SNP (Single Nucleotide Polymorphism) molecular marker related to rate of linear motion of fresh semen and sperm of Fujian local breeding rabbit and application of SNP molecular marker

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to the rectilinear motion rate of fresh semen and sperms of local breeding rabbits in Fujian, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID No: 1, in addition, the invention also provides a primer pair for detecting the SNP molecular marker, and the nucleotide sequence of the primer pair is shown as SEQ ID No: 2-3. The SNP molecular marker disclosed by the invention is closely related to the linear motion rate of the sperms in the fresh semen of the Fujian local breeding rabbits, and can be effectively used for molecular marker-assisted breeding of the Fujian local breeding rabbits, so that early selection can be performed on breeding materials of the Fujian local breeding rabbits with high linear motion rate of the sperms in the fresh semen according to actual frozen semen manufacturing requirements; furthermore, the frozen semen preparation efficiency can be effectively improved, and the long-term breed conservation requirements of livestock and poultry resources in Fujian are met.

Description

Technical Field

[0001] The present invention belongs to the field of animal molecular biology DNA marker technology and applications, and specifically relates to an SNP molecular marker related to the straight-line motility rate of sperm in fresh semen of Fujian local rabbit breeds, a primer pair for detecting the aforementioned SNP marker, the use of the primer pair of the aforementioned SNP marker in the conservation of Fujian local rabbit resources, and a method for detecting the straight-line motility rate of fresh semen of Fujian local rabbit breeds. Background Art

[0002] Fujian Province is located in a mountainous and hilly area. Due to its unique geographical conditions, multiple meat rabbit breed populations have been formed, mainly including three breeds: Fujian Yellow Rabbit, Southwest Fujian Black Rabbit, and Fujian White Rabbit. These local rabbit breeds are deeply favored by local Fujian people for their characteristics such as being able to tolerate roughage, having excellent meat quality, wide adaptability, and strong disease resistance, and have become essential dishes in local weddings, funerals, and other activities. However, with social development, Fujian local rabbit breeds are facing multiple threats and urgently need to take effective germplasm resource conservation measures to prevent them from gradually disappearing over time.

[0003] As an important local agricultural resource in Fujian, local rabbit breeds have unique genetic characteristics and adaptability. However, due to factors such as the impact of foreign breeds and changes in the ecological environment, their numbers have gradually decreased, and their genetic diversity is threatened, urgently needing protection and utilization. Semen cryopreservation technology, as an effective means of germplasm resource conservation, can long-term preserve the genetic information of excellent breeding rabbits. However, due to the low quality of fresh semen of Fujian local rabbit breeds, the quality of the produced frozen semen is generally low, not meeting the requirements for long-term preservation of livestock and poultry resources. Therefore, it is necessary to select high-quality fresh semen for frozen semen production. Single nucleotide polymorphism (SNP) molecular markers provide a scientific basis for the selection of breeding rabbits with high-quality fresh semen. By screening gene loci related to excellent production performance, molecular marker-assisted selection can be achieved, improving the efficiency of frozen semen production for breeding rabbits. The conservation of germplasm resources is of great significance for maintaining ecological balance, ensuring food safety, and promoting the sustainable development of agriculture. Traditional conservation methods have limitations, while modern technical means such as semen cryopreservation can effectively preserve genetic information, providing support for future utilization and conservation, reducing the risk of extinction of local rabbit breeds, and helping to breed new varieties. Molecular marker-assisted selection technology solves the problem of low straight-line motility rate of sperm in fresh semen of local livestock and poultry resources, improving the efficiency of frozen semen production. Therefore, carrying out the work of semen SNP molecular marker selection for Fujian local rabbit resources has important practical significance for promoting the sustainable development of the rabbit industry and protecting biodiversity.

[0004] The development of single nucleotide polymorphism (SNP) molecular marker technology provides new ideas and methods for selecting fresh semen sperm rabbits with high straight-line motility. SNP markers are one of the DNA molecular markers with polymorphisms generated by single nucleotide variations in gene sequences, and have the advantages of wide distribution, genetic stability, and suitability for high-throughput automated analysis. By screening SNP molecular markers closely related to the trait of high straight-line motility of fresh semen sperm of Fujian local rabbit breeds, molecular marker-assisted selection can be achieved, thereby improving the efficiency of frozen semen production. However, at present, the effective SNP molecular markers for semen selection of Fujian local rabbit resources are still limited, and relevant research and exploration work needs to be further carried out. Summary of the Invention

[0005] The present invention aims to solve at least one of the problems existing in the prior art. To this end, the object of the present invention is to provide an SNP molecular marker related to the straight-line motility of fresh semen sperm of Fujian local rabbit breeds, which can be effectively used for semen quality selection of Fujian local rabbit breeds.

[0006] The object of the present invention is achieved by the following technical solutions:

[0007] The present invention provides an SNP molecular marker related to the straight-line motility of fresh semen sperm of Fujian local rabbit breeds. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No: 1, with a full length of 251 bases. The nucleotide sequence shown in SEQ ID No: 1 is as follows:

[0008] 5’-CGGAGGACTTCTCAGAGGGGCGGCTCCGGGCTGCGCGGCTGGCGC TCGCGCAACTCCGCCGGGCACGCGGGGCGGAMGCTCTTGGGCCGGTCTGTCGCTGGAGGCCGCTCTGAGAGGGGCGCGGGTCCCGCTGGCCCGACGAGAGCCCGGGGCGGGTTTGGGGGCTCGCGGAGCAAGGAGGCTTCCGGACCCCAGCCGAAGTTCGTGATGGGGGAGGGGGTGAGCGTGCCCCGGCACGGATGAAGTCATTG-3’(SEQ ID No: 1);

[0009] In the nucleotide sequence of the SNP molecular marker, the 77th base from the 5’ end is represented by M, and M represents C or G.

[0010] The M at the 77th base from the 5’ end in the nucleotide sequence of the SNP molecular marker is related to the straight-line motility of fresh semen sperm of Fujian local rabbit breeds.

[0011] Therefore, the present invention also provides the application of the SNP molecular marker in the molecular marker-assisted breeding of Fujian local rabbit breeds.

[0012] The SNP molecular marker is used in the semen quality selection of Fujian local rabbit breeders.

[0013] According to the application, the M at the 77th base from the 5' end in the nucleotide sequence of the SNP molecular marker is correlated with the linear motility rate of sperm in fresh semen of Fujian local breed rabbits; the linear motility rate of sperm in fresh semen of Fujian local breed rabbits with homozygous CC genotype at this site is significantly lower than that of Fujian local breed rabbits with homozygous GG and heterozygous CG genotypes here.

[0014] The present invention also provides a primer pair for detecting the SNP molecular marker, and the nucleotide sequence of the primer pair is as follows:

[0015] Upstream primer: 5'-CGGAGGACTTCTCAGAGGGG-3' (SEQ ID No: 2)

[0016] Downstream primer: 5'-CAATGACTTCATCCGTGCCG-3' (SEQ ID No: 3).

[0017] The primer pair is used in molecular marker-assisted breeding of Fujian local rabbits.

[0018] The primer pair is used in the semen quality selection of Fujian local rabbit breeders.

[0019] The present invention also provides a method for identifying the linear motility rate of sperm in fresh semen of Fujian local rabbit breeds by using the primer pair, which comprises the following method:

[0020] (1) Collecting genomic DNA from local meat rabbits in Fujian;

[0021] (2) PCR amplification reaction: using the primers to perform three rounds of PCR amplification on the genomic DNA of the local Fujian rabbit breed to be tested, and collecting the amplified products;

[0022] (3) Library mixing and purification: Transfer the PCR amplification products to the same U-shaped trough for mixing, transfer the mixture to a round-bottom centrifuge tube, vortex for 30 seconds, and then place the centrifuge tube on a fixed shaker for overnight shaking; load the mixed library onto electrophoresis, recover the gel containing the target fragment after electrophoresis, and recover it using a purification kit. The recovered product is temporarily stored at 4°C;

[0023] (4) Genotyping and analysis: The purified products were subjected to next-generation sequencing (NGS) using the ILLumina X-10 sequencing platform. The sequencing results were image recognized and genotyped and analyzed using Illumina RTA and Illuminabcl2fastq software.

[0024] (5) Correlation analysis

[0025] The model for trait-marker association analysis is: ijkl =μ+G i +B j +P k +e ijkl , where Y ijkl is the observed value of the trait, μ is the mean, G i is the genotype effect, B j is the variety effect, P k is the batch effect, e ijkl The results were verified by Bonferrroni multiple comparison.

[0026] Wherein, the specific method of step (2) is:

[0027] PCR amplification reaction: The primer pair SEQ No: 2-3 was used to perform three rounds of PCR amplification on the genomic DNA of the Fujian local rabbit to be tested.

[0028] The first round of PCR reaction system was: 1 μL of 10× buffer, 1 μL of 50 nM upstream and downstream primers, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot start Taq enzyme, 2 μL of template DNA, 100 mM Mg 2+ 1 μL was supplemented with ddH2O to a final volume of 10 μL;

[0029] The first round of PCR reaction conditions: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, for a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, for a total of 20 cycles;

[0030] The reaction system for the second round of PCR was as follows: 3 μL of the first round PCR product, 1 μL of 10× buffer, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot start Taq enzyme, 100 mM Mg 2+ 1 μL was supplemented with ddH2O to a final volume of 10 μL;

[0031] The reaction conditions for the second round of PCR: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, a total of 40 cycles;

[0032] The reaction system for the third round of PCR is as follows: using 10 μL of the PCR product from the second round as the template, 2 μL of 10× buffer, 3.6 μL of 2 μM Barcode, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot-start Taq enzyme, and 2+ 1 μL, and adding ddH2O to make up the final volume to 20 μL;

[0033] The reaction conditions for the third round of PCR: 95°C for 15 min; 94°C for 30 s, 60°C for 4 min, 72°C for 30 s, a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, a total of 40 cycles.

[0034] After the amplification is completed, the PCR products are subjected to electrophoresis detection. Using a 3% agarose gel, loading 5 μL of the PCR products, and observing whether the electrophoresis bands are uniform and whether there are any heterozygous bands, etc.

[0035] Compared with the prior art, the advantages of the present invention are as follows:

[0036] 1. The SNP molecular marker of the present invention is closely related to the straight-line motility rate of fresh semen sperm of Fujian local breed rabbits, and can be effectively used for molecular marker-assisted breeding of Fujian local breed rabbits. Furthermore, it can be used to conduct early selection of breeding materials of Fujian local breed rabbits with high straight-line motility rate of fresh semen sperm according to the actual demand for frozen semen production. Moreover, it can effectively improve the efficiency of frozen semen production and meet the long-term conservation needs of Fujian local livestock and poultry resources. In addition, using the SNP marker of the present invention for molecular marker-assisted breeding of Fujian local breed rabbits has the advantages of early screening, time saving, low cost, and high accuracy.

[0037] 2. The primer pair of the present invention can effectively detect the SNP molecular marker related to the straight-line motility rate of fresh semen sperm of Fujian local breed rabbits of the present invention.

[0038] 3. The method for detecting the straight-line motility rate of fresh semen sperm of Fujian local breed rabbits of the present invention can quickly, efficiently, and accurately detect the straight-line motility rate of fresh semen sperm of Fujian local breed rabbits. Furthermore, it can be effectively used for molecular marker-assisted selection of Fujian local breed rabbits, thereby enabling early realization of short-time, low-cost, and high-accuracy selection of excellent individuals of Fujian local breed rabbits with high-quality semen. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the genotyping map of the SNP locus related to the straight-line motility rate of fresh semen sperm of Fujian local breed rabbits of the present invention. Detailed implementation mode

[0040] The present invention provides an SNP molecular marker related to the straight-line motility rate of sperm in fresh semen of Fujian local breeding rabbits. This SNP molecular marker is the nucleotide sequence shown in SEQ ID No: 1 (with a full length of 251 bases). At the 77th base from the 5' end, it is represented by M, and M represents C or G. The nucleotide sequence shown in SEQ ID No: 1 is as follows:

[0041] 5’-CGGAGGACTTCTCAGAGGGGCGGCTCCGGGCTGCGCGGCTGGCGC TCGCGCAACTCCGCCGGGCACGCGGGGCGGAMGCTCTTGGGCCGGTCTGTCGCTGGAGGCCGCTCTGAGAGGGGCGCGGGTCCCGCTGGCCCGACGAGAGCCCGGGGCGGGTTTGGGGGCTCGCGGAGCAAGGAGGCTTCCGGACCCCAGCCGAAGTTCGTGATGGGGGAGGGGGTGAGCGTGCCCCGGCACGGATGAAGTCATTG-3’(SEQ ID NO:1).

[0042] The inventors found that the straight-line motility rate of sperm in fresh semen of Fujian local breeding rabbits with the homozygous CC genotype at this locus is significantly lower than that of Fujian local breeding rabbits with the homozygous GG and heterozygous CG genotypes at this locus. By detecting the above SNP of Fujian local breeding rabbits, the straight-line motility rate of their fresh semen sperm can be effectively determined. Specifically, as described above, the straight-line motility rate of sperm in fresh semen of Fujian local breeding rabbits with the homozygous CC genotype at this SNP locus is significantly lower than that of Fujian local breeding rabbits with the homozygous GG or heterozygous CG genotypes at this locus. For example, when the genotype of this SNP locus is CC, it can be determined that the Fujian local breeding rabbit to be tested belongs to an individual with a low straight-line motility rate of sperm in fresh semen. Thus, the inventors of the present invention determined that the SNP marker of the present invention is closely related to the straight-line motility rate of sperm in fresh semen of Fujian local breeding rabbits and can be effectively used for molecular marker-assisted breeding of Fujian local breeding rabbits. Furthermore, early selection can be carried out on the breeding materials of Fujian local breeding rabbits with a high straight-line motility rate of sperm in fresh semen according to the actual requirements for making frozen semen, which can further effectively improve the efficiency of making frozen semen and meet the long-term conservation requirements of Fujian local livestock and poultry resources. In addition, according to some embodiments of the present invention, using the SNP marker of the present invention for molecular marker-assisted breeding of Fujian local breeding rabbits has the advantages of early screening, time saving, low cost, and high accuracy.

[0043] The following will describe the content of the present invention in detail with reference to the accompanying drawings of the specification and embodiments:

[0044] Example 1 A Method for Identifying the Straight-line Motility Rate of Spermatozoa in Fresh Semen of Fujian Local Breeds of Rabbits

[0045] 1. Source of Experimental Animals

[0046] The following are the Fujian local meat rabbit breeds used in this example:

[0047] Fujian Yellow Rabbit, purchased from Lianjiang Yuhuashan Natural Ecology Agricultural Experiment Farm.

[0048] The Minnan group of Minxi-Southwest Black Rabbit, purchased from Jisheng Black Rabbit Breeding Co., Ltd., Dehua County.

[0049] The Minxi group of Minxi-Southwest Black Rabbit, purchased from Longyan Tongxian Rabbit Industry Development Co., Ltd.

[0050] Fujian White Rabbit, purchased from Fujian Xuechun Agriculture and Animal Husbandry Co., Ltd.

[0051] 2. Extraction of Rabbit Genomic DNA

[0052] Collect ear vein blood from Fujian local meat rabbits, anticoagulate with EDTA, and isolate white blood cells. Use a Blood / Cells / Tissues Genomic DNA Extraction Kit Extract the total DNA of white blood cells from Fujian local breeds of rabbits, dissolve it in TE, and store it at -20 °C for later use; since the specific method of extracting rabbit genomic DNA using the kit is a routine operation, it will not be elaborated here.

[0053] 3. SNP Locus Screening

[0054] 3.1 Primer Design

[0055] Design a primer pair related to the SNP molecular marker according to the Inhibin BetaA Subunit (INHBA) gene of rabbits, for detecting the gene fragment where the above SNP locus is located. The primer pair has the nucleotide sequences shown in SEQ ID No: 2 - 3, and the specific sequences are as follows:

[0056] SEQ ID No: 2 (forward primer): CGGAGGACTTCTCAGAGGGG

[0057] SEQ ID No: 3 (reverse primer): CAATGACTTCATCCGTGCCG.

[0058] The primer pair was commissioned to be synthesized by Shanghai YingJun Biotechnology Co., Ltd.

[0059] 3.2 PCR Amplification Reaction

[0060] Using the extracted DNA as a template, the above primers were used to perform three rounds of PCR amplification on SEQ No: 2-3 to be tested for the genomic DNA of the Fujian local rabbit. The PCR reaction system and PCR reaction conditions for the three rounds of PCR amplification were as follows:

[0061] The first round of PCR reaction system was: 1 μL of 10× buffer, 1 μL of 50 nM upstream and downstream primers, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot start Taq enzyme, 2 μL of template DNA, 100 mM Mg 2+ 1 μL of ddH2O was added to the final volume of 10 μL. PCR reaction conditions: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, for a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, for a total of 20 cycles.

[0062] The reaction system for the second round of PCR was: 3 μL of the first round PCR product, 1 μL of 10× buffer, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot start Taq enzyme, 100 mM Mg 2+ 1 μL of ddH2O was added to the final volume of 10 μL. PCR reaction conditions: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, for a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, for a total of 40 cycles.

[0063] The third round of PCR reaction system was: 10 μL of the second round PCR product as template, 2 μL of 10× buffer, 3.6 μL of 2 μM Barcode, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot start Taq enzyme, 100 mM Mg 2+ 1 μL of ddH2O was added to the final volume of 20 μL. PCR reaction conditions: 95°C for 15 min; 94°C for 30 s, 60°C for 4 min, 72°C for 30 s, for a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, for a total of 40 cycles.

[0064] After amplification, the PCR product was subjected to electrophoresis detection on 3% agarose gel, 5ul of PCR product was loaded, and the electrophoresis bands were observed to see whether they were uniform and whether there were any mixed bands.

[0065] 3.3 Library pooling and purification

[0066] Take 5 μL of each PCR amplification product and transfer it to the same U-shaped trough for mixing. Take 200 ul of the mixture and transfer it to a round-bottom centrifuge tube. Vortex and shake for 30 seconds, then fix the centrifuge tube and shake it overnight on a shaker. Load the mixed library for electrophoresis, recover the gel block containing the target fragment after electrophoresis, and recover it with a purification kit. The recovered product is temporarily stored at 4°C.

[0067] 4. Genotyping and Analysis

[0068] Step 3.3 The purified product is subjected to second-generation sequencing genotyping (NGS, Next-generation sequencing) using the ILLumina X-10 sequencing platform. The sequencing results are used for image recognition, genotype typing, and statistics using Illumina RTA and Illumina bcl2fastq software. The genotyping of SNP loci related to the straight-line motility rate of fresh semen sperm in Fujian local rabbit breeds is shown in Figure 1 .

[0069] 5. Association Analysis between SNP Molecular Markers and the Straight-line Motility Rate of Fresh Semen Sperm in Fujian Local Rabbit Breeds

[0070] Variance analysis is performed using a trait-marker association analysis model to conduct an association analysis between each genotype of polymorphic loci and the straight-line motility rate of fresh semen sperm in Fujian local rabbit breeds.

[0071] The trait-marker association analysis model is: Y ijkl = μ + G i + B j + P k + e ijkl

[0072] Among them, Y ijkl is the trait observation value, μ is the mean value, G i is the genotype effect, B j is the breed effect, P k is the batch effect, and e ijkl is the random error. The analysis results are verified using Bonferrroni multiple comparisons, and the results are shown in Table 1.

[0073] Table 1 results show that the difference in the mean value of the straight-line motility rate of fresh semen sperm between individuals with the CC genotype and those with the GG genotype and CG genotype reaches an extremely significant level (P < 0.01). Furthermore, it is proven that the 77th base C or G from the 5'-end of the nucleotide sequence shown in SEQ ID No:1 is significantly correlated with the straight-line motility rate of fresh semen sperm in Fujian local rabbit breeds (P < 0.01), and it is an SNP marker related to the straight-line motility rate of fresh semen sperm in Fujian local rabbit breeds. The straight-line motility rate of fresh semen sperm in individuals with the CC genotype of this SNP marker is significantly lower than that in individuals with the GG genotype and CG genotype.

[0074] Table 1 Genotype Frequencies of SNP Loci and Association Analysis with the Straight-line Motility Rate of Fresh Semen Sperm in Rabbit Breeds

[0075]

[0076] Note: Different superscript lowercase letters indicate extremely significant differences (P<0.01)

[0077] The method for detecting the linear motility rate of sperm in fresh semen of Fujian local breed rabbits provided by the present invention, according to the embodiments of the present invention, the method determines the linear motility rate of sperm in fresh semen of Fujian local breed rabbits to be tested by detecting the SNP markers of the tested Fujian local breed rabbits. Specifically, the tested Fujian local breed rabbits can be PCR amplified and sequenced by a reagent that can be used to detect the SNP markers related to the linear motility rate of sperm in fresh semen of Fujian local breed rabbits of the present invention, such as the primer pair, so as to detect and determine the genotype of the above-mentioned SNP marker of the tested Fujian local breed rabbits, and then the linear motility rate of sperm in fresh semen of the tested Fujian local breed rabbits can be effectively determined based on the obtained genotype. Among them, as mentioned above, the linear motility rate of sperm in fresh semen of Fujian local breed rabbits with a genotype of homozygous CC at the SNP marker site is significantly lower than that of Fujian local breed rabbits with a genotype of homozygous GG and heterozygous CG here. For example, when the genotype of the site is CC, the tested Fujian local breed rabbits belong to individuals with low linear motility rate of sperm in fresh semen. Therefore, the method of the present invention for detecting the linear motility rate of sperm in fresh semen of Fujian local breed rabbits can quickly, efficiently and accurately detect the linear motility rate of sperm in fresh semen of Fujian local breed rabbits, and can then be effectively used for molecular marker-assisted selection of Fujian local breed rabbits, thereby assisting in the early selection of excellent individuals of Fujian local breed rabbits with high-quality semen in a short time, at low cost and with high accuracy.

[0078] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker related to the straight-line motility rate of sperm in fresh semen of Fujian local breed rabbits, characterized in that: The nucleotide sequence of the SNP molecular marker is as follows: 5'-CGGAGGACTTCTCAGAGGGGCGGCTCCGGGCTGCGCGGCTGGCGCTCGCGCAACTCCGCCGGGCACGCGGGGCGGAMGCTCTTGGGCCGGTCTGTCGCTGGAGGCCGCTCTGAGAGGGGCGCGGGT CCCGCTGGCCCGACGAGAGCCCGGGGCGGGGTTTGGGGGCTCGCGGAGCAAGGAGGCTTCCGGACCCCAGCCGAAGTTCGTGATGGGGGAGGGGGTGAGCGTGCCCCGGCACGGATGAAGTCATTG-3'; The 77th base from the 5' end in the nucleotide sequence of the SNP molecular marker is represented by M, where M represents C or G.

2. The SNP molecular marker according to claim 1, wherein: The M at the 77th base from the 5' end in the nucleotide sequence of the SNP molecular marker is correlated with the linear motility rate of sperm in fresh semen of Fujian local breed rabbits.

3. Application of the SNP molecular marker as claimed in claim 1 in molecular marker-assisted breeding of Fujian local rabbit breeds.

4. Application of the SNP molecular marker as claimed in claim 1 in the semen quality selection of Fujian local breed rabbits.

5. The application according to claim 3 or 4, characterized in that: The M at the 77th base from the 5' end in the nucleotide sequence of the SNP molecular marker is correlated with the linear motility rate of sperm in fresh semen of Fujian local breed rabbits; the linear motility rate of sperm in fresh semen of Fujian local breed rabbits with homozygous CC genotype at this site is significantly lower than that of Fujian local breed rabbits with homozygous GG and heterozygous CG genotypes at this site.

6. A primer pair for detecting the SNP molecular marker as described in claim 1, characterized in that: The nucleotide sequence of the primer pair is as follows: Upstream primer: 5'-CGGAGGACTTCTCAGAGGGG-3' Downstream primer: 5′-CAATGACTTCATCCGTGCCG-3′.

7. Use of the primer pair as claimed in claim 6 in molecular marker-assisted breeding of Fujian local rabbit breeds.

8. Application of the primer pair as claimed in claim 6 in the semen quality selection of Fujian local breed rabbits.

9. A method for identifying the straight-line motility rate of sperm in fresh semen of Fujian local breed rabbits using the primer pair according to claim 6, characterized in that: It includes the following methods: (1) Collecting genomic DNA from local meat rabbits in Fujian; (2) PCR amplification reaction: using the primers to perform three rounds of PCR amplification on the genomic DNA of the local Fujian rabbit breed to be tested, and collecting the amplified products; (3) Library mixing and purification: Transfer the PCR amplification products to the same U-shaped trough for mixing, transfer the mixture to a round-bottom centrifuge tube, vortex for 30 seconds, and then place the centrifuge tube on a fixed shaker for overnight shaking; load the mixed library onto electrophoresis, recover the gel containing the target fragment after electrophoresis, and recover it using a purification kit. The recovered product is temporarily stored at 4°C; (4) Genotyping and analysis: The purified product is subjected to second-generation sequencing genotyping (NGS, Next-generation sequencing) through the ILLumina X-10 sequencing platform; the sequencing results are used for image recognition, genotype typing and statistics using Illumina RTA and Illuminabcl2fastq software; (5) Association analysis The model for trait-marker association analysis is: Y ijkl = μ + G i + B j + P k + e ijkl , where Y ijkl is the trait observation value, μ is the mean, G i is the genotype effect, B j is the cultivar effect, P k is the batch effect, and e ijkl is the random error; the analysis results were verified by Bonferroni multiple comparisons.

10. The method according to claim 9, characterized in that: In the said step (2), The reaction system for the first-round PCR is as follows: 1 μL of 10× buffer, 1 μL each of 50 nM upstream and downstream primers, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot-start Taq enzyme, 2 μL of template DNA, 2+ 1 μL, and ddH2O is added to make up the final volume to 10 μL; The reaction conditions for the first round of PCR: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, a total of 20 cycles; The reaction system for the second-round PCR is as follows: 3 μL of the first-round PCR product, 1 μL of 10× buffer, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot-start Taq enzyme, 1 μL of 2+ 2+ ddH2O is added to make up the final volume to 10 μL; The reaction conditions for the second round of PCR: 95°C for 15 min; 94°C for 30 s, 60°C for 10 min, 72°C for 30 s, a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, a total of 40 cycles; The reaction system for the third-round PCR is as follows: Using 10 μL of the second-round PCR product as a template, 2 μL of 10× buffer, 3.6 μL of 2 μM Barcode, 0.8 μL of 2.5 mM dNTP, 0.5 U of hot-start Taq enzyme, and 1 μL of 2+ ddH2O is added to make the final volume up to 20 μL; The reaction conditions for the third round of PCR: 95°C for 15 min; 94°C for 30 s, 60°C for 4 min, 72°C for 30 s, a total of 4 cycles; 94°C for 30 s, 60°C for 1 min, 72°C for 30 s, a total of 40 cycles.

Images