Application of NAT10 gene in preparation of osteoarthritis treatment and diagnosis reagent

By using the NAT10 gene as a target, detecting its expression and using the inhibitor Remodelin, the diagnosis and treatment difficulties of osteoarthritis are solved, early diagnosis and effective treatment are achieved, and the need for artificial joint replacement is reduced.

CN120350113APending Publication Date: 2025-07-22THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510489081.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The lack of effective targets in the prior art to prevent cartilage destruction and degeneration of osteoarthritis, which leads to difficulties in treatment and end-stage patients need to rely on artificial joint replacement, which brings huge burden to patients and society.

Method used

Using the NAT10 gene as a diagnostic and therapeutic target, the function of the NAT10 gene is inhibited by detecting the expression level of the NAT10 gene and the use of NAT10 inhibitors such as Remodelin, promotes the synthesis and secretion of cartilage matrix, and inhibits cartilage degeneration.

Benefits of technology

The specificity and sensitivity of early diagnosis of osteoarthritis is achieved, providing effective treatment methods, delaying cartilage degeneration and promoting cartilage matrix synthesis, and reducing the need for artificial joint replacement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350113A_ABST
    Figure CN120350113A_ABST
Patent Text Reader

Abstract

The invention provides an NAT10 gene and application thereof in diagnosis and treatment of osteoarthritis. The NAT10 gene and the expression product provided by the invention have important significance on diagnosis of early osteoarthritis, inhibition of NAT10 can promote synthesis and secretion of cartilage matrix and inhibit cartilage degeneration, and then overexpression of NAT10 is utilized to detect cartilage matrix generation indexes, which prompts that NAT10 is an important factor causing osteoarthritis. The results show that NAT10 is an important target for diagnosing and treating osteoarthritis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of human NAT10 gene in the treatment of osteoarthritis and the preparation of diagnostic reagents. Background Art

[0002] Osteoarthritis (OA) is a degenerative disease mainly characterized by subchondral bone remodeling, joint inflammation, osteophyte formation, and cartilage degeneration. The incidence of OA has been increasing year by year, which is related to age, obesity, trauma, inflammation, genetics, anatomy, etc. At present, there is no effective therapeutic target to prevent the occurrence and development of cartilage destruction. Only non-steroidal anti-inflammatory drugs, steroids and other drugs can control pain symptoms. End-stage OA patients can only receive artificial joint replacement treatment, which brings huge medical and economic burdens to patients and society. Therefore, seeking therapeutic targets for OA and effectively inhibiting cartilage degeneration are currently hot and difficult issues in the prevention and treatment of osteoarthritis.

[0003] The NAT10 gene is a gene closely related to the human immune system. In the human immune system, the NAT10 gene plays an important regulatory role. Studies have found that the expression level of the NAT10 gene is closely related to the normal function of the human immune system. When the immune system is invaded by viruses or bacteria, the NAT10 gene will be activated, thereby regulating the activity of immune cells and enhancing the defense ability of the immune system. The regulation of the NAT10 gene is mainly achieved through transcription factors and epigenetic mechanisms. Transcription factors are a class of proteins that can bind to gene DNA and regulate gene expression. They can recognize and bind to the promoter region of the NAT10 gene, thereby promoting or inhibiting the transcription process of the NAT10 gene. In addition, epigenetic mechanisms also play an important regulatory role in the expression of the NAT10 gene. For example, epigenetic modifications such as DNA methylation and histone modification can affect the chromatin structure of the NAT10 gene, and thus affect gene transcription and expression.

[0004] Studies have shown that the abnormal expression of the NAT10 gene is closely related to the occurrence and development of various immune diseases. For example, some studies have found that the expression level of the NAT10 gene is significantly decreased in autoimmune diseases, which may lead to immune system disorders and the occurrence of diseases. In addition, some studies have also found that the NAT10 gene is of great significance in tumor immune escape and drug resistance, apoptosis, cell cycle regulation, etc.

[0005] The protein encoded by the NAT10 gene plays diverse and complex roles in eukaryotes. It is involved in regulating the cell cycle and the precise execution of mitosis, ensuring the correct distribution of chromosomes to daughter cells. As an acetyltransferase, NAT10 participates in regulating the functions and stabilities of various intracellular proteins through protein acetylation, a process crucial for cell signaling, gene expression regulation, and response to environmental stress. In addition, NAT10 also plays a role in the DNA damage response, participating in repair mechanisms to protect the genome from damage. In terms of RNA processing, NAT10 is involved in the fine regulation of gene expression by affecting steps such as RNA splicing, editing, and nuclear export. Notably, the abnormal expression of NAT10 is associated with the development of various cancers, making it a potential cancer treatment target. Therefore, the NAT10 gene is a multifunctional regulatory molecule in cell life activities. The prior art has not reported the mechanism of action of the NAT10 gene in the formation and development of OA, nor its related applications. Therefore, the research on the NAT10 gene as an early diagnosis and intervention for OA is of great significance. Summary of the Invention

[0006] To make up for the deficiencies of the existing technology, the present discovery provides a molecular marker that can be used for the early diagnosis and treatment of osteoarthritis (OA). Compared with traditional imaging examinations for diagnosing osteoarthritis, using gene markers to diagnose osteoarthritis has timeliness, specificity, and sensitivity, enabling patients to be aware of the disease risk at an early stage of the disease and take corresponding preventive and treatment measures according to the level of risk.

[0007] In the first aspect, the present invention provides a target for diagnosing or treating osteoarthritis, and the target is the NAT10 gene.

[0008] In the second aspect, the present invention also provides the application of a diagnostic reagent for detecting the NAT10 gene in the detection of osteoarthritis.

[0009] In the third aspect, the present invention also provides the application of a diagnostic reagent for detecting the NAT10 gene in a detection reagent or kit for osteoarthritis.

[0010] Furthermore, the diagnostic reagent or kit can be a product for diagnosing osteoarthritis by detecting the expression level of the NAT10 gene and its expression products using RT-qPCR, real-time quantitative PCR, immunoassay, in situ hybridization, or microarray detection methods.

[0011] In the fourth aspect, the present invention also provides an RT-qPCR diagnostic reagent for detecting the NAT10 gene, which contains a pair of specific primers, and the primer sequences are as shown in SEQ ID.1-2.

[0012] In an alternative embodiment, a real-time quantitative PCR diagnostic reagent for detecting the NAT10 gene, which comprises a pair of specific primers, and the primer sequences are shown as SEQ ID.1-2.

[0013] In an alternative embodiment, an immunoassay diagnostic reagent for detecting the NAT10 gene, which comprises an antibody capable of specifically binding to the NAT10 protein.

[0014] In an alternative embodiment, an in-situ hybridization diagnostic reagent for detecting the NAT10 gene, which comprises a probe capable of hybridizing with the nucleic acid sequence of the NAT10 gene.

[0015] In an alternative embodiment, an in-situ chip diagnostic reagent for detecting the NAT10 gene, which comprises a protein chip and a gene chip; wherein, the protein chip comprises an antibody capable of specifically binding to the NAT10 protein, and the gene chip comprises a probe capable of hybridizing with the nucleic acid sequence of the NAT10 gene.

[0016] Furthermore, the kit comprises one or more combinations of RNA extraction reagents, reverse transcription reagents, and fluorescence quantitative PCR reaction reagents.

[0017] Based on the inventive concept of the present invention, the above-mentioned specific primers, specifically binding antibodies, probes, etc. can all be designed and screened according to the NAT10 gene sequence.

[0018] In a fifth aspect, the present invention also provides a use of a NAT10 gene inhibitor in the treatment of osteoarthritis.

[0019] In a sixth aspect, the present invention also provides an application of a NAT10 gene inhibitor in the preparation of a drug for treating osteoarthritis.

[0020] Furthermore, the gene inhibitor of NAT10 is a chemical drug, and preferably, the chemical drug is Remodelin.

[0021] The Remodelin (Histone Acetyltransferase inhibitor) is a NAT10 inhibitor. Remodelin remedies the nuclear shape of LMNA-depleted cells by inhibiting NAT10-mediated microtubule reorganization, and improves the nuclear shape and the health status of HGPS cells. Remodelin may thus provide a treatment possibility for alleviating dystrophic and premature aging diseases; its use in the treatment of osteoarthritis has not been reported. Its molecular formula is C 15 H 15 BrN4S, with a molecular weight of 363.28, a CAS number of 1622921-15-6, and the structural formula is:

[0022]

[0023] Furthermore, the NAT10 gene inhibitor of the present invention is a biopharmaceutical, and the biopharmaceutical contains a plasmid capable of inhibiting the expression of the NAT10 gene.

[0024] Even further, the plasmid for inhibiting NAT10 is constructed by a method including the following steps: synthesizing shRNA oligonucleotides and cloning them into an expression plasmid containing an RNA polymerase III promoter.

[0025] In an alternative embodiment, the shRNA oligonucleotide sequence is as shown in SEQ ID.5.

[0026] The NAT10 has the effect of inhibiting the synthesis and secretion of cartilage matrix and promoting cartilage degeneration, while the plasmid for knocking down NAT10 can effectively promote the synthesis and secretion of cartilage matrix and inhibit cartilage degeneration.

[0027] Even further, the NAT10 gene inhibitor is a vector containing the above plasmid.

[0028] The vector can be an adeno-associated virus or a lentivirus.

[0029] The method for constructing the vector is as follows: The steps for constructing the NAT10 knockdown adeno-associated virus / lentivirus are: 1) Transfect the constructed plasmid into a host cell, and verify the knockdown effect by screening and molecular biology methods; 2) Use an adeno-associated virus / lentivirus preparation kit to prepare the NAT10 knockdown virus.

[0030] The steps for constructing the NAT10 overexpression adeno-associated virus / lentivirus are: 1) Transfect the constructed plasmid into a host cell, and verify the overexpression effect by screening and molecular biology methods; 2) Use an adeno-associated virus / lentivirus preparation kit to prepare the NAT10 knockdown virus.

[0031] The host cell is a human primary chondrocyte.

[0032] The NCBI accession number of the nucleotide sequence of NAT10 of the present invention is NG_051821.2.

[0033] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0034] 1. The present invention firstly proposes that the NAT10 gene and its expression product are of great significance for diagnosing early osteoarthritis.

[0035] 2. The present invention collects cartilage samples from the worn area and non-worn area of knee osteoarthritis, extracts cells, and uses high-throughput sequencing method to compare the mRNA expression profiles in the worn area and non-worn area to obtain the differentially expressed genes of NAT10, among which NAT10 is significantly up-regulated in the worn cartilage, and further uses clinical knee osteoarthritis specimens to further verify the expression of NAT10 by qPCR and WB. These results reveal the potential value as a clinical diagnostic biomarker.

[0036] 3. By inhibiting NAT10, the present invention detects the indicators related to cartilage matrix synthesis in chondrocytes and finds that inhibiting NAT10 can promote the synthesis and secretion of cartilage matrix and inhibit cartilage degeneration. Then, by overexpressing NAT10 to detect the indicators of cartilage matrix generation, it is suggested that NAT10 is an important factor leading to the occurrence of osteoarthritis. These results indicate that NAT10 is an important target for the treatment of osteoarthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a graph showing the correlation between the up-regulation of NAT10 and chondrocyte senescence and murine osteoarthritis (OA), where A is a representative graph of Safranin O, Alcian blue, and ac4C immunofluorescence staining of unworn (U) and worn (D) cartilage tissues; B is a heat map of all differentially expressed genes in U and D cartilage tissues of OA patients; C is an immunoblot analysis graph and dot blot analysis graph of NAT10, COL2A1, MMP13, p16, and p21 in U and D cartilage tissues; D is a graph showing the correlation between the abundance of ac4C and the expression level of NAT10; E is an immunoblot analysis of NAT10, COL2A1, MMP13, p16, and p21, and a dot blot analysis of ac4C in young and old cartilage; F is a statistical graph of the total ac4C level of acetylated RNA in old cartilage; G is an image of SA-β-Gal positive in primary human chondrocytes of passage 2 and passage 6; H is a quantitative analysis graph of SA-β-Gal positive in primary human chondrocytes of passage 2 and passage 6; I is an immunoblot analysis graph of NAT10, COL2A1, MMP13, p16, and p21 in chondrocytes with different passages, H2O2 stimulation, and Doxo stimulation; J is an image of Safranin-O / FastGreen and immunohistochemical staining of articular cartilage of mice at 2 months, 12 months, and 24 months old and DMM mice.

[0038] Figure 2 It is a statistical graph of the mRNA expression level of NAT10, where A is worn cartilage tissue and non-worn cartilage tissue, B is old cartilage and young cartilage, and C is chondrocytes with multiple passages;

[0039] Figure 3Figure showing the promotion of chondrocyte senescence in vitro and the progression of osteoarthritis in mice by NAT10. Among them, A is the immunoblot analysis of NAT10, COL2A1, MMP13, p16, and p21, and the dot blot analysis of ac4C in primary human chondrocytes (PHCs) with NAT10 knockdown and overexpression; B is the mRNA quantification results of NAT10, COL2A1, MMP13, p16, and p21 in primary human chondrocytes (PHCs) with NAT10 knockdown and overexpression; C is the total ac4C level of acetylated RNA of NAT10, COL2A1, MMP13, p16, and p21 in primary human chondrocytes (PHCs) with NAT10 knockdown and overexpression; D is the immunofluorescence images of NAT10, p53, IL-1β, and TNF-α in PHCs after NAT10 knockdown or overexpression; E is the images of SA-β-Gal positive in PHCs after NAT10 knockdown or overexpression; F is the statistical chart of the quantitative results of SA-β-Gal positive in PHCs after NAT10 knockdown or overexpression; G is the representative images of the mitochondrial membrane potential of human OA chondrocytes transfected with NAT10 shRNA, NAT10 overexpressing adeno-associated virus, or their corresponding controls; H is the quantitative results of the mitochondrial membrane potential of human OA chondrocytes transfected with NAT10 shRNA, NAT10 overexpressing adeno-associated virus, or their corresponding controls; I is the figure of chondrocyte apoptosis detected by flow cytometry; J is the quantitative results of chondrocyte apoptosis detected by flow cytometry; where n = 3 per group;

[0040] Figure 4 Figure of Safranin O / Fast Green and immunohistochemical staining of NAT10, COL2A1, and p16 in the knee joints of DMM-induced mice treated with different treatments;

[0041] Figure 5 Images and their quantitative analysis statistical charts of NAT10, COL2A1, MMP13, p21, and p16 in the knee joints of mice after DMSO / Remodelin treatment by safranin green and immunofluorescence staining. Detailed implementation manners

[0042] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meanings and scopes of the terms should be clear. However, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or extrinsic definition. In this application, unless otherwise specified, the use of "or" means "and / or". In addition, the use of the terms "comprising", "including", and other forms is non-restrictive.

[0043] Unless otherwise specified, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.

[0044] In the present invention, knee joint cartilage tissues were obtained from surgical patients in the First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong Province. Femoral condyles and tibial plateaus of adults (over 40 years old, knee osteoarthritis, Kellgren & Lawrence imaging grade III to IV, Thompson gross morphology grade III to IV) were obtained during joint replacement surgery for moderate to severe knee osteoarthritis. According to the International Cartilage Repair Society (ICRS) grading system, knee OA cartilage can be divided into non-worn areas (ICRS = 0) and worn areas (ICRS = 1 - 4), and they were collected separately according to non-worn areas and worn areas.

[0045] The surface articular cartilage was cut into 1 mm 3 pieces according to intact areas and worn areas. First, it was washed twice with PBS, then digested with protease (4 mg / mL, Roche, Inc) in a 37°C constant temperature incubator for 2 h, and after being washed twice with PBS, it was digested with collagenase P (0.25 mg / L, Roche, Inc) in a 37°C constant temperature incubator for 12 - 14 h. After digestion and centrifugation, OA intact area and worn area chondrocytes were obtained and seeded into 75 cm 2 bottles. When the density reached about 80%, they were passaged and seeded into 6-well plates, with about 2×10 6 -4×10 6 cells per well, and the medium was changed every 3 days.

[0046] Example 1

[0047] This example studied the application of NAT10 in the diagnosis of osteoarthritis.

[0048] 1. Determination of NAT10 by high-throughput sequencing

[0049] Using Mini kits (purchased from Qiagen), total RNA was extracted from non-worn area chondrocytes and worn area chondrocytes respectively. The mRNA expression profiles of the two groups of cells were obtained by high-throughput sequencing, and the differential NAT10 was found. The results are as Figure 1 shown. It can be seen from the Figure 1 results that the expression level of NAT10 in the worn area was significantly increased, indicating that it is a potential diagnostic factor target for NAT10.

[0050] 2. Results of real-time fluorescence quantitative PCR (RT-qPCR) detection

[0051] Chondrocytes from non-worn areas and worn areas of 20 different patient sources were collected separately. Total RNA was extracted from the tissues of non-worn area and worn area chondrocytes, and reverse transcription was performed according to the method in step 1. Subsequently, the expression of NAT10 was verified by RT-qPCR. The expression of NAT10 was further verified using cartilage specimens from 6 young patients and 6 elderly patients.

[0052] The reverse transcription reaction system and the dosage of each component are shown in Table 1. Prepare a new enzyme-free 200 μl EP tube, mix each component with the total RNA, and then place it in the RT-qPCR instrument. The reverse transcription reaction is carried out according to the following conditions: incubation at 37 °C for 15 minutes to start amplification, incubation at 85 °C for 5 seconds to terminate the reaction, and then store the product at 4 °C for later use.

[0053] Table 1 Formulation of the reverse transcription reaction mixture for mRNA

[0054]

[0055] RT-qPCR detection uses Green Pro Taq HS Premix II (ROX plus) reagent (purchased from AG Biology) and experiments are carried out according to its instructions. Subsequently, use ABI Quant Studio TM Real-Time PCR instrument and Quant Studio TM Real-Time PCR software for analysis.

[0056] The primers for NAT10 are as follows:

[0057] NAT10 F1: 5'-ATAGCAGCCACAAACATTCGC-3' (Seq ID.1);

[0058] NAT10 R1: 5'-ACACACATGCCGAAGGTATTG-3' (Seq ID.2).

[0059] The primers for the internal reference are as follows:

[0060] GAPDH F1: 5'-GGAGCGAGATCCCTCCAAAAT-3' (Seq ID.3);

[0061] GAPDH R1: 5'-GGCTGTTGTCATACTTCTCATGG-3' (Seq ID.4).

[0062] The gene expression levels obtained by real-time fluorescence quantitative PCR were further analyzed statistically using the ΔΔCT method. The gene expression levels were presented as 2^(-ΔΔCT). The expression patterns of the NAT10 gene were further verified in the non-worn and worn areas of cartilage from 20 patients with knee OA from different sources. The results were as Figure 2 shown in Figure 2 A, and it was found that NAT10 was significantly upregulated in the worn cartilage. The comparison results between young and old patients were as

[0063] shown in

[0064] B, and the expression of NAT10 was also significantly upregulated in the cartilage tissues of old patients. This indicates that this target has high sensitivity and specificity for the diagnosis of osteoarthritis.

[0065] Using the techniques of knocking down and overexpressing NAT10, related indicators of extracellular matrix synthesis and catabolism were detected in human chondrocytes, and it was found that NAT10 plays a promoting role in the process of chondrocyte degeneration.

[0066] 1. Construction of plasmids for overexpressing and knocking down NAT10

[0067] The pcDNA3.1 vector was selected to construct the NAT10 knockdown / overexpression plasmids. The NAT10 knockdown sequence was: GCAATTGTACACAGTGACTAT (Seq ID.5). The NAT10 overexpression CDS region sequence was: atgcatcggaaaaaggtggataaccgaatccggattctcattgagaatggagtagctgagcggcaaagatctctctttgttgtagttggggatcgaggaaaagatcag (Seq ID.6).

[0068] The steps for constructing the knockdown plasmid were: 1) Synthesize shRNA oligonucleotides and clone them into an expression vector containing an RNA polymerase III promoter; 2) Transfect the constructed plasmid into host cells, and verify the knockdown effect by screening and molecular biology methods.

[0069] The steps for constructing the overexpression plasmid were: 1) Design and synthesize primers with restriction enzyme sites, and amplify the target gene by PCR; 2) Ligate the amplified product with the linearized expression vector; 3) Transform host cells and screen and identify the recombinant plasmid; 4) Transfect the constructed plasmid into host cells, and verify the overexpression effect by screening and molecular biology methods.

[0070] Using the above method, an NAT10 overexpression cell line NAT10oe, an NAT10 knockout cell line sh-NAT10 and their corresponding empty vector cell lines were constructed respectively.

[0071] After the successful construction of the stable cell lines, total proteins and total RNAs were extracted from chondrocytes.

[0072] This experiment used a 3000 transfection kit for transfection. According to the ratio in the reagent instruction manual, solution A was prepared: 125 μl of Opti-MEM, 5 μl of 3000; solution B was prepared: 125 μl of Opti-MEM, 5 μl of 2 μg of the plasmid to be transfected. Solutions A and B were gently and thoroughly mixed, and after standing at room temperature for 15 minutes, cell transfection was carried out. The real-time fluorescence quantitative PCR (RT-qPCR) technique was used to detect the expressions of NAT10, cartilage matrix index (COL2A1), cartilage degeneration index (MMP13), and senescence-related indexes (P16, P21) in each experimental group. The detection steps and parameters were the same as those in the second step of Example 1. The primers used were as follows:

[0073] NAT10 F1: 5'-ATAGCAGCCACAAACATTCGC-3' (Seq ID.1);

[0074] NAT10 R1: 5'-ACACACATGCCGAAGGTATTG-3' (Seq ID.2);

[0075] COL2A1 F1: 5'-CCAGATGACCTTCCTACGCC-3' (Seq ID.7);

[0076] COL2A1 R1: 5'-TTCAGGGCAGTGTACGTGAAC-3' (Seq ID.8);

[0077] MMP13 F1: 5'-CCAGACTTCACGATGGCATTG-3' (Seq ID.9);

[0078] MMP13 R1: 5'-GGCATCTCCTCCATAATTTGGC-3' (Seq ID.10);

[0079] P16 F1: 5'-GATCCAGGTGGGTAGAAGGTC-3' (Seq ID.11);

[0080] P16 R1: 5'-CCCCTGCAAACTTCGTCCT-3' (Seq ID.12);

[0081] P21 F1: 5'-TGTCCGTCAGAACCCATGC-3' (Seq ID.13);

[0082] P21 R1: 5'-AAAGTCGAAGTTCCATCGCTC-3' (Seq ID.14);

[0083] The statistical results of the expression levels are as Figure 3 shown in B. It can be seen that in the NAT10 gene overexpression group, the cartilage matrix index COL2A1 was downregulated, the degeneration-related index MMP13 was upregulated, and the aging-related P16 and P21 were also upregulated; in the NAT10 gene knockout group, the cartilage matrix index COL2A1 was upregulated, the degeneration-related index MMP13 was downregulated, and the aging-related P16 and P21 were also correspondingly downregulated. Therefore, it can be seen from the fluorescence quantitative results that when the NAT10 gene is overexpressed or knocked out in chondrocytes, the expression levels of cartilage degeneration and aging-related index factors also change, indicating that it has an obvious correlation with cartilage wear, degeneration, and aging.

[0084] 3. Detection of cartilage degeneration-related indicators using Western Blot technology

[0085] Dissolve chondrocytes on ice with RIPA lysis buffer (containing protease and phosphatase inhibitors) for 30 min, then obtain proteins using a cell scraper. Measure the protein concentration using a BCA protein assay kit (ThermoFisher) according to the instructions and a microplate reader. Prepare the gel using a 10% PAGE gel rapid preparation kit (purchased from Yaenzyme). The protein loading amount per well in the gel is uniformly 25 μg. Electrophorese at a constant voltage of 80 V for 30 minutes, then change to a constant voltage of 120 V and electrophorese for 1 h. Subsequently, transfer the membrane at a constant current of 250 mA for 2 h, block it with a rapid blocking solution at room temperature for 10 min (purchased from Yaenzyme), incubate with the primary antibody overnight at 4°C, wash, and then incubate with the corresponding secondary antibody at room temperature for 1 h. The antibodies used are as follows: COL2A1 antibody, NAT10 antibody, MMP13 antibody, P16 antibody, P21 antibody, ac4C antibody, GAPDH antibody (all antibodies are purchased from Proteintech). Prepare a hypersensitive ECL luminescent solution (purchased from Merck millipore) and use an imager (ChemiDoc Touch, BIO RAD) to obtain band images, and detect the protein expression levels of each index in the NAT10 oe, Vetor oe, Sh-NAT10 group, and Sh-NC.

[0086] The experimental results are as Figure 3As shown in A, it can be seen that when the NAT10 gene is overexpressed in chondrocytes, the cartilage degeneration-related index MMP13 is up-regulated, and the aging-related P16 and P21 are also up-regulated. The results further verify the results in the fluorescence quantitative detection, that is, the NAT10 gene is significantly associated with cartilage wear, degeneration and aging.

[0087] Example 3

[0088] This example studies the effect of NAT10 on the progression and treatment of osteoarthritis.

[0089] Animal experiments were used to verify that NAT10 can promote articular cartilage degeneration

[0090] (1) According to the mouse NAT10 sequence information, overexpression / knockdown adeno-associated viruses were constructed, and the experimental method was the same as that in Example 2.

[0091] (2) Nine 12-week-old C57 BL / 6 mice were selected for the experiment, and the mice were randomly divided into 3 groups:

[0092] DMM + empty vector adeno-associated virus group (vector), DMM + NAT10 overexpression adeno-associated virus group (Ad-NAT10), DMM + NAT10 knockdown adeno-associated virus group (Ad-NAT10-shRNA).

[0093] Medial meniscus instability (DMM) surgery was performed on the left knee of the mice in the three groups. Two weeks later, the DMM + vector group was injected with an empty vector adeno-associated virus, the DMM + Ad-NAT10 group was injected with a NAT10 overexpression adeno-associated virus, and the DMM + Ad-NAT10-shRNA group was injected with a NAT10 knockdown adeno-associated virus. The injection was continued for 4 weeks, and the mice were sacrificed at the 10th week after surgery to collect specimens.

[0094] (3) The specimens were stained with micro-CT, HE staining, safranin O-fast green staining, alcian blue staining and immunohistochemistry (IHC), and the osteoarthritis and osteophyte conditions were analyzed according to the Osteoarthritis Research Society International (OARSI) system.

[0095] The research results on the effect of overexpression / knockdown of NAT10 in the mouse joint cavity on the progression of mouse OA are as Figure 4 shown. It can be seen that after injecting the NAT10 overexpression adeno-associated virus into the mouse joint cavity, the degree of arthritis in the joint specimens is higher than that in the empty vector adeno-associated virus group, the aging index P16 is up-regulated, and the cartilage matrix index COL2A1 is down-regulated, indicating that overexpression of NAT10 can promote cartilage degeneration and inhibit the synthesis and secretion of cartilage matrix. After knocking down NAT10, the aging index P16 is down-regulated and the cartilage matrix index COL2A1 is up-regulated, indicating that knocking down NAT10 can delay cartilage degeneration and promote the synthesis and secretion of cartilage matrix.

[0096] Example 4

[0097] This example studies the effect of the NAT10 selective inhibitor Remodelin on the progression and treatment of osteoarthritis.

[0098] Animal experiments were used to verify that NAT10 can promote articular cartilage degeneration

[0099] (1) Six 12-week-old C57 BL / 6 mice were selected for the experiment, and the mice were randomly divided into two groups:

[0100] DMM + DMSO group, DMM + Remodelin group.

[0101] (2) Medial meniscus destabilization (DMM) surgery was performed on the left knee of the mice in both groups to establish an animal model of arthritis. Four weeks later, the DMM + Remodelin group began to receive intragastric administration of Remodelin at 100 mg / kg qd, and the DMM + DMSO group received intragastric administration of an equal dose of DMSO. Intragastric administration was continued for 4 weeks, and the mice were sacrificed at the 8th week after surgery to collect specimens.

[0102] (3) The specimens were stained with safranin O-fast green and immunofluorescence staining (NAT10, COL2A1, MMP13, P21, P16), and the conditions of osteoarthritis and osteophytes were analyzed according to the Osteoarthritis Research Society International (OARSI) system.

[0103] Figure 5 This is a figure showing the research results of the effect of selective inhibition of NAT10 on the progression of OA in mice. It can be seen that after selective inhibition of NAT10 in the DMM + Remodelin group, the degree of arthritis in the joint specimens was significantly lower than that in the DMM + DMSO group. The cartilage matrix index COL2A1 was up-regulated, the matrix degradation-related enzyme MMP13 was down-regulated, and the senescence indexes P21 and P16 were down-regulated. This indicates that selective inhibition of NAT10 can promote the delay of cartilage degeneration, promote the synthesis and secretion of cartilage matrix, and Remodelin is an effective selective inhibitor.

[0104] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention.

Claims

1. A target for the diagnosis or treatment of osteoarthritis, wherein the target is the NAT10 gene.

2. Use of the detection reagent for the NAT10 gene described in claim 1 in the preparation of a reagent kit for detecting osteoarthritis; Preferably, the diagnostic reagent or kit can be a product for diagnosing osteoarthritis by detecting the expression levels of the NAT10 gene and its expression products using RT-qPCR, real-time quantitative PCR, immunoassay, in situ hybridization or microarray detection methods.

3. The application according to claim 2, wherein The detection reagent is an RT-qPCR or real-time quantitative PCR diagnostic reagent, which contains a pair of specific primers, and the primer sequences are as shown in SEQ ID.1-2.

4. The application according to claim 2, wherein The kit includes one or more combinations of RNA extraction reagents, reverse transcription reagents, and fluorescence quantitative PCR reaction reagents.

5. Use of the inhibitor of the NAT10 gene described in claim 1 in the preparation of a therapeutic drug for treating osteoarthritis.

6. The application according to claim 5, wherein The inhibitor of the NAT10 gene is a chemical drug capable of inhibiting the expression of the NAT10 gene; preferably, the chemical drug is Remodelin.

7. The application according to claim 5, wherein The inhibitor of the NAT10 gene is a biological drug capable of inhibiting the NAT10 gene; preferably, the biological drug contains a plasmid capable of inhibiting the expression of the NAT10 gene; More preferably, the plasmid for inhibiting NAT10 is constructed by a method including the following steps: synthesizing shRNA oligonucleotides and cloning them into an expression plasmid containing an RNA polymerase III promoter.

8. The application according to claim 7, characterized in that, The shRNA oligonucleotide sequence is as shown in SEQ ID.

5.

9. The application according to claim 7, wherein The biological drug is a vector containing the plasmid; preferably, the vector is an adeno-associated virus or a lentivirus.

10. The application according to claim 8, characterized in that, The method for constructing the vector is: 1) Transfect the constructed plasmid into a host cell and verify the overexpression effect by screening and molecular biology methods; 2) Prepare an NAT10 knockdown virus using an adeno-associated virus / lentivirus preparation kit; preferably, the host cell is a human primary chondrocyte.