CX3CR1 promoter region methylation level as depression detection index and detection method thereof

Abstract

The invention provides a CX3CR1 promoter region methylation level as a depression detection index and a detection method of the CX3CR1 promoter region methylation level. The CX3CR1 promoter region methylation level comprises a primer pair I or a primer pair II for detecting CX3CR1 gene methylation, the invention also provides a kit containing the primer group and other products. Compared with the prior art, the application has the following advantages: the CX3CR1 promoter region methylation level provided by the invention is used as a depression detection index and a detection method thereof, a brand new target CX3CR1 is adopted, and a primer combination and a kit for depression methylation detection are developed, particularly based on free cfDNA in human plasma, the methylation level of the CX3CR1 promoter region is used for detecting depression, and the methylation level of the CX3CR1 promoter region is used for detecting depression. After being extracted, the gene is modified by hydrosulphite, and then the methylation degree of the gene is detected through sequencing or a probe, so that the depression is diagnosed; compared with traditional subjective diagnosis, the method has a series of advantages of high efficiency, high accuracy, noninvasive property, standardization, convenience, low price and the like.

Description

Technical Field

[0001] This application relates to the field of biological detection technologies, and specifically to the CX3CR1 promoter region methylation level as a detection index for depression and its detection method. Background Art

[0002] Depression is a common mental disorder, metaphorically known as the "common cold in psychiatry", with a lifetime prevalence as high as 10% - 20%. Depression is characterized by high incidence, high recurrence, and high disability, being the leading cause of disability worldwide and a major factor contributing to the global disease burden.

[0003] For the diagnosis of depression, it is currently mainly based on the patient's current medical history, past medical history, family history, etc., and a symptomatic psychiatric examination of the patient is conducted for comprehensive judgment. The depression scale is the main reference index. The depression scale is mainly based on the patient's feedback and the doctor's professional judgment, facing many problems: for doctors, time is limited, technical levels vary, and subjectivity is strong; for patients, clinical symptoms are complex, cooperation is low, and there are many disease subtypes - resulting in inaccurate and inefficient diagnosis of depression. Therefore, finding objective clinical markers and accurately detecting them has become an important research direction in the current diagnosis and treatment fields of depression, and there is an urgent need for an objective diagnosis index for depression that "settles the matter once and for all".

[0004] Currently, there are some immunological markers that can be used to distinguish between depression patients and non - depression patients and quantify the level of immune disorders. These markers include CRP (high - sensitivity C - reactive protein), cytokine levels, whole - genome gene expression, and quantitative PCR levels of specific mRNAs, cytokine or gene expression levels stimulated by LPS in vitro, and quantitative immunocyte counting. For example, in depression patients, the expression of genes related to innate immunity is up - regulated, while the expression of genes related to adaptive immunity is down - regulated. Healthy controls and patients who have remitted during treatment can be distinguished by mRNA transcripts, and these characteristics reflect inflammasome activation and glucocorticoid resistance. In addition, the expression characteristics of six mRNAs (P2RX7, IL1B, IL6, TNF, CXCL12, and GR) can distinguish antidepressant - resistant patients from those who respond to antidepressants: in antidepressant - resistant depression patients, the levels of IL1B, IL6, TNF, and FKBP5 mRNA are increased, and the level of GR mRNA is decreased. In addition to changes at the protein and gene levels, through immunocyte counting, it is found that depression patients have more white blood cells, more neutrophils, fewer T lymphocytes or B lymphocytes, an increased neutrophil / lymphocyte ratio, and an increased CD4 + / CD8 + T - cell ratio. Although these indicators have been detected in depression patients, none of them can be used for the precise diagnosis of depression.

[0005] Epigenetic modifications such as DNA methylation are related to the occurrence of depression. Current studies have shown that some genes such as BICD2 can be used as DNA methylation biomarkers for major depressive disorder. In previous studies, the inventors screened genes with abnormal methylation levels in depression patients, clustered the abnormally expressed genes, and found that some abnormally expressed genes were related to the nervous system or directly related to synapses, thus forming a candidate gene pool for depression research. The gene CX3CR1 was selected from it for further research. The CX3CL1 / CR1 axis mediates the occurrence of depression. CL1 is a type of chemokine that exists in neuronal cells and binds to the only receptor CX3CR1, and CX3CR1 exists in microglial cells. In the normal CNS, neurons communicate with microglial cells through CX3CL1 and its receptor CX3CR1, mediating the occurrence of depression.

[0006] Circulating free DNA (cfDNA) is a DNA library composed of DNA from different sources such as genomes, mitochondria, and bacteria. The fragment length is generally 50 - 300 bp, and it usually exists widely in the blood of healthy people at low concentrations, including urine, saliva, cerebrospinal fluid, pleural and peritoneal effusions, serum, plasma, etc. As a dynamic biomarker, it may be caused by reasons such as apoptosis, necrosis, or active secretion of cells. However, in cases of diseases or other conditions in the body, including a series of reasons such as malignant tumors, trauma, organ transplantation, pregnancy, etc., cfDNA will be released into the blood circulation in large amounts, and its content will increase significantly. Most cfDNA research is based on DNA derived from cancer cells. Circulating tumor DNA (ctDNA) is a nuclear biomarker used to detect or monitor the development of cancer over time. These cancer biomarkers are released by tumors or circulating cancer cells during apoptosis or necrosis. As the tumor grows and matures, the concentration of fragmented ctDNA in the circulation increases. Based on the clinical diagnosis and screening of a large number of different types of cfDNA, it has been applied in many aspects such as liquid biopsy, early cancer screening, non-invasive prenatal screening, infectious diseases, etc. Liquid biopsy based on cfDNA is applied to the non-invasive dynamic assessment of cancer patients in the early and late stages. DNA methylation analysis from cfDNA samples has great prospects because the intrinsic characteristics of DNA are more general and more cell-specific than genomics, and established cfDNA analysis methods already exist. Moreover, cfDNA has its unique advantages in molecular diagnosis. Compared with RNA, cfDNA has higher stability. In addition to having the advantages of simplicity and non-invasiveness, it also has higher sensitivity compared with traditional markers. However, in the diagnosis of depression, cfDNA still has great research and development space and can be used as an important molecular biomarker for diagnosing depression. Summary of the Invention

[0007] In view of the above-mentioned technical limitations, the present application proposes using the methylation level of the CX3CR1 promoter region as a detection index for depression and its detection method; taking the detection of cfDNA in human plasma as a new research entry point, it opens up a new way for the diagnosis of depression, making up for the deficiencies of the traditional psychological scale test in terms of inaccurate diagnosis and poor patient cooperation.

[0008] To achieve the above object, the present application adopts the following technical solutions:

[0009] The inventive point of the present application is to provide a methylation detection primer set for using the methylation level of the CX3CR1 promoter region as a detection index for depression, and the primer set includes primer pair one or primer pair two for detecting the methylation of the CX3CR1 gene;

[0010] Primer pair one includes:

[0011] CX3CR1 forward primer 1 with the sequence shown in SEQ ID No.1,

[0012] CX3CR1 reverse primer 1 with the sequence shown in SEQ ID No.2;

[0013] Primer pair two includes:

[0014] CX3CR1 forward primer 2 with the sequence shown in SEQ ID No.3,

[0015] CX3CR1 reverse primer 2 with the sequence shown in SEQ ID No.4.

[0016] SEQ ID No.1:

[0017] GAGTGGATTTTAGGAGAGGTATTAAG;

[0018] SEQ ID No.2:

[0019] CTTCATTAAATAATCTATAACCCC;

[0020] SEQ ID No.3:

[0021] TTGTAGTTTTTAGTTTTGTTTTGGG;

[0022] SEQ ID No.4:

[0023] AAACCCCTCTAACCCCTTACTAC.

[0024] Optionally, the above methylation detection primer set using the methylation level of the CX3CR1 promoter region as a detection index for depression. Primer pair 1 is used to detect the 1915bp - 2314bp fragment of the full-length CDS region of the CX3CR1 gene promoter region, and the sequence of this fragment is as shown in SEQ ID No.5; Primer pair 2 is used to detect the 2131bp - 2287bp fragment of the full-length CDS region of the CX3CR1 gene promoter region, and the sequence of this fragment is as shown in SEQ ID No.6.

[0025] SEQ ID No.5:

[0026] GAGTGGACCCCAGGAGAGGTATCAAGGGGTGGTGTGGGGTGGGGAGGGGCCAGTGTCAGAAAGTGGATGGGGAG CG GCCTGACTCTGCTTTTGTCCTGTGGCCTTCTGGCCAAAGGCAGGGAAAGGTGGCCAAACACTGAGACCAAGAACAAAGAAAGAAAACTGCTGGTGGACTTCTTCCACCATGAGCAGGCCACCAAGCC CG CAGCACTGCACTGCAGCCCCCAGCTCTGTCCTGGGGTTGGGGGAGGTGAGGAGGGGCAAGGTGGGGAGCACACAGAGCACC CG CTGTCCT C G GAACACCACAG CG ACTAGAGGTAAGGGAGCAC CG GATGTGGCTGGGATGTGGGCAGCAAGGGGCCAGAGGGGCCTTGAAGGGGTCACAGACCATTTAATGAAG。

[0027] SEQ ID No.6:

[0028] TGCAGCCCCCAGCTCTGTCCTGGGGTTGGGGGAGGTGAGGAGGGGCAAGGTGGGGAGCACACAGAGCACC CG CTGTCCT CG GAACACCACAG CG ACTAGAGGTAAGGGAGCAC CG GATGTGGCTGGGATGTGGGCAGCAAGGGGCCAGAGGGGCCTT。

[0029] Optionally, for the above methylation detection primer set using the methylation level of the CX3CR1 promoter region as an index for detecting depression, the 1915bp - 2314bp fragment of the full - length CDS region of the CX3CR1 gene promoter region contains 6 CpG sites for methylation detection (annotated in the aforementioned SEQ ID No.5 sequence); the 2131bp - 2287bp fragment of the full - length CDS region of the CX3CR1 gene promoter region contains 4 CpG sites for methylation detection (annotated in the aforementioned SEQ ID No.6 sequence).

[0030] CpG sites (or CG sites) refer to a region of DNA where the base sequence appears as cytosine followed by guanine; "CpG" is an abbreviation for "—C—phosphate—G—", indicating that a phosphodiester bond links cytosine and guanine, with C at the 5' end and G at the 3' end; the cytosine in a CpG site can be methylated to 5 - methylcytosine; in mammals, methylation of CpG sites within a gene can alter the expression of this gene, and the study of this expression regulation is an important part of epigenetics.

[0031] Optionally, for the above methylation detection primer set using the methylation level of the CX3CR1 promoter region as an index for detecting depression, the full - length CDS region of the CX3CR1 gene promoter region is as shown in SEQ ID No.7.

[0032] SEQ ID No.7:

[0033]

[0034] The second inventive point of the present application is to provide a methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, comprising the following steps:

[0035] S1. cfDNA extraction;

[0036] S2. Bisulfite modification;

[0037] S3. Bisulfite sequencing PCR, i.e., BSP, the PCR corresponding fragment is the sequence shown in SEQ ID No. 5, and the PCR primer pair is the aforementioned primer set;

[0038] S4. Agarose gel electrophoresis detection and purification;

[0039] S5. Ligation product transformation and sequencing.

[0040] Optionally, in the above methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, in step S2, the sulfite conversion in the bisulfite modification adopts a PCR method; the PCR reaction system is: 100 pg - 2 μg of Input DNA, 130 μl of CT Conversion Mix, and ddH2O to 150 μl; the PCR reaction conditions are: 98°C for 10 min, 64°C for 40 min, 98°C for 5 min, 64°C for 40 min, 98°C for 5 min, 64°C for 40 min, and termination at 4°C.

[0041] Optionally, in the above methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, in step S3, the reaction system of BSP PCR is: 25 μl of bisulfite conversion reagent, 2 μl of forward primer, 2 μl of reverse primer, 9 μl of DNA, and 12 μl of ddH2O; the BSP PCR reaction conditions are: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 51.7°C for 30 s, extension at 72°C for 1 min, and the denaturation to extension steps are cycled 35 times, and repair extension at 72°C for 5 min.

[0042] The third inventive point of the present application is to provide a methylation ARMS + Taqman probe detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, comprising the following steps:

[0043] S1. cfDNA extraction;

[0044] S2. Bisulfite modification;

[0045] S3. Perform qPCR detection using a special reagent for bisulfite-converted methylation multiplex qPCR.

[0046] The special reagent is 2x Biosmart MethyLlight Qpcr Mix (Vazyme catalog EM701).

[0047] ARMS-PCR: Amplification Refractory Mutation System PCR (ARMS-PCR), also known as Allele-Specific PCR (AS-PCR).

[0048] The ARMS-PCR technique is based on allele-specific extension reactions. Only when the base at the 3'-end of a certain allele-specific primer is complementary to the base at the mutation site can the extension reaction occur. The upstream and downstream primers used for conventional PCR amplification of DNA fully match the target sequence, while allele-specific PCR uses two upstream primers specific to the allele. The two primers differ in the nucleotide at the 3'-end. One is specific to the wild-type allele, and the other is specific to the mutant allele. Under the action of Taq DNA polymerase, the upstream primer that does not fully match the template will not anneal and no PCR product will be generated, while the primer system that matches the template can amplify the product. Whether the amplification product is present can be easily distinguished by gel electrophoresis or qPCR, thereby determining the SNP genotype. Currently, the mainstream in the market is the ARMS+qPCR technique, which uses TaqMan probes for detection. (For example, in the detection of the EGFR gene for tumor-targeted drug use, more than 90% of the detection kits approved by the CFDA use the ARMS detection method).

[0049] Optionally, in the above methylation ARMS+Taqman probe detection method using the methylation level of the CX3CR1 promoter region as an index for depression detection, in step S3, the reaction system for qPCR is as follows: a total of 20 μl, 10 μl of methylation qPCR reagent, 0.2 μl of 20 μM universal upstream primer, 0.2 μl of 20 μM universal downstream primer, 0.2 μl of 20 μM probe, 1 μl of DNA, and 8.6 μl of ddH2O; the reaction conditions for qPCR are 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and the second to third steps are cycled 45 times.

[0050] The fourth inventive point of this application is to provide the above-mentioned methylation detection primer set for using the methylation level of the CX3CR1 promoter region as an index for depression detection in the preparation of a depression detection kit or a biochip.

[0051] The present invention studies the pathogenesis of depression from a brand-new perspective of intergenerational inheritance. Based on this, a new molecular diagnostic index for depression is discovered. By using the BSP method for methylation diagnosis and the ARMS+Taqman probe method for methylation diagnosis, an effective molecular diagnostic index and detection process for depression are established.

[0052] Compared with the prior art, the present application has the following advantages:

[0053] The methylation level of the CX3CR1 promoter region provided by the present invention as a detection index for depression and its detection method adopt a primer combination and a kit for methylation detection of depression. Based on the cell-free cfDNA in human plasma, after extraction, it is subjected to bisulfite modification, and then its methylation degree is detected by sequencing or probes, so as to diagnose depression. Compared with traditional subjective diagnosis, it has a series of advantages such as high efficiency, high accuracy, non-invasiveness, standardization, convenience, and low price.

[0054] Specifically:

[0055] 1) High efficiency: The plasma cfDNA extraction reagent of the present technology has a higher extraction efficiency for a variety of body fluids, especially plasma and serum, compared with other reagents. And in the detection of cfDNA, only a relatively low content of cfDNA is required for a series of subsequent detection operations, overcoming the problems of difficult cfDNA extraction and low extraction content, and improving the detection efficiency;

[0056] 2) High accuracy: The "depression diagnosis kit based on plasma cfDNA" has high accuracy for depression in the mild, moderate, and severe stages. Compared with various subjective psychological scales, it can better quantify the presence or absence of depression, excluding the influence brought by concealment and dishonesty of patients during the completion of each depression scale, and is more objective and accurate; compared with various other biochemical or molecular indicators, it is less affected by other diseases or the normal change state of the body, and is more specific and precise;

[0057] 3) Non-invasive: The sample for cfDNA extraction is plasma. Only about 0.6 ml of plasma sample is required, and it can be detected simultaneously with various other biochemical indicators that require blood collection. It is non-invasive and more acceptable to patients;

[0058] 4) Standard and convenient: The operation process of the kit is convenient and standard. The detection institution can operate hundreds of samples at the same time, and the methylation detection steps such as bisulfite modification, BSP pcr, ligation transformation, and sequencing in its operation process have been developed and matured. For patients, there is no need to perform various complex examinations, which greatly saves time and improves the cooperation degree of patients;

[0059] 5) Low cost: The "Depression Diagnosis Kit Based on Plasma cfDNA" is a high-tech product. Its cost mainly lies in the early product R & D process, which has been basically completed at present. Specifically, the main components of the kit are extraction and purification columns, basic buffer eluents, conversion reagents, etc. Its low-cost feature makes it easier to be included in the medical insurance scope and widely purchased by medical institutions, which helps the large-scale promotion and clinical application of the kit.

[0060] 6) Green and environmentally friendly: The main components of this product are stable nanomaterials. The waste after the experiment (such as the buffer discarded during the extraction of cfDNA through the column) will not cause any impact on the environment even without special treatment. Brief Description of the Drawings

[0061] Figure 1 It shows the statistical results of the demethylation degree of the CpG1 site in the sample methylation detection of an embodiment of the present invention.

[0062] Figure 2 It shows the statistical results of the demethylation degree of the CpG2 site in the sample methylation detection of an embodiment of the present invention.

[0063] Figure 3 It shows the statistical results of the demethylation degree of the CpG3 site in the sample methylation detection of an embodiment of the present invention.

[0064] Figure 4 It shows the statistical results of the demethylation degree of the CpG4 site in the sample methylation detection of an embodiment of the present invention.

[0065] Figure 5 It shows the statistical results of the demethylation degree of the CpG5 site in the sample methylation detection of an embodiment of the present invention.

[0066] Figure 6 It shows the statistical results of the demethylation degree of the CpG6 site in the sample methylation detection of an embodiment of the present invention. Detailed Description of the Invention

[0067] To make the objectives, technical solutions and advantages of the present application clearer and more understandable, the present application will be further described in detail below. However, it should be understood that the description herein is only used to explain the present application and not to limit the scope of the present application.

[0068] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs. The terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. The reagents and instruments used herein are all commercially available, and the characterization means involved can be referred to the relevant descriptions in the prior art and will not be elaborated herein.

[0069] To further understand this application, the following provides a more detailed description of this application in conjunction with the best embodiments.

[0070] Example 1

[0071] A methylation detection primer set for using the methylation level of the CX3CR1 promoter region as an index for detecting depression, comprising primer pair 1 or primer pair 2 for detecting the methylation of the CX3CR1 gene;

[0072] Primer pair 1 includes:

[0073] CX3CR1 forward primer 1 with the sequence shown in SEQ ID No.1,

[0074] CX3CR1 reverse primer 1 with the sequence shown in SEQ ID No.2;

[0075] Primer pair 2 includes:

[0076] CX3CR1 forward primer 2 with the sequence shown in SEQ ID No.3,

[0077] CX3CR1 reverse primer 2 with the sequence shown in SEQ ID No.4.

[0078] SEQ ID No.1:

[0079] GAGTGGATTTTAGGAGAGGTATTAAG;

[0080] SEQ ID No.2:

[0081] CTTCATTAAATAATCTATAACCCC;

[0082] SEQ ID No.3:

[0083] TTGTAGTTTTTAGTTTTGTTTTGGG;

[0084] SEQ ID No.4:

[0085] AAACCCCTCTAACCCCTTACTAC.

[0086] Primer pair 1 is used to detect the 1915bp - 2314bp fragment of the full - length sequence in the CDS region of the CX3CR1 gene promoter region, and the sequence of this fragment is shown as SEQ ID No.5;

[0087] Primer pair 2 is used to detect the 2131bp - 2287bp fragment of the full - length sequence in the CDS region of the CX3CR1 gene promoter region, and the sequence of this fragment is shown as SEQ ID No.6.

[0088] SEQ ID No.5:

[0089] GAGTGGACCCCAGGAGAGGTATCAAGGGGTGGTGTGGGGTGGGGAGGGGCCAGTGTCAGAAAGTGGATGGGGAG CG GCCTGACTCTGCTTTTGTCCTGTGGCCTTCTGGCCAAAGGCAGGGAAAGGTGGCCAAACACTGAGACCAAGAACAAAGAAAGAAAACTGCTGGTGGACTTCTTCCACCATGAGCAGGCCACCAAGCC CG CAGCACTGCACTGCAGCCCCCAGCTCTGTCCTGGGGTTGGGGGAGGTGAGGAGGGGCAAGGTGGGGAGCACACAGAGCACC CG CTGTCCT C G GAACACCACAG CG ACTAGAGGTAAGGGAGCAC CG GATGTGGCTGGGATGTGGGCAGCAAGGGGCCAGAGGGGCCTTGAAGGGGTCACAGACCATTTAATGAAG.

[0090] SEQ ID No.6:

[0091] TGCAGCCCCCAGCTCTGTCCTGGGGTTGGGGGAGGTGAGGAGGGGCAAGGTGGGGAGCACACAGAGCACC CG CTGTCCT CG GAACACCACAG CG ACTAGAGGTAAGGGAGCAC CG GATGTGGCTGGGATGTGGGCAGCAAGGGGCCAGAGGGGCCTT.

[0092] The 1915bp-2314bp fragment of the full-length CDS region in the promoter region of the CX3CR1 gene contains 6 CpG sites for methylation detection (annotated in the aforementioned SEQ ID No.5 sequence);

[0093] The 2131bp-2287bp fragment of the full-length CDS region in the promoter region of the CX3CR1 gene contains 4 CpG sites for methylation detection (annotated in the aforementioned SEQ ID No.6 sequence).

[0094] CpG sites (or CG sites) refer to a region of DNA where the base sequence appears as cytosine followed by guanine; "CpG" is an abbreviation for "—C—phosphate—G—", indicating that a phosphodiester bond links cytosine and guanine, with C at the 5' end and G at the 3' end; the cytosine in a CpG site can be methylated to 5-methylcytosine; in mammals, the methylation of CpG sites within a gene can alter the expression of this gene, and the study of this expression regulation is an important part of epigenetics.

[0095] The full-length CDS region in the promoter region of the CX3CR1 gene is as shown in SEQ ID No.7.

[0096] SEQ ID No.7:

[0097]

[0098] The present application also provides a methylation BSP detection method using the methylation level of the CX3CR1 promoter region as an indicator for detecting depression, comprising the following steps:

[0099] S1. cfDNA extraction;

[0100] S2. Bisulfite modification;

[0101] S3. Bisulfite sequencing PCR, i.e., BSP, the PCR corresponding fragment is the sequence shown in SEQ ID No. 5, and the PCR primer pair is the aforementioned primer set;

[0102] S4. Agarose gel electrophoresis detection and purification;

[0103] S5. Transformation of the ligation product and sequencing.

[0104] In step S2 of the methylation BSP detection method using the methylation level of the CX3CR1 promoter region as an indicator for detecting depression, the sulfite conversion in the bisulfite modification adopts a PCR method; the PCR reaction system is: 100 pg - 2 μg of Input DNA, 130 μl of CT Conversion Mix, and ddH2O to 150 μl; the PCR reaction conditions are: 98°C for 10 min, 64°C for 40 min, 98°C for 5 min, 64°C for 40 min, 98°C for 5 min, 64°C for 40 min, and termination at 4°C.

[0105] In step S3 of the methylation BSP detection method using the methylation level of the CX3CR1 promoter region as an indicator for detecting depression, the reaction system of BSP PCR is: 25 μl of bisulfite conversion reagent, 2 μl of forward primer, 2 μl of reverse primer, 9 μl of DNA, and 12 μl of ddH2O; the BSP PCR reaction conditions are: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 51.7°C for 30 s, extension at 72°C for 1 min, the denaturation to extension steps are cycled 35 times, and repair extension at 72°C for 5 min.

[0106] The present application also provides a methylation ARMS + Taqman probe detection method using the methylation level of the CX3CR1 promoter region as an indicator for detecting depression, comprising the following steps:

[0107] S1. cfDNA extraction;

[0108] S2. Bisulfite modification;

[0109] S3. qPCR detection using a methylation multiplex qPCR special reagent for bisulfite conversion.

[0110] The special reagent is 2x Biosmart MethyLlight Qpcr Mix (Vazyme catalog EM701).

[0111] In step S3 of the methylation ARMS + Taqman probe detection method using the methylation level of the CX3CR1 promoter region as an index for detecting depression, the reaction system for qPCR is as follows: the total volume is 20 μl, 10 μl of methylation qPCR reagent, 0.2 μl of 20 μM universal upstream primer, 0.2 μl of 20 μM universal downstream primer, 0.2 μl of 20 μM probe, 1 μl of DNA, and 8.6 μl of ddH2O; the reaction conditions for qPCR are 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and the 2nd - 3rd steps are cycled 45 times.

[0112] The present application also provides the use of the above-mentioned methylation detection primer set using the methylation level of the CX3CR1 promoter region as an index for detecting depression in the preparation of a depression detection kit or a biochip.

[0113] Example 2

[0114] Process / method for methylation detection by BSP method:

[0115] I. Extraction of cfDNA:

[0116] 1. Kit: Quick-cfDNASerum&Plasma kit (Catalog No.D4076).

[0117] 2. Reagent preparation:

[0118] 1) Add 6.5 mL of Proteinase k Storage Buffer to the Proteinuse k powder and store at -20°C;

[0119] 2) Add 48 mL of absolute ethanol to 12 mL of S&P DNAWash Buffer.

[0120] 3. Process:

[0121] 1) Take 600 μl of serum, add 150 ml of 5×Digestion Buffer and mix well.

[0122] 2) Add 60 μl of Proteinase K and mix well.

[0123] 3) Heat in a metal bath at 55°C for 30 min.

[0124] 4) Add twice the volume of S&P Binding Buffer (1620 ml) and mix well.

[0125] 5) Place the column into the collection tube, add 700 μl of the mixture, centrifuge at 1000 g for 2 min, discard the liquid in the collection tube, and repeat multiple times until all the mixture has been centrifuged (preheat the DNA Elution Buffer to 60 - 70 °C at this time).

[0126] 6) Add 400 μl of S&P Prep Buffer, centrifuge at 13400 g for 30 s, and discard the liquid in the collection tube.

[0127] 7) Add 700 μl of S&P Wash Buffer, centrifuge at 13400 g for 30 s, and discard the liquid in the collection tube.

[0128] 8) Add 400 μl of S&P Wash Buffer, centrifuge at 16000 g for 1 min, and discard the liquid in the collection tube.

[0129] 9) After standing for a few minutes for the ethanol to evaporate, place the collection column into an empty 1.5 ml tube, add 30 μl of preheated DNA Elution Buffer to the center of the column, let it stand at room temperature for 3 min, and centrifuge at 16000 g for 30 s.

[0130] 10) Add the eluted DNA to the center of the column again, let it stand at room temperature for 3 min, and centrifuge at 16000 g for 30 s.

[0131] II. Bisulfite Modification:

[0132] The most commonly used method for detecting DNA methylation is the bisulfite conversion method. The principle of this technique is to treat DNA with bisulfite to convert unmethylated cytosine into uracil, while methylated cytosine remains unchanged during the conversion process. After conversion, the DNA methylation status can be determined by PCR amplification or DNA sequencing.

[0133] 1. Kit: DNA Methylation Bisμlfite Kit (Vazyme Catalog EM101).

[0134] 2. Reagent Preparation:

[0135] 1) For E-Wash Buffer, add the specified volume of anhydrous ethanol before the first use (80 ml of anhydrous ethanol needs to be added to EM101 - 01; 160 ml of anhydrous ethanol needs to be added to each bottle of EM101 - 02). After adding ethanol, tighten the bottle cap strictly to prevent ethanol from evaporating.

[0136] 2) Prepare CT Conversion Mix:

[0137] Add 1 ml of ddH2O, 200 μl of CT Conversion Diluent, and 100 μl of CT Conversion Buffer to a tube of CT Conversion Powder and mix. Vortex at room temperature for about 1 min until dissolved. Each tube of the mixed Mix can be used for about 10 reactions. Prepare it immediately before use. It can be stored at room temperature (15 - 25 °C) for 24 h or frozen (-30 - -15 °C) for 1 month. When using, it needs to be equilibrated to room temperature and vortexed thoroughly.

[0138] 3. Bisulfite conversion:

[0139] 1) Equilibrate the CT Conversion Mix to room temperature and prepare the following reaction in a 200 μl sterile PCR tube as shown in Table 1.

[0140] Table 1

[0141] Component Volume Input DNA X μl (100 pg - 2 μg) CT Conversion Mix 130 μl ddH2O To 150 μl

[0142] 2) Invert the tube up and down or pipette to mix well, and briefly centrifuge to collect the reaction solution at the bottom of the tube.

[0143] 3) Place the PCR tube in a PCR instrument and perform the following reaction as shown in Table 2.

[0144] Table 2

[0145] Temperature Time Hot lid 105°C On 98℃ 10 min 64℃ 40 min 98℃ 5 min 64℃ 40 min 98℃ 5 min 64℃ 40 min 4℃ Hold (<24 h

[0146] 4. Purification of the conversion product:

[0147] 1) Place the EpiArt DNA Columns adsorption column in the Collection Tubes collection tube.

[0148] 2) Add 600 μl of E-Binding Buffer to the adsorption column, and then add the converted reaction product to the adsorption column. Gently invert the tube up and down 8 - 10 times to mix the reaction solution and E-Binding Buffer thoroughly.

[0149] 3) Centrifuge at 12,000 rpm (13,400 × g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0150] 4) Add 500 μl of E-Wash Buffer (ethanol already added) to the adsorption column and centrifuge at 12,000 rpm (13,400×g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0151] 5) Add 500 μl of E-Desμlphonation Buffer to the adsorption column and let it react at room temperature (15 - 25°C) for 15 min. Centrifuge at 12,000 rpm (13,400×g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0152] 6) Add 500 μl of E-Wash Buffer (ethanol already added) to the adsorption column and centrifuge at 12,000 rpm (13,400×g) for 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0153] 7) Repeat step 6.

[0154] 8) Centrifuge the empty column at 12,000 rpm (13,400×g) for 2 min.

[0155] 9) Transfer the adsorption column to a new 1.5 ml centrifuge tube, open the lid and let it dry completely for 2 min. Add 10 - 20 μl of E-Elution Buffer to the center of the adsorption column membrane. Let it stand at room temperature for 1 - 2 min and centrifuge at 12,000 rpm (13,400×g) for 2 min to collect the DNA filtrate.

[0156] 10) Discard the adsorption column and store the DNA at -20°C. For long-term storage, place it at -70°C.

[0157] III. BSP pcr:

[0158] 1. Design primers: Website MethPremier 2.0, general parameters:

[0159] 1) Primer length is 18 - 30 bp;

[0160] 2) Tm value is 55 - 65 degrees, and the annealing temperature should be around 60 degrees;

[0161] 3) GC content is 40 - 70%;

[0162] 4) Pay special attention to avoid the existence of primer dimers and non-specific amplification;

[0163] 5) Avoid four consecutive bases, especially G and C. It is better that there are no more than 3 G or C within the last 5 bases at the 3' end.

[0164] Finally, the primer sequences are screened out:

[0165] BSP - human - 2 - F (SEQ ID No.1): GAGTGGATTTTAGGAGAGGTATTAAG;

[0166] BSP - human - 2 - R (SEQ ID No.2): CTTCATTAAATAATCTATAACCCC.

[0167] The fragment corresponding to PCR (SEQ ID No.5):

[0168] GAGTGGACCCCAGGAGAGGTATCAAGGGGTGGTGTGGGGTGGGGAGGGGCCAGTGTCAGAAAGTGGATGGGGAGCGGCCTGACTCTGCTTTTGTCCTGTGGCCTTCTGGCCAAAGGCAGGGAAAGGTGGCCAAACACTGAGACCAAGAACAAAGAAAGAAAACTGCTGGTGGACTTCTTCCACCATGAGCAGGCCACCAAGCCCGCAGCACTGCACTGCAGCCCCCAGCTCTGTCCTGGGGTTGGGGGAGGTGAGGAGGGGCAAGGTGGGGAGCACACAGAGCACCCGCTGTCCTCGGAACACCACAGCGACTAGAGGTAAGGGAGCACCGGATGTGGCTGGGATGTGGGCAGCAAGGGGCCAGAGGGGCCTTGAAGGGGTCACAGACCATTTAATGAAG.

[0169] 2. PCR reaction system: 50 μl, as shown in Table 3.

[0170] Table 3

[0171]

[0172] 3. PCR reaction conditions, as shown in Table 4.

[0173] Table 4

[0174]

[0175] IV. Detection by agarose gel electrophoresis and separation and purification:

[0176] 1. Kit: Gel DNA Extraction Mini Kit (Vazyme catalog DC301).

[0177] 2. Use the PCR product for 1% agarose gel electrophoresis. Electrophoresis parameters: 130 V, 100 mA, observe by electrophoresis for 20 - 30 minutes. The fragment size is about 400 bp (DNA maker: Enzyme 100DL DNA Maker).

[0178] 1) Take 40 mL of 1×TAE in a beaker, weigh 0.4 g of agarose into the beaker, mix well and shake.

[0179] 2) Place it in the microwave for 1 minute. When it is slightly boiling, take out the beaker and shake well (using clips), then put it back into the microwave. Take it out after boiling (about 20 s), then put it back in, for about 10 s, and take it out after boiling.

[0180] 3) Take out the beaker, let it clarify, cool it down in cold water, and add Gelred at a ratio of 1 / 10000 (40 mL / 10000 = 4 μL). Pour the gel solution along the edge into the mold, avoid generating bubbles, and insert the comb teeth.

[0181] 4) Let the gel solidify for about 30 minutes.

[0182] 5) Place the gel in a 1×TAE gel basin and soak it, then add the pcr reaction solution.

[0183] 6) For electrophoresis, at 120 V for 20 minutes until the band runs to about 2 / 3, running from the negative electrode to the positive electrode.

[0184] 7) Observe under ultraviolet (UV) irradiation.

[0185] 3. Gel extraction and recovery:

[0186] 1) After DNA electrophoresis, quickly cut the gel containing the target DNA fragment under ultraviolet light. It is recommended to suck dry the liquid on the gel surface with a tissue and chop it up, and try to remove the excess gel. Weigh the gel (removing the weight of the empty tube). 100 mg of gel is equivalent to 100 μl in volume, which is regarded as one gel volume.

[0187] 2) Add an equal volume of Buffer GDP. Incubate in a water bath at 50 - 55 °C for 7 - 10 minutes, and adjust the time appropriately according to the gel size to ensure that the gel block is completely dissolved. Invert and mix 2 times during the water bath to accelerate the solubilization. (Adding 1 - 3 times the volume of Buffer GDP does not affect the DNA recovery rate. When recovering DNA fragments less than or equal to 100 bp, add 3 times the volume of Buffer GDP. After solubilizing in the water bath, then add 1 gel volume of isopropanol, mix well and then proceed to the third step.)

[0188] 3) Briefly centrifuge to collect the droplets on the tube wall. Place the FastPure DNAMini Columns-G adsorption column in a 2 ml Collection Tube, transfer ≤ 700 μl of the sol solution to the adsorption column, and centrifuge at 12,000 rpm (13,800 × g) for 30 - 60 sec. If the volume of the sol is > 700 μl, place the adsorption column back into the collection tube, transfer the remaining sol solution to the adsorption column, and centrifuge at 12,000 rpm (13,800 × g) for 30 - 60 sec.

[0189] 4) Discard the filtrate and place the adsorption column in the collection tube. Add 300 μl of Buffer GDP to the adsorption column. Let it stand for 1 min. Centrifuge at 12,000 rpm (13,800 × g) for 30 - 60 sec.

[0190] 5) Discard the filtrate and place the adsorption column in the collection tube. Add 700 μl of Buffer GW (anhydrous ethanol has been added) to the adsorption column. Centrifuge at 12,000 rpm (13,800 × g) for 30 - 60 sec. (Please add Buffer GW along the four sides of the adsorption column wall, or invert and mix 2 - 3 times after adding Buffer GW, which helps to completely wash the salts adhering to the tube wall.)

[0191] 6) Repeat step 5.

[0192] 7) Discard the filtrate and place the adsorption column back into the collection tube. Centrifuge at 12,000 rpm (13,800 × g) for 2 min.

[0193] 8) Place the adsorption column in a 1.5 ml sterilized centrifuge tube, add 20 - 30 μl of Elution Buffer to the center of the adsorption column, and let it stand for 2 min. Centrifuge at 12,000 rpm (13,800 × g) for 1 min. Discard the adsorption column and store the DNA at -20 °C. (If the highest yield is required, it is recommended to re - add the obtained solution to the centrifugal adsorption column and repeat step 8 for secondary elution. When recovering fragments larger than 3 kb, it is recommended to pre - heat the Elution Buffer to 55 °C to improve the recovery efficiency.)

[0194] V. Transformation and sequencing of the ligation product:

[0195] 1. Kit: Μltra - Universal TOPO Cloning Kit (Vazyme catalog C603).

[0196] 2. Ligation reaction:

[0197] 1) Prepare the reaction system: 10 μl, as shown in Table 5.

[0198] 5×Μltra-Universal TOPO Cloning Mix 2 μl DNA 8 μl

[0199] 2) Flick to mix well and centrifuge briefly to collect at the bottom of the tube.

[0200] 3) React at 37 °C for 5 min. After the reaction is completed, place the centrifuge tube on ice.

[0201] 3. Transformation:

[0202] Solid medium (100 mL) = LB (Yeast Extract: 0.5 g, Tryptone: 1 g, NaCl: 1 g) + agar: 1 g (1%-2% agar powder). Prepare, sterilize, and when it is no longer hot to the touch, add 1 / 1000 of ampicillin (AMP), i.e., 100 μL, and pour the plate.

[0203] 1) Take out the competent cells DH5α from -80 °C and quickly place them on ice to thaw.

[0204] 2) Add the DNA to be transformed into 100 μl of competent cells, flick the tube wall to mix well (avoid pipetting), and let it stand on ice for 30 min.

[0205] 3) After heat shock in a 42 °C water bath for 45 sec, quickly place it on ice and let it stand for 2 min. Do not shake the centrifuge tube.

[0206] 4) Add 900 μl of LB or SOC liquid medium (without antibiotics) to the centrifuge tube, mix well, and incubate at 37 °C in a shaker at 200 rpm for 1 h.

[0207] 5) Centrifuge at 5,000 rpm (2,500×g) for 3 min, discard 900 μl of the supernatant, resuspend the bacteria in the remaining medium, and evenly spread it on an LB solid medium plate containing 1 / 1000 ampicillin antibiotic.

[0208] 6) Place the plate upright in a 37 °C incubator for 10 min. After the bacterial solution is completely absorbed, invert the plate and incubate overnight (16 - 20 h).

[0209] 4. Pick a single colony into 1 ml of LB medium containing ampicillin, shake the bacteria for 12 h and then send it for sequencing (GenScript).

[0210] 5. Analyze the experimental results: Import the sequencing data into Snapgene software and perform methylation alignment of the required fragments on the SSEARCH2SEQ website (https: / / www.ebi.ac.uk / Tools / psa / ssearch2seq / ).

[0211] Example 3

[0212] ARMS + Taqman Probe Method for Methylation Detection:

[0213] ARMS-PCR: Amplification Refractory Mutation System PCR (ARMS-PCR), also known as Allele-Specific PCR (AS-PCR). The ARMS-PCR technique is based on allele-specific extension reaction. Only when the base at the 3'-end of a certain allele-specific primer is complementary to the base at the mutation site can the extension reaction proceed. The upstream and downstream primers used for conventional PCR amplification of DNA are completely matched with the target sequence, while allele PCR uses two upstream primers specific to alleles. The nucleotides at their 3'-ends are different. One is specific to the wild-type allele, and the other is specific to the mutant allele. Under the action of Taq DNA polymerase, the upstream primer that is not completely matched with the template will not anneal and no PCR product will be generated, while the primer system that is matched with the template can amplify the product. The presence or absence of the amplification product can be easily distinguished by gel electrophoresis or qPCR, thus determining the SNP genotype. Currently, the mainstream in the market is the ARMS + qPCR technique, which uses TaqMan probes for detection.

[0214] After the design of the specific primers for ARMS is completed, a pair of TaqMan probes for allele-specific fluorescence resonance energy transfer is also required. The TaqMan probes are respectively linked with two different fluorescent dyes. The 5'-end is a fluorescent group, and the 3'-end is linked with a common fluorescence quenching group. In a complete probe, the quenching group and the fluorescent group are very close in space to cause fluorescence quenching. Under normal circumstances, the fluorescence emitted by the 5'-end fluorescent group cannot be detected, and only the background fluorescence of the 3'-end quenching group can be detected. During the amplification of the target gene, both the PCR primers and the fluorescently labeled probes will bind complementarily to the target sequence during annealing (the Probe Tm is relatively high and needs to bind to the DNA Template before the Primer). When Taq enzyme encounters the probe stably bound to the template during the extension of the template strand, the 5'-3' exonuclease of Taq enzyme will degrade the specific probe bound to the template, so that the fluorescent group on the probe is physically separated, the quenching effect disappears, and fluorescence is emitted. If there is a mismatch between the fluorescent probe and the target sequence, the amount of fluorescence released will be greatly reduced. Subsequently, the genotype is determined by software analysis and processing of the fluorescence data.

[0215] I. Extraction of cfDNA:

[0216] 1. Kit: Quick-cfDNA Serum & Plasma kit (Catalog No. D4076).

[0217] 2. Procedure:

[0218] 1) Take 600 μl of serum, add 150 ml of 5× Digestion Buffer and mix well.

[0219] 2) Add 60 μl of Proteinase K and mix well.

[0220] 3) Heat in a metal bath at 55 °C for 30 min.

[0221] 4) Add twice the volume of S&P Binding Buffer (1620 ml) and mix well.

[0222] 5) Place the column into the collection tube, add 700 μl of the mixture, centrifuge at 1000 g for 2 min, discard the liquid in the collection tube, and repeat multiple times until all the mixture is centrifuged (preheat the DNA Elution Buffer to 60 - 70 °C at this time).

[0223] 6) Add 400 μl of S&P Prep Buffer, centrifuge at 13400 g for 30 s, and discard the liquid in the collection tube.

[0224] 7) Add 700 μl of S&P Wash Buffer, centrifuge at 13400 g for 30 s, and discard the liquid in the collection tube.

[0225] 8) Add 400 μl of S&P Wash Buffer, centrifuge at 16000 g for 1 min, and discard the liquid in the collection tube.

[0226] 9) After standing for a few minutes for the ethanol to evaporate, place the collection column into an empty 1.5 ml tube, add 30 μl of preheated DNA Elution Buffer to the center of the column, let it stand at room temperature for 3 min, and centrifuge at 16000 g for 30 s.

[0227] 10) Add the eluted DNA to the center of the column again, let it stand at room temperature for 3 min, and centrifuge at 16000 g for 30 s.

[0228] II. Bisulfite modification:

[0229] 1. Kit: DNA Methylation Bisulfite Kit (Vazyme Catalog EM101).

[0230] 2. Reagent preparation:

[0231] 1) Before the first use of the E-Wash Buffer, add a specified volume of absolute ethanol (80 ml of absolute ethanol is required for EM101-01; 160 ml of absolute ethanol is required for each bottle of EM101-02). After adding ethanol, tighten the bottle cap strictly to prevent ethanol from volatilizing.

[0232] 2) Prepare the CT Conversion Mix:

[0233] Add 1 ml of ddH2O, 200 μl of CT Conversion Diluent, and 100 μl of CT Conversion Buffer to a tube of CT Conversion Powder and mix by vortexing at room temperature for about 1 min until dissolved. Each tube of the mixed Mix can be used for about 10 reactions. Prepare it immediately before use and it can be stored at room temperature (15 - 25 °C) for 24 h or at freezing (-30 - -15 °C) for 1 month; balance it to room temperature and vortex it well before use.

[0234] 3. Bisulfite conversion:

[0235] 1) Balance the CT Conversion Mix to room temperature and prepare the following reaction in a 200 μl sterilized PCR tube as shown in Table 1 above.

[0236] 2) Invert the tube up and down or pipette to mix well, and briefly centrifuge to collect the reaction solution at the bottom of the tube.

[0237] 3) Place the PCR tube in a PCR instrument and perform the following reaction as shown in Table 2 above.

[0238] 4. Purification of the conversion product:

[0239] 1) Place the EpiArt DNA Column adsorption column in the Collection Tubes collection tube.

[0240] 2) Add 600 μl of E-Binding Buffer to the adsorption column, and then add the converted reaction product to the adsorption column. Gently invert the tube up and down 8 - 10 times to mix the reaction solution and E-Binding Buffer completely.

[0241] 3) Centrifuge at 12,000 rpm (13,400 × g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0242] 4) Add 500 μl of E-Wash Buffer (ethanol already added) to the adsorption column and centrifuge at 12,000 rpm (13,400×g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0243] 5) Add 500 μl of E-Desulphonation Buffer to the adsorption column and let it react statically at room temperature (15 - 25 °C) for 15 min. Centrifuge at 12,000 rpm (13,400×g) for 30 - 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0244] 6) Add 500 μl of E-Wash Buffer (ethanol already added) to the adsorption column and centrifuge at 12,000 rpm (13,400×g) for 60 sec. Discard the filtrate and place the adsorption column back into the collection tube.

[0245] 7) Repeat step 6.

[0246] 8) Centrifuge the empty column at 12,000 rpm (13,400×g) for 2 min.

[0247] 9) Transfer the adsorption column to a new 1.5 ml centrifuge tube, open the lid and let it dry thoroughly for 2 min. Add 10 - 20 μl of E-Elution Buffer to the center of the adsorption column membrane. Let it stand at room temperature for 1 - 2 min and then centrifuge at 12,000 rpm (13,400×g) for 2 min to collect the DNA filtrate.

[0248] 10) Discard the adsorption column and store the DNA at -20 °C. For long-term storage, place it at -70 °C.

[0249] III. Biosmart MethyLlight Qpcr:

[0250] 1. PCR reaction system: 20 μl, as shown in Table 6.

[0251] 2×Biosmart MethyLlight Qpcr Mix (Vazyme catalog EM701) 10 μl Universal Primer F (20 μM) 0.2 μl Universal Primer R (20 μM) 0.2 μl Probe (20 μM) 0.2 μl DNA 1 μl dd water 8.6 μl

[0252] The primer and probe sequences for the ARMS + probe method are specifically shown in Tables 7 and 8.

[0253] The universal primers are: CpG1 - 6, actin; the probes are: CpG-Probe-1 - 6, actin.

[0254] Table 7

[0255] Name Sequence Number Sequence TM Value GC% Length (bp) CpG-1-F SEQ ID No.8 cacaaaacaaaaacaaaatcaaacaa 59.3 28 25 CpG-2-F SEQ ID No.9 aaaacaaaactaaaaactacaatacaatactcca 59.5 24 34 CpG-3-F SEQ ID No.10 atcgctataatattccgaaaaccaca 59.9 35 26 CpG-4-F SEQ ID No.11 ccttacctctaatcgctataatatgcca 60.1 39 28 CpG-5-F SEQ ID No.12 catccgatactcccttacctctactca 60.9 48 27 CpG-6-F SEQ ID No.13 cccacatcccaaccacataca 59.9 52 21

[0256] Table 8

[0257]

[0258] 2. The qPCR reaction conditions are shown in Table 9 as follows:

[0259] Table 9

[0260]

[0261]

[0262] 3. Analyze the experimental results.

[0263] The technology of the present invention is to compare the methylation levels of each site between patients with depression and normal people through the extraction and methylation detection technology of plasma cfDNA, and it is found that there are significant differences in their methylation levels, which proves that it can be used as a feasible indicator for the detection of depression. The key technology of this product is to use an efficient cfDNA extraction technology to independently screen specific sites to detect the methylation level, and adopt a complete, feasible and accurate detection process to realize the screening and diagnosis of depression. The detection results are as Figure 1 - Figure 6 shown. It can be seen from the figure that the degree of demethylation of each CpG site in patients with depression is higher than that in normal people, indicating that this site can be used as one of the molecular diagnostic indicators for depression.

[0264] Among the two methods provided in this application, the BSP detection method is suitable for scientific research with better accuracy, but it has a longer cycle, which takes 2 - 3 days; while the probe method is more suitable for clinical use after improvement and can be completed in one day, which is faster.

[0265] Example 4

[0266] Small - scale verification experiment:

[0267] To verify the actual operation effect of the invention technology, the applicant obtained some plasma samples from the hospital and detected the methylation sites of the samples using the methylation detection methods (BSP method or ARMS + Taqman) provided in this application without knowing the patient information (whether the patient is diagnosed with depression is unknown).

[0268] After the detection, the detection results were compared with the diagnosis results statistically obtained by doctors through various depression scales (the existing conventional methods for the determination of depression) to verify the accuracy of the detection method of the technology in this application. The diagnostic determination method for depression in the technology of this application is: when using the BSP method to sequence the DNA fragment with the primer pairs of 4 CpG sites, or when using the ARMS + Taqman probe method to detect 4 CpG sites, if all 4 CpG sites are demethylated, it is determined as a depression sample.

[0269] The results of the comparative experiment are shown in Table 10 - Table 11 (using the BSP method and the probe method respectively).

[0270] Table 10

[0271]

[0272]

[0273] Table 11

[0274]

[0275]

[0276] Table 10 shows the comparison of the results of methylated detection (diagnosis) of depression samples by the BSP method in Example 2 with the determination of depression by the conventional depression scale. Among them, among the 27 samples, Samples 2, 6, and 24 are different from the conventional determination. Taking the conventional method as the determination standard, the methylation sites and the BSP method of this technical solution have a diagnostic accuracy rate of approximately 88.9%.

[0277] Table 11 shows the comparison of the results of methylated detection (diagnosis) of depression samples by the ARMS+Taqman probe method in Example 3 with the determination of depression by the conventional depression scale. Among them, among the 27 samples, Samples 9 and 10 are different from the conventional determination. Taking the conventional method as the determination standard, the methylation sites and the ARMS+Taqman probe method of this technical solution have a diagnostic accuracy rate of approximately 92.6%.

[0278] The above are only the preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent replacements, or improvements made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A methylation detection primer set for using the methylation level of the CX3CR1 promoter region as a detection index for depression, characterized in that, The primer set includes primer pair 1 or primer pair 2 for detecting the methylation of the CX3CR1 gene; The primer pair 1 includes: CX3CR1 forward primer 1 with the sequence shown in SEQ ID No.1, CX3CR1 reverse primer 1 with the sequence shown in SEQ ID No.2; The primer pair 2 includes: CX3CR1 forward primer 2 with the sequence shown in SEQ ID No.3, CX3CR1 reverse primer 2 with the sequence shown in SEQ ID No.

4.

2. The methylation detection primer set for using the methylation level of the CX3CR1 promoter region as an index for detecting depression according to claim 1, characterized in that, The primer pair 1 is used to detect the 1915bp - 2314bp fragment of the full-length sequence of the CDS region in the promoter region of the CX3CR1 gene, and the sequence of this fragment is shown in SEQ ID No.5; the primer pair 2 is used to detect the 2131bp - 2287bp fragment of the full-length sequence of the CDS region in the promoter region of the CX3CR1 gene, and the sequence of this fragment is shown in SEQ ID No.

6.

3. The methylation detection primer set for using the methylation level of the CX3CR1 promoter region as an indicator for detecting depression according to claim 2, wherein, The 1915bp - 2314bp fragment of the full-length sequence of the CDS region in the promoter region of the CX3CR1 gene contains 6 CpG sites for methylation detection; the 2131bp - 2287bp fragment of the full-length sequence of the CDS region in the promoter region of the CX3CR1 gene contains 4 CpG sites for methylation detection.

4. The methylation detection primer set for using the methylation level of the CX3CR1 promoter region as a detection index for depression according to any one of claims 1-3, characterized in that, The full-length sequence of the CDS region in the promoter region of the CX3CR1 gene is shown in SEQ ID No.

7.

5. A methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, characterized in that, It includes the following steps: S1. cfDNA extraction; S2. Bisulfite modification; S3. Disulfide sequencing PCR, namely BSP, the PCR corresponding fragment is the sequence shown in SEQ ID No.5, and the PCR primer pair is the primer set described in any one of claims 1 - 4; S4. Agarose gel electrophoresis detection and separation and purification; S5. Ligation product transformation and sequencing.

6. The methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression according to claim 5, characterized in that In the step S2, the sulfite conversion in the bisulfite modification adopts the PCR method; the PCR reaction system is: 100pg - 2μg of Input DNA, 130μl of CT Conversion Mix, and add ddH2O to 150μl; the PCR reaction conditions are: 98°C for 10min, 64°C for 40min, 98°C for 5min, 64°C for 40min, 98°C for 5min, 64°C for 40min, and terminate at 4°C.

7. The methylation BSP detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression according to claim 5, wherein In the step S3, the reaction system of BSP PCR is: 25μl of bisulfite conversion reagent, 2μl of forward primer, 2μl of reverse primer, 9μl of DNA, and 12μl of ddH2O; the BSP PCR reaction conditions are: pre-denaturation at 95°C for 5min, denaturation at 95°C for 30s, annealing at 51.7°C for 30s, extension at 72°C for 1min, the denaturation to extension steps are cycled 35 times, and repair extension at 72°C for 5min.

8. A methylation ARMS + Taqman probe detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression, characterized in that, It includes the following steps: S1. cfDNA extraction; S2. Bisulfite modification; S3. Use the methylation multiplex qPCR special reagent for sulfite conversion for qPCR detection.

9. The methylation ARMS + Taqman probe detection method using the methylation level of the CX3CR1 promoter region as a detection index for depression according to claim 8, characterized in that, In the step S3, the reaction system for qPCR is as follows: the total volume is 20 μl, 10 μl of methylation qPCR reagent, 0.2 μl of 20 μM universal upstream primer, 0.2 μl of 20 μM universal downstream primer, 0.2 μl of 20 μM probe, 1 μl of DNA, and 8.6 μl of ddH2O; the reaction conditions for qPCR are 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and the second to third steps are cycled 45 times.

10. Use of the methylation detection primer set according to any one of claims 1-4 for detecting the methylation level of the CX3CR1 promoter region as an index for detecting depression in the preparation of a depression detection kit or a biochip.

Images