A snp molecular marker related to a major quantitative trait locus of the epididymal weight of hu sheep and application thereof
By screening SNP molecular markers on chromosome 9 of Hu sheep through genome-wide association studies, the problem of lack of genetic markers related to epididymal weight in Hu sheep was solved, enabling early selection of Hu sheep individuals with superior epididymal weight traits and improving the breeding efficiency of Hu sheep reproductive capacity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2026-03-24
AI Technical Summary
The lack of effective molecular markers in existing technologies for screening genetic markers related to epididymal weight in Hu sheep leads to a decline in the fertility of Hu sheep, making it difficult to improve the fertility of rams through molecular marker-assisted selection.
Genome-wide association study (GWAS) was used to screen for SNP molecular markers located on chromosome 9 of Hu sheep. The polymorphic bases were C/T, located in the intergenic region between PPDPF and SNTG1 genes. Correlation analysis was performed using a univariate linear mixture model, and a detection kit was designed to detect the genotype of Hu sheep individuals.
It provides more precise genetic markers for the localization and analysis of epididymal weight in Hu sheep, enabling early selection of Hu sheep individuals with superior epididymal weight traits, improving breeding efficiency and genetic level, and meeting market demand.
Smart Images

Figure CN120350139B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic breeding and molecular biology, specifically relating to a SNP molecular marker related to the major quantitative trait locus (QTL) of epididymal weight in Hu sheep and its application. Background Technology
[0002] The Hu sheep is a unique sheep breed in China, characterized by its year-round estrus cycle, early sexual maturity, high litter size, and rapid growth. It is widely distributed throughout the country. However, in recent years, the phenomenon of prioritizing importation over breeding has become increasingly prominent, leading to mixed Hu sheep breeds, loss of superior genes, and a decline in reproductive performance, severely hindering the sustainable development of the Hu sheep industry.
[0003] Reproductive capacity is one of the most important economic traits in livestock production. Improving livestock reproductive capacity can not only reduce livestock production costs and increase economic efficiency, but also accelerate the livestock breeding process, promote the development of new breeds, and improve livestock quality. In a modern sheep production system, increasing the utilization rate and coverage of superior breeding rams can rapidly improve the reproductive efficiency, production capacity, and genetic improvement speed of the flock, while reducing disease risks and maximizing the benefits of sheep farming. There are many indicators for evaluating male reproductive capacity, the most common being ejaculation volume and semen quality, such as fresh semen motility, post-freezing motility, sperm density, and sperm abnormality rate. However, due to the complexity and low repeatability of semen quality assessment, and the fact that most semen quality traits are low-heritability traits and easily affected by factors such as age, temperature, nutritional level, and season, it is difficult to objectively and accurately evaluate them. The epididymis is one of the important organs in the male reproductive system, responsible for sperm maturation and storage. It consists of a long, curved tubule, including four anatomical regions: the initial segment, head, body, and tail. Immature sperm produced in the testes must be transported through the epididymis to become motile and fertilization-capable mature sperm. Studies have shown that highly fertile rams produce more sperm, which are then transported to the epididymal tail via the epididymal duct for storage. This results in a larger epididymal duct diameter, increased sperm count in the epididymal tail, and a corresponding increase in epididymal weight. Furthermore, individuals with heavier epididymal weights have higher levels of n-3 polyunsaturated fatty acids, lower levels of reactive oxygen species, and stronger antioxidant capacity in the epididymal tail. Therefore, screening for molecular markers associated with epididymal weight in rams and applying molecular marker-assisted selection (MAS) can rapidly improve ram fertility.
[0004] Compared with traditional breeding methods, MAS can effectively improve the accuracy of selection for complex economic traits, reduce breeding costs, and increase breeding efficiency. However, the number of candidate genes and molecular markers reported so far related to epididymal weight in livestock is very limited. Screening SNPs and candidate genes that are significantly associated with epididymal weight, and developing molecular markers for selection-aided breeding and design breeding, will accelerate the process and improve the precision of breeding high-breeding Hu sheep. Genome-wide association study (GWAS) is a research method that uses gene chips or high-throughput genotyping technology to perform genome-wide genotyping of a population, and uses statistical methods to associate the phenotype of complex traits with the genotype of each genetic variation, thereby identifying genetic variations that are significantly associated with the phenotype. In recent years, GWAS has become the mainstream method internationally for screening genetic markers that are significantly associated with complex traits, providing strong support for elucidating the genetic mechanisms of complex traits and precision breeding. Currently, researchers have conducted GWAS on various important economic traits in sheep, identifying molecular markers and candidate genes related to traits such as coat color, growth and development, reproduction, and disease. However, research on genetic markers and candidate genes related to epididymal weight in Hu sheep is lacking. Summary of the Invention
[0005] Given the difficulty in assessing semen quality in male livestock and its susceptibility to multiple factors, and considering that epididymal weight is related to ram fertility, the current technology for candidate genes and molecular markers related to epididymal weight in livestock is limited. This invention aims to provide a SNP molecular marker related to a major quantitative trait locus of epididymal weight in Hu sheep and its application.
[0006] To achieve the above objectives, the present invention employs the following technical solution:
[0007] This invention provides a SNP molecular marker associated with a major quantitative trait locus of epididymal weight in Hu sheep. The SNP molecular marker is located on chromosome 9 of Hu sheep, originating from the intergenic region of the PPDPF and SNTG1 genes, and has a polymorphic base of C / T.
[0008] The SNP molecular marker is located at position 151 bp in the nucleotide sequence shown in SEQ ID NO.1.
[0009] A method for screening SNP molecular markers associated with major quantitative trait loci of epididymal weight in Hu sheep includes:
[0010] (1) Collect molecular samples of testes and epididymis from Hu sheep, measure and record traits related to the main effect QTL of testicular weight in Hu sheep;
[0011] (2) Steps for collecting blood from the jugular vein (1) DNA from the sample;
[0012] (3) Based on the DNA extracted in step (2), construct a library, and perform library quality testing and sequencing;
[0013] (4) Mutation detection and SNP site screening;
[0014] (5) Genome-wide association analysis was performed to screen for significant associated sites, perform functional annotation, and obtain SNP molecular markers associated with major quantitative trait sites of epididymal weight in Hu sheep.
[0015] The method involves screening for significantly associated loci based on genome-wide association analysis and using a univariate linear mixture model to analyze the correlation between SNP loci and phenotypes.
[0016] The formula for the univariate linear mixed model is: y = Wα + xβ + g + e, where y is the individual phenotypic value, W is the fixed effects matrix, α is the fixed effects vector, x is the genotype of the SNP, β is the effect value of the additive effect of the SNP, g is the random effect, and e is the random residual.
[0017] The application of SNP molecular markers related to the major quantitative trait loci of epididymal weight in Hu sheep in molecular marker-assisted breeding of Hu sheep.
[0018] The application of SNP molecular markers related to the major quantitative trait loci of epididymal weight in Hu sheep in assisted selection breeding of total epididymal weight.
[0019] The application of SNP molecular markers related to the major quantitative trait site of epididymal weight in Hu sheep in the preparation of detection kits.
[0020] The detection kit includes primers designed using the nucleotide sequences flanking the SNP molecular marker locus associated with the major quantitative trait locus of epididymal weight in Hu sheep, and reagents for detecting the genotype of the SNP molecular marker in individual Hu sheep.
[0021] A method for detecting the genotype of Hu sheep involves designing primers based on the nucleotide sequences flanking the SNP molecular marker locus associated with the major quantitative trait locus (QTL) of epididymal weight in Hu sheep. Blood is collected from male Hu sheep lambs after birth, and genomic DNA is extracted. The primers are then used to perform genotyping on the Hu sheep material to determine the genotype of the Hu sheep at the SNP locus.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] The SNP molecular markers associated with major quantitative trait loci (QTLs) of epididymal weight provided by this invention offer important genetic markers for genetic research and molecular breeding of epididymal weight in Hu sheep. They help to more accurately locate and analyze the relationship between the markers and epididymal weight in Hu sheep, and also provide more precise targets for subsequent gene editing and breeding operations.
[0024] The present invention provides a method for screening SNP molecular markers related to major quantitative trait loci (QTLs) of epididymal weight in Hu sheep. This method provides an effective tool for discovering new genetic markers. The method includes steps such as sample collection, DNA extraction, library construction, whole genome resequencing, variant detection, SNP site screening, genome-wide association analysis, and functional annotation. It can systematically screen SNP molecular markers related to epididymal weight in Hu sheep.
[0025] The application of SNP molecular markers provided by this invention, through the application of a specific SNP molecular marker (located at position 33127527 on chromosome 9 of Hu sheep, with a polymorphic base of C / T), allows for earlier selection, which can more effectively screen Hu sheep individuals with excellent epididymal weight traits, accelerate the breeding process, and improve breeding efficiency. Using this marker for assisted selection of total epididymal weight can more effectively improve the genetic level of total epididymal weight in Hu sheep, meeting market demand. Furthermore, applying the SNP molecular marker to the preparation of detection kits provides a rapid and accurate method for the genetic detection of epididymal weight in Hu sheep.
[0026] This invention proposes a method for detecting the genotype of Hu sheep. This method, based on SNP molecular markers, provides an effective tool for genetic research and breeding of Hu sheep. It can accurately determine the genotype of Hu sheep at SNP loci, providing basic data for subsequent genetic analysis and breeding operations. Attached Figure Description
[0027] Figure 1 Linkage disequilibrium analysis of candidate SNPs within the major QTL interval related to epididymal weight in this invention;
[0028] Figure 2 This invention compares the differences in epididymal weight among different genotypes of the SNP molecular marker rs419414147. Detailed Implementation
[0029] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0030] Definition Explanation
[0031] Linkage disequilibrium (LD): refers to the phenomenon where alleles of two or more loci in the genome co-occur in a population at a frequency higher than that of random combinations.
[0032] Gene annotation refers to the process of identifying, locating, and functionally describing genes and their related functional elements within a genome sequence. Its core objective is to elucidate the biological significance of the genome sequence, providing fundamental data for subsequent genetic research, functional genomics analysis, and molecular breeding.
[0033] ANNOVAR: A gene annotation tool for variant annotation and functional prediction, capable of integrating multiple databases for gene annotation.
[0034] Quantitative trait loci (QTLs) are chromosomal regions in the genome that are significantly associated with quantitative trait variation and typically contain one or more genes (or regulatory elements) that affect that trait.
[0035] Quantitative traits: These are complex traits influenced by multiple genes and environmental factors, such as crop yield, livestock weight, and human height or blood pressure. These traits are continuously distributed in a population and cannot be easily classified.
[0036] The present invention will now be described in further detail with reference to the accompanying drawings:
[0037] Example 1
[0038] This invention provides a SNP molecular marker associated with a major quantitative trait (QTL) locus related to epididymal weight in Hu sheep. The screening method specifically includes the following steps:
[0039] 1. Selection and management of experimental animals
[0040] Between 2018 and 2022, this study selected 3028 male Hu sheep lambs from eight large-scale Hu sheep farms in nine batches as experimental animals. All experimental animals were weaned and underwent standardized disease immunization at 56±8.4 days of age, and then transported to Minqin Defu Agricultural Technology Co., Ltd. (Minqin, China; Meat Sheep Performance Testing Center, Lanzhou University). Each lamb was transferred to a fattening pen (0.8m × 1.0m) for individual rearing. All batches of sheep were fed under the same nutritional and feeding management conditions. The nutrient ratio was formulated according to the NRC (2007) standard for fattening sheep nutritional requirements, and prepared as a total mixed ration (TMR) pelleted feed.
[0041] 2. Trait determination and sample collection
[0042] At 180 days of age, the sheep were slaughtered according to the sheep slaughter operating procedures. After slaughter, the testicular and epididymal tissues of each individual were rapidly dissected and separated. The left epididymal weight (LEW) and right epididymal weight (REW) were weighed using a thousandth-place single-pan balance, and the total epididymal weight (TEW) was calculated. Stunted sheep, as well as those with cryptorchidism or testicular inflammation in the experimental population, were excluded. Then, outliers in the phenotypic data of each batch were excluded by drawing box plots. Descriptive statistics of the epididymal weight data were performed using SPSS Statistics 25.0, and the results are shown in Table 1.
[0043] Table 1: Descriptive statistics of epididymal weight
[0044]
[0045] 3. Genomic DNA extraction and sequencing
[0046] (1) Sample collection and DNA extraction
[0047] Before slaughtering all sheep at 180 days of age, approximately 5 mL of jugular venous blood samples were collected using vacuum blood collection tubes containing EDTA anticoagulant. The blood collection tubes were inverted to thoroughly mix the anticoagulant with the blood, and then stored in a -20 °C refrigerator for subsequent genomic DNA extraction. According to the steps for extracting blood genomic DNA in the Blood Genomic DNA Kit, the blood genomic DNA was extracted.
[0048] (2) DNA quality detection
[0049] The integrity and concentration of the extracted DNA were detected using 1% agarose gel and a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), respectively. The NanoDrop OD 260 / 280 value of the DNA sample was between 1.8 and 2.0, and the concentration was greater than 50 ng / μL for qualified quality inspection.
[0050] (3) Library construction
[0051] The construction of DNA libraries and genome resequencing were completed by Novogene Co., Ltd. in Beijing. The DNA library construction process includes DNA fragmentation, end repair, addition of A tails, adapter ligation, and PCR enrichment.
[0052] (4) Library quality detection
[0053] The concentration and insert fragment size of the constructed libraries were detected using Qubit2.0 and Agilent 2100, respectively. Quantitative polymerase chain reaction (Q-PCR) was used to accurately quantify the effective concentration of the libraries.
[0054] (5) Sequencing and Data Processing
[0055] Whole-genome resequencing was performed on quality-controlled libraries using the Illumina NovaSeq 6000 sequencing platform using a 150bp paired-end (PE150) sequencing strategy. The raw sequencing data were quality-controlled using Trimmomatic software, which removed adapter sequences from the Illumina library construction, reads containing more than 10% unknown bases, reads containing more than 40% low-quality bases (base quality value <15), and potential PCR repetitive sequences.
[0056] 4. Mutation detection and SNP site screening
[0057] (1) Cleanreads are aligned to the reference genome.
[0058] The quality-controlled clean reads were aligned to the sheep reference genome (ARS-UI Ramb v2.0, GCA 016772045.1) using the Burrows-WheelerAlignment-Maximal ExactMatch (BWA-MEM) algorithm.
[0059] (2) Sort and remove duplicates from BAM files
[0060] Use SAMtools (v 1.10) and PicardTools (http: / / broadinstitute.github.io / picard) to sort and remove duplicates from the BAM files.
[0061] (3) Mutation detection
[0062] The variation detection was performed using GATK (v 4.1.8) software, specifically including the following steps: ① Use HaplotypeCaller to generate a gVCF file for each sample; ② Use the CombineGVCFs module to merge multiple GVCF files into a large GVCF file; ③ Use the GenotypeGVCFs module to perform joint genotyping analysis on the merged GVCF file and output the final VCF file.
[0063] (4) Mutant hard filtering
[0064] The identified variant set was hard-filtered using bcftools (v 1.18) software, with the following parameters: INFO / DP. <10311|INFO / DP>92802|QD<2.0|QUAL<30.0|MQ<40.0|FS>60.0|ReadPosRankSum<-8.0|MQRankSum<-12.5|SOR>3.0. A total of 51,750,417 SNP sites were obtained after hard filtering.
[0065] (5) Further filtering of SNP sites
[0066] Low-quality SNP loci with a SNP call rate <80% and a minimum allele frequency (MAF) <0.05 were filtered out using PLINK software. A total of 23,168,716 high-quality autosomal SNP loci were retained for subsequent analysis.
[0067] 5. Genome-wide association analysis
[0068] (1) Prune the autosomal SNPs obtained from quality control to obtain independent SNP loci.
[0069] Linkage disequilibrium (LD) pruning was performed on the SNPs obtained from quality control using the `--indep-pairwise 1000500.2` function in PLINK, resulting in 521,215 independent SNP loci. The significance threshold at the genomic level was determined to be 9.59e-08 (0.05 / 521215) using the Bonferroni correction method, with a suggestive threshold set at 1e-06. Principal component analysis (PCA) was performed using PLINK software.
[0070] (2) Univariate linear mixture model analysis was performed using GCTA software to screen for significantly associated SNP sites.
[0071] GWAS analysis was performed using the fastGWA method in GCTA software. This method utilizes sparse GRMs to accelerate computation and is a fast GWAS method based on a linear mixed model (LMM). Its basic formula is: y = Wα + xβ + g + e, where y is the individual phenotypic value, W is the fixed effects matrix, α is the fixed effects vector, x is the SNP genotype, β is the effect value of the SNP additive effect, g is the random effect, and e is the random residual. The GRMs calculated for all SNP loci were used as independent variables; the field-year-season effects of the experimental animals were integrated into batch fixed effects (9 batches in total); the first three principal components of the PCA were added as covariates to the GWAS model to minimize the influence of population stratification. Furthermore, to eliminate the bias caused by pre-slaughter live weight, pre-slaughter live weight was added as a numerical covariate to the GWAS model.
[0072] (3) Linkage disequilibrium analysis and gene annotation
[0073] LD analysis was performed on the identified significant SNPs using HaploView software. Gene annotation of significant SNP loci obtained from GWAS was performed using ANNOVAR. The sheep reference genome version used was ARS-UI Ramb v2.0 (GCA016772045.1). GWAS results showed that the signal strongly associated with epididymal weight was located in a 235.92 kb region on Chr9:33,001,025-33,236,946. This major-effect QTL contained 8 significant SNP loci, all located in the intergenic regions of the PPDPFL and SNTG1 candidate genes. Haplotype analysis showed that among the 8 candidate SNPs, 2 constituted 1 LD block (epididymal weight block). Figure 1 ) 9_33127527 was selected from the LD block as a SNP molecular marker closely linked to the QTL, and its details are shown in Table 2.
[0074] Table 2: Detailed information on SNP molecular markers
[0075]
[0076] The 150bp base sequence before and after the SNP molecular marker is shown in SEQ: NC_056062.1|:33127377-33127677Ovis aries strain OAR_USU_Benz2616 breed Rambouillet chromosome 9,ARS-UI_Ramb_v3.0,whole genome shotgun sequence
[0077] CTTAAAAGTAGCCAGCTTAAAATCACTCTGCGTCTAGCACAAAAGAACTGTACAAAAAAGATCTTGATGACCCAGATAATCGTGATGGTGTGATCACTCACCTAGAGCCAGACATCCTGGAATGTGAAGTCAAGTGGGCCTGAATTCCAG[C / T]TGAGCTCTTTCAAATCCTGAAAGATGATGCTGTGAAAGTGCTGCA CTCAACATGCCAGCAAATTTGGAATACTCACCAGTGGCCACAGGACTGGA AAAGGTCAGGTTTCATTCCAGTCCCAAAGAAAGGCAATGCTAAAGAATGC TCAAA (as shown in SEQ ID NO.1)
[0078] (4) Verification of the association between SNP sites and phenotype
[0079] Genotyping results at 33,127,527 bp on chromosome 9 were extracted from all sequenced individuals using PLINK software. The non-parametric Kruskal-Wallis test was used to analyze the differences in epididymal weight among different genotypes of rs419414147; P < 0.05 was considered statistically significant. See attached results. Figure 2 As shown in Table 3.
[0080] Table 3: Associations between different SNP genotypes and TEW, LEW, and REW
[0081]
[0082] The above results indicate that SNP molecular markers significantly affect epididymal weight, with the TEW (36.66 g) of individuals with the CC genotype being significantly lower than that of individuals with the TC (40.42 g) and TT genotypes (42.52 g) (P < 0.01). Figure 2 This indicates a significant correlation between rs419414147C>T and epididymal weight, with individuals carrying the T allele exhibiting greater epididymal weight. Therefore, in Hu sheep breeding, primers can be designed on the nucleotide sequences flanking the aforementioned SNP molecular markers. Blood samples can be collected from male Hu sheep lambs after birth, and genomic DNA can be extracted. These primers can then be used to genotype the lambs to determine if they carry the T allele. Selecting individuals with the T allele allows for early selection of rams with high fertility.
[0083] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.
Claims
1. The application of a reagent for detecting SNP molecular markers associated with major quantitative trait loci of epididymal weight in Hu sheep in assisted selection breeding of total epididymal weight, characterized in that... The SNP molecular marker is located in the intergenic region of the PPDPF and SNTG1 genes on chromosome 9 of Hu sheep, at position 151 bp in the nucleotide sequence shown in SEQ ID NO.1, where the 151st base is C or T, and the total epididymal weight of the CC genotype is significantly lower than that of the TC and TT genotypes.
2. The application of primers for detecting SNP molecular markers associated with major quantitative trait loci related to epididymal weight in Hu sheep in the preparation of a detection kit, characterized in that, The SNP molecular marker is located in the intergenic region of the PPDPF and SNTG1 genes on chromosome 9 of Hu sheep, at position 151 bp in the nucleotide sequence shown in SEQ ID NO.1, where the 151st base is C or T, and the total epididymal weight of the CC genotype is significantly lower than that of the TC and TT genotypes.
3. A method for breeding Hu sheep, characterized in that, Primers were designed based on the nucleotide sequences flanking the SNP molecular marker. Blood was collected from male lambs of the target Hu sheep after birth, and genomic DNA was extracted. The primers were used to perform genotyping on the target Hu sheep material to determine the genotype. Individuals with the T allele were selected. The breeding trait was total epididymal weight. The SNP molecular marker is located in the intergenic region of the PPDPF and SNTG1 genes on chromosome 9 of Hu sheep, at position 151 bp in the nucleotide sequence shown in SEQ ID NO.1, where the 151st base is C or T, and the total epididymal weight of the CC genotype is significantly lower than that of the TC and TT genotypes.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to Hu sheep testis size character as well as screening method and application of SNP molecular marker
CN119410794A
Sheep single nucleotide polymorphism (SNP) molecular marker and use thereof in detecting resistance to brucellosis in sheep
US20250122583A1