-DNA; wherein the at least one nucleic acid sequence of each attachment site comprises a 3'-terminal guanine nucleotide.

2. The probe according to claim 1, wherein the probe comprises a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain.

3. The probe according to claim 1, wherein the synthetic backbone is a single-stranded DNA synthetic backbone having a length of from about 10 nucleotides to about 100 nucleotides.

4. The probe according to any one of claims 1-3, further comprising a first complementary primary nucleic acid molecule that hybridizes to a first attachment site of the at least three attachment sites, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment site of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the cleavable linker is located between the first domain and the second domain.

5. The probe according to claim 4, wherein the cleavable linker comprises:

6. The probe according to any one of claims 1-3, wherein the number of nucleotides in the target binding domain is greater than the number of attachment sites in the barcode domain.

7. The probe according to any one of claims 1-3, wherein the barcode domain comprises at least four attachment sites.

8. A probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and wherein at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprises at least three attachment sites, each attachment site comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the synthetic backbone comprises L-DNA, wherein each attachment site of the at least three attachment sites corresponds to two nucleotides of at least six nucleotides in the target binding domain, and the at least three attachment sites each have a different nucleic acid sequence, and The nucleic acid sequence at each of the at least three attachment positions determines the positions and identities of two corresponding nucleotides of at least six nucleotides in the target nucleic acid bound by the target binding domain.

9. A method for determining the nucleotide sequence of a nucleic acid, comprising: (1) hybridizing the target binding domain of at least one first probe of any one of claims 1-8 with a first region of a target nucleic acid, the target nucleic acid optionally being immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label with a first attachment position of at least three attachment positions of the barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label with a second attachment position of at least three attachment positions of the barcode domain; (6) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label with a third attachment position of at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to at least six nucleotides of the target binding domain of at least one first probe based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label, and at least one sixth detectable label.

10. A method for determining the presence of a target nucleic acid, comprising: (1) hybridizing the target binding domain of at least one first probe of any one of claims 1-8 with a first region of a target nucleic acid; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label with a first attachment position of at least three attachment positions of the barcode domain; (3) identifying at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label with a second attachment position of at least three attachment positions of the barcode domain; (6) Identify at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) Remove at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (8) Hybridize a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of at least three attachment positions of the barcode domain; (9) Identify at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) Determine the presence of the target nucleic acid based on the identities of at least one first detectable label, at least one second detectable label, at least one third detectable label, at least one fourth detectable label, at least one fifth detectable label, and at least one sixth detectable label.

Images