Molecular marker related to wheat harvest index and application thereof
By locating linked segments of the 4D chromosome in wheat and developing KASP markers, the problem of low efficiency in improving wheat harvest index and thousand-grain weight in traditional breeding methods has been solved, realizing efficient and precise molecular marker-assisted breeding and improving breeding efficiency and yield improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-08
AI Technical Summary
Traditional breeding methods are difficult to improve wheat harvest index and thousand-grain weight efficiently and accurately. Existing technologies are time-consuming, costly and inefficient, and are difficult to effectively aggregate micro-effect genes.
A linkage segment on chromosome 4D containing two significantly associated SNP sites was located in wheat through genome-wide association analysis. KASP markers were developed for rapid screening of materials with high harvest index and thousand-grain weight, and molecular marker-assisted breeding was carried out using competitive allele-specific PCR.
It enables early and precise molecular marker-assisted selection, improves wheat breeding efficiency, simplifies the breeding process of high-yield new varieties, reduces costs, and simultaneously improves multiple yield factors.
Smart Images

Figure CN121992141A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker related to wheat harvest index and its application. Background Technology
[0002] wheat( Triticum aestivum Wheat (L.) is one of the world's most important staple crops, playing an irreplaceable role in ensuring food security and maintaining social stability. Wheat yield is directly related to a country's self-sufficiency rate in staple food and the stability of the global food market. The harvest index (the ratio of grain yield to total biomass above ground) is a key indicator for measuring the efficiency of converting photosynthetic products into economic yield, and its improvement is the core genetic basis for the yield leap achieved by modern semi-dwarf varieties. Among the yield components, thousand-grain weight is a direct factor determining grain storage capacity and plumpness, and its stability is crucial to the final yield.
[0003] However, wheat harvest index, as a typical complex quantitative trait, is controlled by multiple genes and is significantly affected by environmental conditions, exhibiting complex genetic patterns. Traditional breeding methods often rely on indirect selection using field phenotypic data, which is not only time-consuming and costly but also inefficient, making it difficult to effectively aggregate minor genes. To address this challenge, modern molecular breeding methods have been widely introduced, providing new insights for the precise improvement of wheat harvest index.
[0004] Molecular marker technology provides a powerful tool for the research and application of quantitative traits. Among the many marker types, KASP technology is widely used due to its sensitivity, stability, and low cost. KASP relies on allele-specific amplification and fluorescence signal determination to achieve accurate typing of target single nucleotide polymorphisms, making it particularly suitable for rapid screening of large-scale populations.
[0005] Meanwhile, genome-wide association studies (GWAS) are crucial in elucidating the genetic mechanisms of wheat harvest index. By integrating high-density genotypic and multi-environmental phenotypic data from 406 natural populations, we successfully identified a candidate linkage segment significantly associated with harvest index. Further pleiotropic analysis revealed that this linkage segment, while primarily regulating harvest index, also exhibits a synergistic effect on thousand-grain weight. Molecular markers developed targeting this segment can be used for the selection of high harvest index.
[0006] In summary, developing functional KASP markers based on harvest index-related GWAS loci enables early and precise selection for this complex trait at the genotypic level. This not only helps accelerate the breeding of high-yielding wheat varieties but also provides an efficient and feasible breeding strategy for synergistically improving multiple yield factors by utilizing genetic associations between traits. Summary of the Invention
[0007] The first objective of this invention is to provide a quantitative trait locus (QTL) located on wheat chromosome 4D that controls the harvest index and thousand-grain weight, and its molecular marker.
[0008] A second objective of this invention is to provide the application of the molecular marker in the breeding of high-harvest-index wheat varieties.
[0009] To achieve the above objectives, the present invention adopts the following technical solution: This invention discloses a linkage segment associated with high wheat harvest index. The inventors used data from 11 environments (2019-2023 sown and late-sown in Yangling, Shaanxi; 2018 sown in Chongzhou, Sichuan) encompassing 406 wheat natural populations. These data included effective tiller number (PTN), grains per spike (KNS), 1000-grain weight (TKW), plant height (PH), and total tiller number (TTN). The wheat harvest index (HI) was calculated using the formula: (PTN × KNS × TKW / 1000) / (PH × TTN) * 100 (%). Genome-wide association analysis identified a linkage segment in wheat ranging from 21.0 Mb to 22.0 Mb. This linkage segment contains two SNPs significantly associated with the harvest index: Ta _Chr4D_22018842: TGGTGGATAATATTTATAAGATTACTGAATTTGAGACGTGGTGGCAGAGATGGAAGAGGT[C / G]AGGAAGAACAAGAAGTGGATGTGCCCTCACTGCGTTGAGGAGACGGGTACCAAGAAATTC. (As shown in SEQ ID NO.1, the SNP site in bold and square brackets is Chr4D_22018842 (C / G). There is a C / G base mutation at position 61.)
[0010] Ta _Chr4D_21035056: TTGAGCATCGCGCACGACCGGCTGCACGGCGGCGGCGGCAGCTTGGCCGCGCACGCGGAG[C / A]CCCCAGCGAGCAGGAGGAGCACGACCAAGACCGAAACCCTAGCAAGACATAACTGAAGGG. (As shown in SEQ ID NO.2, the SNP site Chr4D_21035056 (C / A) is in bold and within square brackets). A C / A base mutation exists at position 61.
[0011] This candidate segment mainly contains two haplotypes, as shown in SEQ ID NO.1, when Ta _Chr4D_22018842 is characterized by a C base (CC genotype, hereinafter also referred to as the 0 / 0 genotype), as shown in SEQ ID NO.2, and when Ta _Chr4D_21035056 also exhibits a C base (CC genotype, hereinafter also referred to as the 0 / 0 genotype). When the main haplotype of this segment is CC (hereinafter also referred to as Hap A), wheat exhibits a lower harvest index; as shown in SEQ ID NO.1, when Ta _Chr4D_22018842 exhibits a G base (GG genotype, hereinafter also referred to as the 1 / 1 genotype), as shown in SEQ ID NO.2, and when Ta _Chr4D_21035056 also shows an A base (AA genotype, hereinafter referred to as 1 / 1 genotype). When the main haplotype in this segment is GA (hereinafter referred to as Hap A), wheat shows a higher harvest index.
[0012] The third objective of this invention is to disclose the role of the aforementioned candidate QTL in thousand-grain weight. By using the linkage segments located above and combining them with the agronomic traits of 406 wheat samples for pleiotropic analysis, it was found that the QTL also has a significant effect on grain weight. As shown in SEQ ID NO.1, when Ta_Chr4D_22018842 exhibits a C base (CC genotype, hereinafter referred to as 0 / 0 genotype), as shown in SEQ ID NO.2, and when Ta_Chr4D_21035056 also exhibits a C base (CC genotype, hereinafter referred to as 0 / 0 genotype), and the main haplotype of this segment is CC (hereinafter referred to as Hap A), wheat exhibits a lower thousand-grain weight; as shown in SEQ ID NO.1, when Ta_Chr4D_22018842 exhibits a G base (GG genotype, hereinafter referred to as 1 / 1 genotype), as shown in SEQ ID NO.2, and when Ta_Chr4D_21035056 also exhibits an A base (AA genotype, hereinafter referred to as 1 / 1 genotype), and the main haplotype of this segment is GA (hereinafter referred to as Hap A), wheat exhibits a higher thousand-grain weight.
[0013] A fourth objective of this invention is to provide a molecular marker that is significantly correlated with the wheat harvest index.
[0014] The fifth objective of this invention is to provide the application of the aforementioned molecular markers related to the wheat harvest index.
[0015] We selected Ta_Chr4D_22018842 as the target site for developing diagnostic markers. Functional markers were located in linkage regions identified in genome-wide association studies. Ta The _Chr4D_22018842 SNP is located at position 22018842 on chromosome 4D of the wheat reference genome IWGSCRefSeq CSv1.0. This site contains a C / G base mutation, and the nucleotide sequence of this SNP is shown in SEQ ID NO.1. When the base at this site is C (CC genotype, hereinafter referred to as the 0 / 0 genotype), the wheat harvest index is low. When the base at this site is G (GG genotype, hereinafter referred to as the 1 / 1 genotype), the wheat harvest index is high. There is also a heterozygous case, the CG genotype, also known as the 0 / 1 genotype, whose harvest index is close to that of the 0 / 0 genotype. Population validation results show that the harvest index and grain weight of wheat with genotype 1 / 1 are significantly higher than those of wheat with genotype 0 / 0, with a highly significant difference.
[0016] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a C / G base mutation exists at position 61 of the sequence shown in SEQ ID NO.1.
[0017] Based on this SNP site, a primer set for the KASP marker was designed to amplify the KASP marker associated with the wheat harvest index. The primer pair sequences for the molecular marker are as follows: Ta _Chr4D_22018842-F1: GAAGGTGACCAAGTTCATGCTTGGCAGAGATGGAAGAGGTC; (shown in SEQID NO.3).
[0018] Ta _Chr4D_22018842-F2: GAAGGTCGGAGTCAACGGATTTGGCAGAGATGGAAGAGGTG; (shown in SEQ ID NO.4).
[0019] Ta _Chr4D_22018842-R: gtgagggcacatccacttct. (Shown in SEQ ID NO.5).
[0020] Two forward primers are used to connect different fluorescent adapter sequences; forward primers Ta The 5' end of _Chr4D_22018842-F1 is linked to a FAM fluorescent adapter sequence; forward primer. TaThe 5' end of _Chr4D_22018842-F2 is connected to a VIC fluorescent linker sequence; the FAM and VIC fluorescent linker sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.6); VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.7).
[0021] This invention also discloses the application of the primer set of the aforementioned molecular markers in marker-assisted breeding related to wheat harvest index. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to identify the harvest index of wheat materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using competitive allele-specific PCR, specifically using the aforementioned primer set of molecular markers.
[0022] This invention also discloses the application of the primer set of the above-mentioned molecular markers in identifying the wheat harvest index. Specifically, the specific steps for identifying the wheat harvest index are as follows: Using the DNA of the tested wheat germplasm as a template for competitive allele-specific PCR amplification, and employing the aforementioned molecular markers... Ta PCR amplification was performed using the primer pair corresponding to _Chr4D_22018842. The upstream primer F1, upstream primer F2, and downstream primer R were mixed in a 2:2:5 ratio to form a primer mix. The reaction system configuration for competitive allele-specific PCR amplification is shown in Table 1, and the PCR reaction procedure is shown in Table 2. Table 1. Reaction system ratios for PCR amplification
[0023]
[0024] Using primer sets Ta _Chr4D_22018842-F1、 Ta _Chr4D_22018842-F2、 Ta Competitive allele-specific PCR amplification was performed using _Chr4D_22018842-R. If the PCR product of the sample only detected primers ligated with fluorescent adapter sequences... TaIf the FAM fluorescence signal corresponding to _Chr4D_22018842-F1 is detected, the detection site is a 0 / 0 genotype, which is determined to be a homozygous type with a low harvest index phenotype. If only the VIC fluorescence signal corresponding to primer Ta_Chr4D_22018842-F2 with fluorescent adapter sequence is detected in the PCR product of the sample, the detection site is a 1 / 1 genotype, which is determined to be a homozygous type with a high harvest index phenotype. If both FAM and VIC fluorescence signals corresponding to primers Ta_Chr4D_22018842-F1 and Ta_Chr4D_22018842-F2 with fluorescent adapter sequence are detected simultaneously, the detection site is a 0 / 1 genotype (corresponding to the AG genotype), which is determined to be a heterozygous type with a low harvest index phenotype.
[0025] In addition, this invention also protects a kit for identifying the wheat harvest index, the kit containing primer sets Ta_Chr4D_22018842-F1, Ta_Chr4D_22018842-F2, and Ta_Chr4D_22018842-R. Other components of the kit are conventional reagents. Specifically, it also includes a 2×KASP Master Mix. This invention imposes specific restrictions on the concentration of the primer sets; a concentration of 10 μM can be used. The source of the 2×KASP Master Mix described in this invention is not particularly required.
[0026] The kit of this invention can rapidly identify the wheat harvest index content and the wheat harvest index genotype. The specific method follows the steps for identifying the wheat harvest index. Analysis of the quantitative real-time PCR amplification results reveals the following: If the PCR product only detects the FAM fluorescence signal corresponding to primer Ta_Chr4D_22018842-F1 with the fluorescent adapter sequence, the detection site indicates a 0 / 0 genotype, classifying it as a homozygous type with a low harvest index. If the PCR product only detects the VIC fluorescence signal corresponding to primer Ta_Chr4D_22018842-F2 with the fluorescent adapter sequence, the detection site indicates a 1 / 1 genotype, classifying it as a homozygous type with a high harvest index. If both FAM and VIC fluorescence signals corresponding to primers Ta_Chr4D_22018842-F1 and Ta_Chr4D_22018842-F2 with the fluorescent adapter sequence are detected simultaneously, the detection site indicates a 0 / 1 genotype, classifying it as a heterozygous type with a low harvest index.
[0027] The present invention has the following advantages: (1) The inventors of this invention, through genome-wide association analysis of wheat harvest index, located a linkage segment in wheat, a linkage segment of 21.0 Mb to 22.0 Mb, which contains two major haplotypes, Hap B, which has a higher harvest index and thousand-grain weight.
[0028] (2) The linkage segment contains a functional SNP site named Ta_Chr4D_22018842. This molecular marker is located on chromosome 4D of the wheat reference genome. Using the molecular marker Ta_Chr4D_22018842 of the present invention, the wheat harvest index can be quickly identified.
[0029] (3) Using markers linked to the wheat harvest index for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0030] (4) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification related to crude oil content in wheat. Attached Figure Description
[0031] Figure 1 QTL mapping results and linkage intervals for the wheat harvest index in genome-wide association analysis.
[0032] Figure 2 This is a box plot of the harvest index and a bar chart of the thousand-grain weight distribution corresponding to different haplotypes in the linkage interval of a natural wheat population in Embodiment 1 of the present invention. HapA, i.e., the CC genotype in QHI-4D.2, has a low harvest index and a thousand-grain weight, while Hap B, i.e., the GA genotype in QHI-4D.2, has a high harvest index and a thousand-grain weight. The dots represent the data distribution, and ** represents P<0.01.
[0033] Figure 3 This is a bar chart showing the distribution of harvest index for the genotype at the Ta_Chr4D_22018842 locus in the wheat population of Example 2 of this invention. 1 / 1 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a high harvest index, and 0 / 0 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a low harvest index. The dots represent the data distribution, and ** represents P < 0.01.
[0034] Figure 4 This is an analysis of the amplified molecular marker at the Ta_Chr4D_22018842 site in the wheat F2 segregating population of Example 3 of the present invention.
[0035] Figure 5This is a box plot showing the distribution of wheat harvest index corresponding to the genotypes at the Ta_Chr4D_22018842 locus in wheat germplasm resources of Example 3 of the present invention. 0 / 0 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a low wheat harvest index; 0 / 1 indicates that the genotype at the Ta_Chr4D_22018842 locus is heterozygous with a low wheat harvest index; and 1 / 1 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a high wheat harvest index. The dots represent the data distribution, and ** represents P < 0.01.
[0036] Figure 6 This is an analysis of the amplified molecular marker at the Ta_Chr4D_22018842 site in 50 wheat germplasm resources in Example 4 of this invention.
[0037] Figure 7 This is a box plot showing the distribution of wheat harvest index corresponding to the genotypes at the Ta_Chr4D_22018842 locus in wheat germplasm resources of Example 4 of this invention. 0 / 0 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a low wheat harvest index, and 1 / 1 indicates that the genotype at the Ta_Chr4D_22018842 locus is homozygous with a high wheat harvest index. The dots represent the data distribution, and *** represents P<0.001. Detailed Implementation
[0038] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0039] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0041] Example 1: Development of Linkage Zones Related to Wheat Harvest Index This invention uses a natural population comprising 406 wheat varieties. Under 11 environmental conditions (2019-2023, sown and late-sown in Yangling, Shaanxi; 2018, sown in Chongzhou, Sichuan), agronomic traits such as effective tiller number (PTN), grains per spike (KNS), 1000-grain weight (TKW), plant height (PH), and total tiller number (TTN) were systematically investigated. Since actual yield per plant was not measured, theoretical yield per plant was calculated using yield components. Aboveground biomass was simulated using plant height and total tiller number, calculated using the formula: Harvest Index (HI) = (PTN × KNS × TKW / 1000) / (PH × TTN)*100 (%). Genome-wide association studies (GWAS) were performed using high-density genotypic data and multi-environment harvest index phenotypic data from this population. The analysis identified a linkage segment on chromosome 4D that was significantly associated with the harvest index, located at 21.0 Mb to 22.0 Mb (reference genome: IWGSC RefSeqCSv1.0). This segment is a quantitative trait locus (QTL) controlling the harvest index, and its association analysis Manhattan plot is shown below. Figure 1 As shown.
[0042] Within this linkage segment, two SNPs significantly associated with the harvest index are included: Ta_Chr4D_22018842 (SEQ ID NO.1, base at position 61 is C / G); Ta_Chr4D_21035056 (SEQ ID NO.2, base at position 61 is C / A); This section mainly contains two haplotypes: Hap A: When both Ta_Chr4D_22018842 and Ta_Chr4D_21035056 are C (i.e., CC haplotype), wheat exhibits a lower harvest index.
[0043] Hap B: When the Ta_Chr4D_22018842 site is G and the Ta_Chr4D_21035056 site is A (i.e., GA haplotype), wheat exhibits a higher harvest index.
[0044] This study performed haplotype analysis on 406 wheat accessions, including two haplotypes. 303 wheat accessions had the CC genotype (Hap A) at the QHI-4D.2 candidate site, while 101 wheat accessions had the GA genotype (Hap B) at the QHI-4D.2 locus. The phenotypic distribution of harvest index corresponding to different haplotypes is shown below. Figure 2As shown, the harvest index of the material with genotype CC (Hap A) was significantly lower than that of the material with genotype GA (Hap B) (P < 0.01), which is completely consistent with the conclusion in Example 1 that haplotype Hap B is the superior haplotype, thus verifying the effectiveness and accuracy of this linkage segment at the population level. There was a highly significant difference in the harvest index between the two haplotypes (P < 0.01).
[0045] Further analysis revealed that this QTL, while regulating the harvest index, also exhibited a significant synergistic regulatory effect on thousand-grain weight. The Hap B haplotype material not only had a higher harvest index but also a significantly higher thousand-grain weight than the Hap A haplotype material, confirming the pleiotropic nature of this locus and providing an important genetic basis for simultaneously improving both harvest index and thousand-grain weight (e.g., ...). Figure 2 (As shown).
[0046] Example 2: Development of molecular markers associated with wheat harvest index Based on the findings of Example 1, we selected Ta_Chr4D_22018842 as the target site for developing diagnostic markers. Since this site is tightly linked to the QTLs regulating harvest index and thousand-grain weight, and its genotype completely co-segregates with the superior haplotype Hap B, the molecular markers developed targeting this site can not only represent the genotype of the SNP itself, but also accurately indicate the presence or absence of the entire superior linkage segment (haplotype) in which it resides. In other words, by detecting just one site, Ta_Chr4D_22018842, it is possible to track and select complex superior haplotypes composed of multiple sites. This site is located at position 22018842 on chromosome 4D and contains a C / G base mutation, as shown in SEQ ID NO.1. The C / G base mutation at this site is located at position 61 of the sequence shown in SEQ ID NO.1 (counting from the first base at the 5' end as position 1). When the base at this locus is C (CC genotype, 0 / 0 genotype), the harvest index of wheat material is low; when the base at this locus is G (GG genotype, 1 / 1 genotype), the harvest index of wheat material is high. Figure 3 ).
[0047] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene: Ta_Chr4D_22018842-F1: GAAGGTGACCAAGTTCATGCTTGGCAGAGATGGAAGAGGTC; (shown in SEQ ID NO.3).
[0048] Ta_Chr4D_22018842-F2: GAAGGTCGGAGTCAACGGATTTGGCAGAGATGGAAGAGGTG; (shown in SEQ ID NO. 4).
[0049] Ta_Chr4D_22018842-R: gtgagggcacatccacttct. (Shown in SEQ ID NO.5).
[0050] Two forward primers are used, each ligating a different fluorescent adapter sequence. The 5' end of forward primer Ta_Chr4D_22018842-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of forward primer Ta_Chr4D_22018842-F2 is ligated to the VIC fluorescent adapter sequence. The FAM and VIC fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.6); VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.7).
[0051] Using this primer set, quantitative real-time PCR amplification was performed on the test samples. The results showed that if the PCR product only detected FAM fluorescence signal corresponding to primer Ta_Chr4D_22018842-F1 with a fluorescent adapter sequence, the detection site was a 0 / 0 genotype, indicating a homozygous type with a low harvest index. If the PCR product only detected VIC fluorescence signal corresponding to primer Ta_Chr4D_22018842-F2 with a fluorescent adapter sequence, the detection site was a 1 / 1 genotype, indicating a homozygous type with a high harvest index phenotype. If both FAM and VIC fluorescence signals corresponding to primers Ta_Chr4D_22018842-F1 and Ta_Chr4D_22018842-F2 with fluorescent adapter sequences were detected simultaneously, the detection site was a 0 / 1 genotype, indicating a low harvest index. Figure 4 ).
[0052] This study developed markers in 406 wheat accessions. 305 accessions had a genotype of 0 / 0 at the Chr4D_22018842 locus, while 101 accessions had a genotype of 1 / 1 at the Chr4D_22018842 locus. The phenotypic distribution of harvest index corresponding to different genotypes is shown below. Figure 3 As shown, the harvest index of the material with genotype 1 / 1 (GG) was significantly higher than that of the material with genotype 0 / 0 (CC) (P < 0.01), validating the effectiveness and accuracy of the molecular marker at the population level.
[0053] The 406 wheat materials used for marker development were those published in the article "Wang X, et al. Populationtranscriptome and phenotype analyses reveal that Rht-D1b contributed a larger seedling root to modern bread wheat. Plant Cell. 2025 Oct 31;37(11):koaf267."
[0054] Example 3: Verification of the accuracy of the molecular marker described in this invention using an F2 segregation population. To verify whether the candidate SNP loci located by our simulated harvest index phenotype truly affect the harvest index, we conducted a validation using an F2 segregating population containing 85 lines. We actually measured the yield per plant and aboveground biomass of each line. The actual harvest index (HI) was calculated as: yield per plant / aboveground biomass * 100 (%). The genotypes of the 85 lines in the F2 segregating population were identified using the aforementioned molecular markers. The harvest index of the wheat germplasm materials used and the genotypes corresponding to the Chr4D_22018842 locus are shown in Table 3. Table 3. Wheat harvest index and genotypes corresponding to Chr4D_22018842 locus in 85 lines of the F2 segregating population.
[0055] Using the genomic DNA of the wheat to be identified as a template, competitive allele-specific PCR was performed using the primer pair to obtain the PCR product.
[0056] The reaction system for competitive allele-specific PCR amplification is as follows: 2.5 μL genomic DNA, 2.5 μL 2×KASPMaster Mix, and 0.07 μL mixed primer mix (F1:F2:R=2:2:5). The preferred PCR amplification program is: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 64℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 56℃ annealing and extension for 1 min, 35 cycles.
[0057] The wheat harvest index was determined based on the competitive allele-specific PCR products. Table 3 shows that in this study, among 85 F2 segregating populations, 18 wheat materials had a genotype of 0 / 0 at the Chr4D_22018842 locus; 50 wheat materials had a genotype of 0 / 1 at the Chr4D_22018842 locus; and 17 wheat materials had a genotype of 1 / 1 at the Chr4D_22018842 locus. The t-test showed a significant difference between the 0 / 0 and 1 / 1 genotypes. P <0.01). The detection results are consistent with the genotype at the Chr4D_22018842 locus and the actual wheat harvest index measurement results. Figure 5 Therefore, the KASP marker of the present invention can effectively identify the size of the harvest index of wheat materials and can be used for the prediction and screening of high harvest index wheat materials.
[0058] Example 4: Verification of the accuracy of the molecular markers described in this invention using germplasm resources. To further verify whether the candidate SNP loci located by our simulated harvest index phenotype truly affect the harvest index, we conducted a validation using 50 wheat germplasm resources. We actually measured the yield per plant and aboveground biomass for each germplasm. The actual harvest index (HI) was calculated as: yield per plant / aboveground biomass * 100 (%). The genotypes of the 50 wheat germplasm resources were identified using the aforementioned molecular markers. The harvest index of the specific wheat germplasm materials used and the genotypes corresponding to the Chr4D_22018842 locus are shown in Table 4. Table 4. Wheat harvest index and genotype corresponding to Chr4D_22018842 locus for 50 wheat germplasms.
[0059] Table 4 shows that in this study, 25 wheat accessions were identified as having the genotype 0 / 0 at the Chr4D_22018842 locus, and 25 accessions were identified as having the genotype 1 / 1 at the Chr4D_22018842 locus. The t-test indicated a significant difference between the 0 / 0 and 1 / 1 genotypes. P < 0.001). The detection results are consistent with the genotype at the Chr4D_22018842 locus and the actual wheat harvest index determination results. Figure 6 , Figure 7 Therefore, the KASP marker of the present invention can effectively identify the size of the harvest index of wheat materials and can be used for the prediction and screening of high harvest index wheat materials.
[0060] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. A molecular marker associated with wheat harvest index, characterized in that, The molecular marker is located on wheat chromosome 4D, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. There is a G / C base mutation at position 61 of the sequence shown in SEQ ID NO.
1. When the base at this position is G, it is associated with a high harvest index phenotype; when the base at this position is C, it is associated with a low harvest index phenotype.
2. The molecular marker related to wheat harvest index according to claim 1, characterized in that, The molecular marker is the KASP marker.
3. A primer set for amplifying the molecular marker of claim 2, characterized in that, The primer set includes: forward primer Ta _Chr4D_22018842-F1: GAAGGTGACCAAGTTCATGCTTGGCAGAGATGGAAGAGGTC; forward primer Ta _Chr4D_22018842-F2:GAAGGTCGGAGTCAACGGATTTGGCAGAGATGGAAGAGGTG; reverse primer Ta _Chr4D_22018842-R:gtgagggcacatccacttct.
4. The primer set of molecular markers according to claim 3, characterized in that, The two forward primers are connected to different fluorescent adapter sequences; the 5' end of the forward primer Ta_Chr4D_22018842-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer Ta_Chr4D_22018842-F2 is connected to the VIC fluorescent adapter sequence.
5. A reagent kit for identifying wheat harvest index, characterized in that, It includes the primer set described in claim 4.
6. The application of the primer set of the molecular marker according to claim 4 or the kit according to claim 5 in the identification of wheat harvest index, characterized in that, Competitive allele-specific PCR amplification was performed using the primer set or the kit described above. The results of the competitive allele-specific PCR amplification were analyzed. If only primers with fluorescent adapter sequences were detected in the PCR products of the sample, the analysis was performed. Ta If the FAM fluorescence signal corresponding to _Chr4D_22018842-F1 is detected, then this locus indicates an 0 / 0 genotype, classifying it as a homozygous type with a low harvest index; if only primers with fluorescent adapter sequences are detected in the PCR product of the sample... Ta If the VIC fluorescence signal corresponding to _Chr4D_22018842-F2 is detected, then this locus represents a 1 / 1 genotype, indicating a homozygous high-harvest-index phenotype; if a primer containing a fluorescent adapter sequence is also detected... Ta _Chr4D_22018842-F1、 Ta If the two FAM and VIC fluorescence signals corresponding to _Chr4D_22018842-F2 indicate that the locus is a 0 / 1 genotype, and is determined to be a heterozygous type with a low harvest index.
7. A method for determining the wheat harvest index, characterized in that, The method includes the following steps: (1) Extracting genomic DNA from wheat to be tested; (2) Using the genomic DNA extracted in step (1) as a template, competitive allele-specific PCR amplification is performed using the primer set of molecular markers described in claim 4 or the kit described in claim 5, and the results of competitive allele-specific PCR amplification are analyzed. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Using primer sets Ta _Chr4D_22018842-F1、 Ta _Chr4D_22018842-F2、 Ta Competitive allele-specific PCR amplification was performed using _Chr4D_22018842-R. If the PCR product of the sample only detected primers ligated with fluorescent adapter sequences... Ta If the FAM fluorescence signal corresponding to _Chr4D_22018842-F1 is detected, then this locus indicates an 0 / 0 genotype, classifying it as a homozygous type with a low harvest index; if only primers with fluorescent adapter sequences are detected in the PCR product of the sample... Ta If the VIC fluorescence signal corresponding to _Chr4D_22018842-F2 is detected, then this locus represents a 1 / 1 genotype, indicating a homozygous high-harvest-index phenotype; if a primer containing a fluorescent adapter sequence is also detected... Ta _Chr4D_22018842-F1、 Ta If the two FAM and VIC fluorescence signals corresponding to _Chr4D_22018842-F2 indicate that the locus is a 0 / 1 genotype, and is determined to be a heterozygous type with a low harvest index.