RPA-CRISPRCas12a detection method and kit based on areca yellow phytoplasma 16S rRNA (ribosomal Ribonucleic Acid) specific target sequence

Abstract

The invention relates to the technical field of molecular biological detection, in particular to an RPA-CRISPRCas12a detection method and a kit based on a specific target sequence of areca yellowed phytoplasma 16S rRNA (ribosomal Ribonucleic Acid). The method comprises the following steps: extracting genome DNA of an areca nut sample, and performing amplification through an RPA primer by taking the genome DNA as a template to obtain an amplification product; mixing the amplification product with crRNA, an ssDNA fluorescence report probe, Cas12a protein, a buffer solution and DEPC water, and reacting to obtain a reactant; the reactants are placed under blue light to observe fluorescence, and if fluorescence exists, the areca catechu sample contains areca catechu yellowed phytoplasma. The designed RPA primer has relatively high specificity and can specifically amplify a part of sequences of the areca yellow phytoplasma 16S rRNA gene; the RPA technology can complete high-efficiency gene amplification within 30 minutes; the detection limit can reach 1.6 copies / mu L.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and particularly relates to an RPA-CRISPR Cas12a detection method and kit based on a specific target sequence of 16S rRNA of Areca yellow phytoplasma. Background Art

[0002] Phytoplasmas ('Candidatus Phytoplasma', previously known as mycoplasma-like organisms, Mycoplasma like organism = MLO) are a group of prokaryotes without cell walls, surrounded by a unit membrane with a thickness of about 8-12 nm, with diverse morphologies and sensitive to tetracycline antibiotics. The disease symptoms caused by phytoplasmas and the severity of their occurrence are closely related to environmental conditions. For example, in seasons with higher temperatures, the number of phytoplasmas in host plants is higher, resulting in obvious disease symptoms in plants, especially in young tissues; while in low-temperature seasons, the number of phytoplasmas in plants is lower, and most plants show reduced symptoms or even no obvious disease symptoms.

[0003] The areca palm yellowing disease caused by phytoplasma was first discovered in Kerala, India in 1914. By the 1960s, the areca palm yellowing disease had become widespread in this region. Indian scholar Nayar observed phytoplasma (Mycoplasma like organism = MLO) in the leaf tissues of yellowing areca palms through an electron microscope in 1971; further electron microscope observation experiments on diseased and healthy areca palm leaf samples found that phytoplasma existed in the young sieve tubes of diseased tissues, while it was completely absent in healthy samples. Based on the experimental results, Nayar first proposed in 1978 that the areca palm yellowing disease was caused by phytoplasma infection (phytoplasma is relatively special and difficult to culture artificially, and it is impossible to directly complete the Koch's postulates inoculation verification). The inoculation experiments and electron microscope observation experimental results carried out by Ponnamma et al. using the vector insect Dictyophara pallida and dodder also provided further evidence for the pathogenic nature of phytoplasma. In China, after the areca palm yellowing disease was first discovered in Tunchang County, Hainan Province in 1981, relevant scholars explored and studied its pathogen or cause. In 1995, Jin Kaixuan et al. observed Bacterial like organism (BLO) and Mycoplasma like organism (MLO) in the conducting tissues of diseased areca palm plants in Hainan through an electron microscope, and proposed that the yellowing type of areca palm yellowing disease was caused by phytoplasma infection. After that, the research group of Luo Daquan et al. found microorganisms similar to phytoplasma in the sieve tube tissues of the leaves of diseased and yellowing plants through an electron microscope. The antibiotic injection experiment confirmed that tetracycline could inhibit the symptoms of the areca palm yellowing disease (phytoplasma is sensitive to tetracycline antibiotics), and the nested PCR method was used to amplify the 16S rRNA gene sequence of the DNA of diseased samples and conduct sequence determination and comparison, thus further proving that phytoplasma was a pathogen causing the areca palm yellowing disease in Hainan.

[0004] In Hainan, in the early stage of the areca palm yellowing disease, the leaf margins of the leaflets of the penultimate pinnate leaf of diseased plants first show yellowing symptoms, the flower spikes cannot extend normally, the flower spikes of diseased plants are shorter, and the fruits sometimes fall off prematurely. As time goes by and the disease develops, the yellowing symptoms of diseased plants will become more severe and often spread to all leaves; in the dry season with high temperature and low humidity, the whole leaves of diseased areca palm plants often cannot unfold normally, the axillary buds are dark and water-soaked, and there is a brown sandwich at their bases; most diseased plants die of apical drying within 5 - 7 years after the appearance of yellowing symptoms. At present, this disease occurs in 18 cities and counties in Hainan, posing a serious threat to the areca palm industry and the income increase of farmers.

[0005] Currently, the detection targets for phytoplasmas (including Areca yellowing phytoplasma) are the 16S rRNA gene, rp gene (for the rp gene, our team has developed a visualization rapid detection method based on RPA-CRISPR / Cas12a, with the invention patent number CN118547093B), ribosomal proteins (rpl22 and rpS3), SecY, SecA, elongation factor (EF-Tu) tuf, and GroEL. Among them, the 16S rRNA gene is highly conserved and is thus widely used in phytoplasma phylogenetic analysis and classification research. In the 1990s, the phytoplasma detection technology based on 16S rRNA first emerged. So far, the classification criteria for phytoplasma groups and subgroups are also based on the restriction fragment length polymorphism of their 16S rRNA sequences. Currently, various nucleic acid detection technologies have been established for the 16S rRNA target gene, among which the PCR technology is the main one, and recently the loop-mediated isothermal amplification (LAMP) technology has also been established.

[0006] So far, the established detection methods for the pathogen phytoplasma of Areca yellowing disease include nested PCR, real-time quantitative PCR, droplet digital PCR, etc. However, after collecting diseased samples in the field and extracting the total plant genomic DNA in the laboratory, these methods need to be further detected using precision temperature-variable instruments such as PCR instruments and real-time fluorescence quantitative PCR instruments. In actual production, there is an urgent need to develop a method with good specificity and sensitivity, especially one that does not require complex temperature-variable equipment, is easy to operate, and is expected to be applicable to on-site detection in the field, so as to improve the detection efficiency and achieve the purpose of rapid, sensitive, and specific detection. Summary of the Invention

[0007] To meet the above technical requirements, the present invention provides an RPA-CRISPR Cas12a detection method and kit based on the 16S rRNA specific target sequence of Areca yellowing phytoplasma for rapid and accurate detection of Areca yellowing phytoplasma.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] The present invention provides an RPA-CRISPR Cas12a detection method based on the 16S rRNA specific target sequence of Areca yellowing phytoplasma, comprising the following steps:

[0010] 1) Extract the genomic DNA of the areca sample, and use the genomic DNA as a template to amplify with RPA primers to obtain an amplification product;

[0011] The nucleotide sequence of the upstream primer of the RPA primer is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.2;

[0012] 2) Mix the amplification product obtained in step 1) with crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer, and DEPC water, and obtain a reaction product after reaction;

[0013] The amino acid sequence of the Cas12a protein is shown as SEQ ID No.5; the nucleotide sequence of the ssDNA fluorescent reporter probe is shown as SEQ ID No.6;

[0014] The nucleotide sequence of the crRNA is shown as SEQ ID No.7;

[0015] 3) Place the reaction product obtained in step 2) under blue light to observe fluorescence. If there is fluorescence, it indicates that the areca nut sample contains areca yellowing phytoplasma.

[0016] Preferably, the amplification system in step 1) includes: 2.4 μL of upstream primer with a concentration of 10 μM, 2.4 μL of downstream primer with a concentration of 10 μM, 29.5 μL of buffer solution, 2 μL of genomic DNA, and ddH2O is added to make up to 47.5 μL.

[0017] Preferably, the amplification conditions include: temperature is 37 °C and time is 30 min.

[0018] Preferably, the volume ratio of the amplification product in step 2) to crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer, and DEPC water is 3:3:1:1:2:10.

[0019] Preferably, the concentration of the crRNA is 1 μM, the concentration of the ssDNA fluorescent reporter probe is 3 μM, and the concentration of the Cas12a protein is 1 μM.

[0020] Preferably, the reaction conditions include: temperature is 37 °C and time is 30 min.

[0021] The present invention also provides a kit for detecting areca yellowing phytoplasma based on RPA-CRISPR Cas12a, including: RPA primers, crRNA, ssDNA fluorescent reporter probes, and Cas12a proteins in the method of the above technical solution.

[0022] The present invention also provides the application of the kit of the above technical solution in detecting areca yellowing phytoplasma.

[0023] In the present invention, CRISPR / Cas12a, as an emerging biotechnology, can be combined with isothermal amplification technologies such as RPA for rapid isothermal visual detection of pathogenic bacteria. Cas12a can specifically recognize and cleave double-stranded DNA (dsDNA) with a PAM sequence rich in T nucleotides under the guidance of crRNA, and cleave the target strand at specific sites to achieve the purpose of detection. By coupling the RPA amplification technology with Cas12a, using the RPA amplification technology to amplify the target DNA, and then adding the CRISPR system, after the Cas12a-crRNA complex binds to the target DNA, the trans-cleavage activity is activated, cleaving the labeled fluorophore in the system to generate a fluorescence signal. The main features of this method are high efficiency, rapidity, simplicity of operation, strong specificity, and high sensitivity, making it suitable for on-site real-time detection. The present invention aims to detect Areca yellow phytoplasma, taking nucleic acid amplification technology as the core, and establishing a more rapid, accurate, and stable detection method by establishing a series of nucleic acid detection methods. The sensitivity, specificity, and repeatability of the method are analyzed, and it has high detection sensitivity, can complete the detection within about 60 minutes, and has high accuracy. This method has the characteristics of rapidity, visualization, and high sensitivity.

[0024] Advantages of the present invention:

[0025] 1) Strong specificity: The designed RPA primers have high specificity and can specifically amplify a partial sequence of the 16S rRNA gene of Areca yellow phytoplasma;

[0026] 2) Fast reaction speed: The RPA technology can complete high-efficiency gene amplification within 30 minutes;

[0027] 3) High sensitivity: After obtaining a large number of target DNA fragments by isothermal amplification of RPA, the CRISPR / Cas12a system specifically recognizes the target fragments, and the final detection limit can reach 1.6 copies / μL, which is 143.1 times that of the RPA-CRISPR / Cas12a detection method based on the rp gene developed by our team (patent number of invention patent CN118547093B, the lowest detection limit can reach 2.29×10 2 copies / μL); 33.1 times that of the LAMP method for the 16S rRNA gene (the lowest detection limit can reach 53 copies / μL; Yu et al. The Plant Pathology Journal, 2020, 36(5): 459 - 467), and is superior to the TaqMan probe Real-time quantitative PCR detection method (the lowest detection limit is 1.16×10 1 copies / μL; Lin Zhaowei et al. Chinese Journal of Tropical Crops, 2024, 45(6): 1120 - 1126), which is 7.3 times that of the latter.

[0028] 4) Simple result determination: The fluorescence detection result can be read by the naked eye under ultraviolet light irradiation, or the result can be determined according to the fluorescence intensity on the fluorescence detector;

[0029] 5) Simple operation: Only simple constant temperature instrument equipment is required. Description of the Drawings

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings required for use in the embodiments will be briefly introduced below.

[0031] Figure 1 Using the genomic DNA of healthy areca palm leaves, areca palm bacterial leaf spot pathogen (Burkholderia andropogonis = Robbsia andropogonis), Pantoea ananatis, jujube tree leaves infected with 16SrV group phytoplasma, areca palm leaves infected with 16SrI and 16SrII group phytoplasmas, leaf samples of Paulownia witches' broom phytoplasma infected with 16SrI group, genomic DNA of Trema tomentosa plants infected with 16SrXXXII group phytoplasmas, and cDNA of areca palm leaf yellowing virus 1 as references to verify the specificity of RPA primers; Note: M: DL2000 DNA Marker; NC: blank control;

[0032] Figure 2 For the verification of the function of activating the cleavage activity of Cas12a by crRNA; Note: A, C: Verification of the function of activating the cleavage activity of Cas12a by crRNA1; B, D: Verification of the function of activating the cleavage activity of Cas12a by crRNA2; NC: blank control;

[0033] Figure 3 For the specificity verification result of the RPA-CRISPR / Cas12a method, A is the color development result of each reaction tube observed by the naked eye under blue light; B is the fluorescence value of each reaction tube measured by the microplate reader. Using the genomic DNA of healthy areca palm leaves, areca palm bacterial leaf spot pathogen, Pantoea ananatis, jujube tree infected with 16SrV group phytoplasma, areca palm trees infected with 16SrI and 16SrII group phytoplasmas, Paulownia samples infected with 16SrI group phytoplasma, genomic DNA of Trema tomentosa plants infected with 16SrXXXII group phytoplasmas, cDNA of areca palm leaf yellowing virus 1 (areca palm leaf yellowing virus 1 = areca palm velarivius 1), and the recombinant plasmid of 16S gene of 16SrI and 16SrII group phytoplasmas as references, ddH2O is used as the negative control; Note: NC: blank control;

[0034] Figure 4 The recombinant plasmid of the 16S gene of phytoplasma 16SrI group was serially diluted with DEPC water to 9 concentration gradients from 1.6×10 6 copies / μL to 1.6×10 -2 copies / μL, and a blank control with DEPC water as the template was set. The sensitivity determination results of the RPA-CRISPR / Cas12a detection method are as follows. A shows the color development results of each reaction tube observed with the naked eye under blue light; B shows the fluorescence values of each reaction tube measured by a microplate reader. Note: NC: blank control;

[0035] Figure 5 The detection results of 25 genomic DNA samples of areca nut that have been previously identified as infected with phytoplasma by using the RPA-CRISPR / Cas12a method are shown. Note: NC: blank control. Detailed implementation mode

[0036] The present invention provides an RPA-CRISPR Cas12a detection method based on the specific target sequence of 16S rRNA of areca nut yellowing phytoplasma, comprising the following steps:

[0037] 1) Extract the genomic DNA of the areca nut sample, and use the genomic DNA as a template to amplify with RPA primers to obtain an amplification product;

[0038] The nucleotide sequence of the upstream primer of the RPA primer is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2;

[0039] 2) Mix the amplification product obtained in step 1) with crRNA, ssDNA fluorescence reporter probe, Cas12a protein, buffer, and DEPC water, and react to obtain a reaction product;

[0040] The amino acid sequence of the Cas12a protein is as shown in SEQ ID No.5;

[0041] The nucleotide sequence of the ssDNA fluorescence reporter probe is as shown in SEQ ID No.6;

[0042] The nucleotide sequence of the crRNA is as shown in SEQ ID No.7;

[0043] 3) Place the reaction product obtained in step 2) under blue light to observe fluorescence. If there is fluorescence, it indicates that the areca nut sample contains areca nut yellowing phytoplasma.

[0044] The genomic DNA of the areca nut sample is extracted, and using the genomic DNA as a template, amplification is carried out with RPA primers to obtain an amplification product; the nucleotide sequence of the upstream primer of the RPA primer is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2.

[0045] There is no special limitation on the method for extracting the genomic DNA of the areca nut sample in the present invention, and those skilled in the art can extract it by conventional methods. In the present invention, the amplification system preferably includes: 2.4 μL of the upstream primer with a concentration of 10 μM, 2.4 μL of the downstream primer with a concentration of 10 μM, 29.5 μL of a buffer solution, 2 μL of genomic DNA, and ddH2O is added to make up to 47.5 μL. In the present invention, the amplification conditions preferably include: a temperature of 37 °C and a time of 30 min.

[0046] SEQ ID No.1:

[0047] GTTCTATAATTAGGGAAGAATAAATGATGG;

[0048] SEQ ID No.2:

[0049] TATCTTACTCTAGCTAAACAGTTTTTATAG.

[0050] The obtained amplification product in the present invention is mixed with crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer solution, and DEPC water, and a reaction product is obtained after the reaction;

[0051] The amino acid sequence of the Cas12a protein is as shown in SEQ ID No.5; the nucleotide sequence of the ssDNA fluorescent reporter probe is as shown in SEQ ID No.6; the nucleotide sequence of the crRNA is as shown in SEQ ID No.7; in the present invention, the volume ratio of the amplification product to crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer solution, and DEPC water is preferably 3:3:1:1:2:10. In the present invention, the concentration of the crRNA is preferably 1 μM, the concentration of the ssDNA fluorescent reporter probe is preferably 3 μM, and the concentration of the Cas12a protein is preferably 1 μM. The present invention preferably modifies the 5'-end of the ssDNA fluorescent reporter probe with FAM and the 3'-end with BHQ1. In the present invention, the reaction conditions preferably include: a temperature of 37 °C and a time of 30 min.

[0052] SEQ ID No.6:

[0053] TTAATTTTATTA;

[0054] SEQ ID No.7:

[0055] UAAUUUCUACUAAGUGUAGAUCGCCCAAUAAUUCCGGAUAAC。

[0056] The reactants obtained in the present invention are placed under blue light to observe fluorescence. If there is fluorescence, it indicates that the areca nut sample contains areca nut yellow phytoplasma. The present invention can also read the fluorescence intensity of the reactants in a fluorescence reader to interpret the results.

[0057] The present invention also provides a kit for detecting areca nut yellow phytoplasma based on RPA-CRISPRCas12a, including: RPA primers, crRNA, ssDNA fluorescence reporter probes and Cas12a protein in the method described in the above technical solution. In the present invention, the above reagents in the kit are independently packaged. The present invention does not have special limitations on the amounts of the above reagents in the kit, and those skilled in the art can adopt conventional settings.

[0058] The present invention also provides the application of the kit described in the above technical solution in detecting areca nut yellow phytoplasma.

[0059] In order to further illustrate the present invention, the present invention will be described in detail below in conjunction with embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0060] Example 1

[0061] (1) Design and preparation of RPA primers

[0062] Based on the multiple sequence alignment of the 16S rRNA of areca nut yellow phytoplasma at home and abroad with non-specific target sequences such as areca nut chloroplast and 16S rRNA of areca nut bacterial leaf spot pathogen, specific sequence fragments of phytoplasma in groups 16SrI and 16SrII were found and used as targets for primer design. Based on the conserved region sequence, the following primer design principles were followed for design: the primer length is between 28 and 36 bp, the amplification product length is between 100 and 300 bp, the GC content is between 30 and 70%, and Tm>50°C. The primer pairs with self-complementarity and complementarity between primers were excluded using DNAMAN 9.0 for RPA primer design. The RPA primers were synthesized, purified and confirmed by a relevant company in the Guangzhou branch of a bioengineering company.

[0063] Table 1 Target, primer DNA sequence and Cas12a protein sequence

[0064]

[0065]

[0066]

[0067] (2) Preparation of ssDNA Fluorescent Probe

[0068] LbCas12a has a TA preference for non-specific cleavage of single-stranded DNA. The ssDNA fluorescent probe sequence (5'-3') (SEQ ID No. 6): TTAATTTTATTA, with FAM modification at the 5' end and BHQ1 modification at the 3' end, i.e., 5`6-FAM-TTAATTTTATTA-BHQ1-3`. The single-stranded DNA reporter sequence was synthesized, purified, and confirmed by BGI Tech Solutions (Guangzhou) Co., Ltd.

[0069] (3) Design and Preparation of crRNA

[0070] Since LbCas12a specifically cleaves double-stranded DNA by recognizing the PAM sequence (5'-TTTN-3'), the region where crRNA hybridizes and recognizes the target DNA is 20 nucleotides downstream of the PAM sequence. crRNA was designed based on the amplified sequence of the RPA primer. The 222bp amplified sequence was uploaded to the crRNA design website CRISPOR (http: / / crispor.tefor.net / ), and corresponding parameters were filled in for design (selecting the system as CRISPR / Cas12a and the species as bacteria). The two crRNAs with the highest scores were selected and synthesized by BGI Tech Solutions (Guangzhou) Co., Ltd. (The screening process is to use the online tool provided by the development team of the CRISPR / Cas system for crRNA prediction, select the two sequences with the highest scores, and perform subsequent screening.)

[0071] Table 2 crRNA Sequences

[0072]

[0073] (4) Screening of Optimal crRNA

[0074] Using the target DNA at the same concentration as the template, Cas12a protein, ssDNA fluorescent probe, NEB buffer 2.1 (the kit used is a commercial product of the company, and the specific components are not provided), and DEPC water were added together into a sterile PCR tube. The two designed crRNAs were respectively added to this reaction system (the specific reaction system is shown in Table 3). Screening was carried out by comparing the fluorescence signal intensities, and finally it was found that crRNA2 had stronger specificity and higher sensitivity.

[0075] Table 3 CRISPR / Cas12a Reaction System

[0076] Reagent Initial concentration Dosage Final concentration Cas12a 1 μM 1 μL 50 nM crRNA 1 μM 3 μL 150 nM ssDNA 3 μM 1 μL 150 nM DNA fragment - 3 μL - NEBuffer2.1 - 2 μL - DEPC water 10 μL

[0077] Example 2

[0078] Establishment of a Visual Detection System for Areca Yellowing Phytoplasma

[0079] Add the RPA primers, buffer (the kit used is a commercial product of the company, and the specific components are not provided), ddH2O, and the total genomic DNA of the areca nut to be tested into the dry powder tube. After pipetting and mixing evenly, add 2.5 μL of MgOAc solution (280 mM) into the tube and immediately place it in a 37°C constant temperature water bath for 30 min. The specific reaction system of RPA is shown in Table 4 below:

[0080] Table 4 RPA Reaction System

[0081] Reagent Initial concentration Dosage Final concentration Forward primer 10 μM 2.4 μL 0.48 μM Reverse primer 10 μM 2.4 μL 0.48 μM Buffer - 29.5 μL - Template - 2 μL - <![CDATA[ddH2O]]> - Make up to 47.5 μL -

[0082] Add the ssDNA fluorescent probe, NEB buffer 2.1, crRNA, and DEPC water into a nuclease-free PCR tube to dissolve and mix them evenly. Subsequently, add the RPA amplification product into the above system, mix it evenly with a pipette, cover the tube cap, and place it at 37°C for 30 min. After the reaction is completed, place the reaction tube under blue light to observe the fluorescence color, or read the fluorescence intensity in a fluorescence reader to perform the result judgment. The CRISPR-Cas12a reaction system is shown in Table 3:

[0083] Example 3

[0084] (1) Specificity Verification of the RPA-CRISPR / Cas12a Visual Detection Method

[0085] To evaluate the specificity of this method, the RPA-CRISPR / Cas12a method established by the present invention was used to detect healthy areca nut leaves, Xanthomonas arecae, Pantoea ananatis, Areca yellowing virus 1, Jujube witches'-broom phytoplasma, Paulownia witches'-broom phytoplasma, Trema orientale witches'-broom phytoplasma, 16SrI group Areca yellowing phytoplasma, 16SrI group recombinant plasmid, 16SrII group Areca yellowing phytoplasma, and 16SrII group recombinant plasmid, respectively, and a blank control with DEPC water as the template was set. The fluorescence intensity was read with an enzyme-labeled instrument, and the visual results were read under blue light.

[0086] Finally, only the reaction tubes belonging to the Paulownia witches'-broom phytoplasma of the 16SrI group, the Areca yellowing phytoplasma of the 16SrI group, and the 16SrI group recombinant plasmid emitted green fluorescence under blue light, and the fluorescence values read by the enzyme-labeled instrument were significantly higher than those of the negative control.

[0087] (2) Sensitivity Determination of the RPA-CRISPR / Cas12a Visual Detection Method

[0088] The recombinant plasmid of the 16SrI group was serially diluted with DEPC water to 9 concentration gradients from 1.6×10 6 copies / μL to 1.6×10 -2 copies / μL, and a blank control with DEPC water as the template was set to determine the sensitivity of the RPA-CRISPR / Cas12a detection method.

[0089] Both the results of fluorescence color development and fluorescence value reading showed that the lowest detection limit of the RPA-CRISPR / Cas12a detection method was 1.6 copies / μL.

[0090] Example 4

[0091] Detection of Areca nut samples in the field

[0092] The RPA-CRISPR / Cas12a method was used to detect the total genomic DNA samples of 25 Areca nut plants that had been previously identified as infected with phytoplasma, and the detection results were read under blue light.

[0093] The results showed that under blue light, fluorescence could be emitted from all 25 reaction tubes, and the positive rate was 100%.

[0094] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments without creative efforts based on these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A RPA-CRISPRCas12a detection method based on the specific target sequence of 16S rRNA of Areca yellow phytoplasma, characterized in that, It includes the following steps: 1) Extract the genomic DNA of the areca nut sample, use the genomic DNA as a template and amplify it with RPA primers to obtain an amplification product; The nucleotide sequence of the upstream primer of the RPA primer is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.2; 2) Mix the amplification product obtained in step 1) with crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer solution, and DEPC water, and obtain a reaction product after reaction; The amino acid sequence of the Cas12a protein is shown in SEQ ID No.5; The nucleotide sequence of the ssDNA fluorescent reporter probe is shown in SEQ ID No.6; The nucleotide sequence of the crRNA is shown in SEQ ID No.7; 3) Place the reaction product obtained in step 2) under blue light to observe fluorescence. If there is fluorescence, it indicates that the areca nut sample contains areca yellow phytoplasma.

2. The method according to claim 1, wherein The amplification system in step 1) includes: 2.4 μL of upstream primer with a concentration of 10 μM, 2.4 μL of downstream primer with a concentration of 10 μM, 29.5 μL of buffer solution, 2 μL of genomic DNA, and ddH2O is added to make up to 47.5 μL.

3. The method according to claim 1 or 2, characterized in that, The amplification conditions include: temperature is 37 °C, and time is 30 min.

4. The method according to claim 1, characterized in that The volume ratio of the amplification product, crRNA, ssDNA fluorescent reporter probe, Cas12a protein, buffer solution, and DEPC water in step 2) is 3:3:1:1:2:

10.

5. The method according to claim 4, characterized in that The concentration of the crRNA is 1 μM, the concentration of the ssDNA fluorescent reporter probe is 3 μM, and the concentration of the Cas12a protein is 1 μM.

6. The method according to claim 1, characterized in that The reaction conditions include: temperature is 37 °C, and time is 30 min.

7. A kit for detecting Areca yellow phytoplasma based on RPA-CRISPRCas12a, characterized in that, It includes: The RPA primer, crRNA, ssDNA fluorescent reporter probe, and Cas12a protein in the method described in claim 1.

8. Use of the kit according to claim 7 in detecting areca yellow phytoplasma.

Images