Primer group for chaff tree genome SSR (Simple Sequence Repeat) marking as well as application and screening method

By screening out 7 pairs of high-quality SSR primer groups, the shortcomings in molecular identification and genetic diversity research of crude bran tree were solved, and precise molecular identification and genetic diversity analysis of crude bran tree varieties were achieved, supporting the protection and utilization of germplasm resources.

CN120350152APending Publication Date: 2025-07-22PINGDINGSHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510459467.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The lack of efficient SSR primer sets suitable for crude bran trees in the prior art, resulting in insufficient research on its molecular identification and genetic diversity.

Method used

Seven pairs of high-quality SSR primer groups were designed and screened out. Primers with good amplification efficiency and polymorphism were screened through analysis of the genome data of the crude bran tree, using PCR amplification and capillary electrophoresis analysis, which was suitable for molecular identification and genetic diversity analysis of the crude bran tree.

Benefits of technology

Accurate molecular identification and genetic diversity analysis of crude bran varieties is realized, which can effectively distinguish individuals from ancient tree groups from different sources and provides technical support for the protection and utilization of germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetics and molecular markers, and particularly relates to a primer group for chaff tree genome SSR (Simple Sequence Repeat) marking as well as application and a screening method. According to the primer group screening method for the chaff tree genome SSR marking, 212767 SSR loci from a dibasic group to a hexa-basic group repetitive primitive are screened on the basis of chaff tree genome data, and 192 pairs of primers are designed and synthesized. According to the method, seven pairs of high-quality SSR primer groups are screened from eight chaff tree germplasm materials from different geographical sources through PCR (Polymerase Chain Reaction) amplification, capillary electrophoresis analysis and polymorphism evaluation. The primers have good amplification efficiency, polymorphism and strip peak pattern stability, and are suitable for molecular identification and genetic diversity analysis. The seven pairs of primer groups provided by the invention are used for carrying out precise molecular identification on six ancient tree samples, and 48 group individuals of Luoyang chaff tree can be effectively distinguished. Important technical support is provided for conservation, utilization and genetic research of germplasm resources of the chaff tree.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetics and molecular marker technology, and particularly relates to a primer set for SSR markers of Ehretia dicksonii genome, as well as its application and screening method. Background Art

[0002] Ehretia dicksonii Ehretia macrophylla Wall.) is a tree species with important ecological and economic values, and the protection, development and utilization of its germplasm resources are of great significance. However, there are relatively few genetic studies on Ehretia dicksonii, especially in molecular identification and genetic diversity research, and there is a lack of effective molecular marker tools. SSR markers (simple sequence repeats) have become one of the most commonly used molecular marker tools in plant genetic research due to their high polymorphism, good stability and wide distribution. However, there is currently no efficient SSR primer set suitable for Ehretia dicksonii. The present invention solves the defects in the prior art by developing and screening high-quality SSR markers, and provides a molecular tool for the protection and utilization of Ehretia dicksonii germplasm resources. Summary of the Invention

[0003] The present invention provides a primer set for SSR markers of Ehretia dicksonii genome, and also provides a screening method for the primer set, which can be used for molecular identification and genetic diversity analysis of Ehretia dicksonii.

[0004] The technical solution adopted by the present invention is as follows: By analyzing the genome data of Ehretia dicksonii, the present invention designs 192 pairs of SSR primers, and through the evaluation of amplification efficiency, band peak type and polymorphism, 7 pairs of high-quality primer sets are screened out and applied to the identification of ancient Ehretia dicksonii trees and population genetic diversity analysis. The primer set for SSR markers of Ehretia dicksonii genome includes at least one of the following primer pairs: Primer pair A, the nucleotide sequence of its upstream primer is shown as SEQ ID NO.1: TGGTGAAGATGAAGGTGAGGATG, and the nucleotide sequence of its downstream primer is shown as SEQ ID NO.2: CTTGTCAAACTGGGATTTGGGAC; Primer pair B, the nucleotide sequence of its upstream primer is shown as SEQ ID NO.3: CGGGGTTGAGTAAGTGCTAGATT, and the nucleotide sequence of its downstream primer is shown as SEQ ID NO.4: AACAATGGGGACTAACCGTAGAC; Primer pair C, the nucleotide sequence of its upstream primer is shown as SEQ ID NO.5: TCTCGTTTCTCTCTCCACAGTTC, and the nucleotide sequence of its downstream primer is shown as SEQ ID NO.6: TAAAGTGTAGTACCCCACACACC; Primer pair D, the nucleotide sequence of its upstream primer is shown as ACAACACCAGTGATCACTACCTC in SEQ ID NO.7, and the nucleotide sequence of its downstream primer is shown as GCTTCTTGTTTTGCTATTCGGGT in SEQ ID NO.8.

[0005] Primer pair E, the nucleotide sequence of its upstream primer is shown as GGGAGAAGAATGTGGAGTCCATT in SEQ ID NO.9, and the nucleotide sequence of its downstream primer is shown as CACACATACACACGGATTTCACC in SEQ ID NO.10; Primer pair F, the nucleotide sequence of its upstream primer is shown as AGTGCGGATGGTTTGTATCTGAT in SEQ ID NO.11, and the nucleotide sequence of its downstream primer is shown as GTCATTGCACTTGGATGAAGCTT in SEQ ID NO.12; Primer pair G, the nucleotide sequence of its upstream primer is shown as TTGGATGGCATGAACACAGAAAC in SEQ ID NO.13, and the nucleotide sequence of its downstream primer is shown as GTGTCGTAGTTTAATGCCTTCGG in SEQ ID NO.14.

[0006] The primer set of Ehretia dicksonii genomic SSR markers proposed by the present invention can be applied to: (1) Molecular identification of Ehretia dicksonii varieties; (2) Genetic diversity analysis of Ehretia dicksonii varieties; (3) Analysis of genetic relationships of Ehretia dicksonii varieties; (4) Molecular marker-assisted breeding of Ehretia dicksonii.

[0007] Using the primer set of Ehretia dicksonii genomic SSR markers of the present invention, a kit for Ehretia dicksonii genomic SSR markers can be prepared, and the kit includes any one or a combination of primer pair A, primer pair B, primer pair C, primer pair D, primer pair E, primer pair F, and primer pair G.

[0008] The screening method of the primer set for Ehretia dicksonii genomic SSR markers of the present invention includes the following steps: (1) Obtain the original gene database of the target Ehretia dicksonii sample; Download the Ehretia dicksonii genomic data, use the MISA software to obtain the sequence segments where all repetitive sequences are located, and establish a repetitive sequence database as the original gene database of the target Ehretia dicksonii sample.

[0009] (2)Perform SSR locus search on the original gene database described in step (1), where the repeat numbers of mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides are at least 10, 6, 5, 5, 5, and 5 times respectively; (3)Use the upstream and downstream sequences of the SSR loci obtained in step (2) as target sequences, and use Primer5.0 to design PCR primers for the target sequences and generate candidate primers; (4)Select 8 rough-leaved catalpa samples from 8 different geographical sources respectively, extract DNA as templates, perform PCR amplification using the candidate primers, subject the amplified products to capillary electrophoresis and genotyping, and then use GeneMarker software for band analysis to preliminarily screen out the preliminary screening PCR primers that can amplify the target sequences in step (3); then extract the DNA of rough-leaved catalpa from different provenances from the target rough-leaved catalpa as templates, perform PCR amplification using the preliminary screening PCR primers, subject the amplified products to capillary electrophoresis and genotyping, and use GeneMarker software for band analysis to screen out the primers that can amplify the target sequences in step (3), and thus obtain the primer set for SSR markers of the rough-leaved catalpa genome.

[0010] The target rough-leaved catalpa sample described in step (1) is the rooted tissue culture seedlings of the target rough-leaved catalpa or the leaves of the plants of the target rough-leaved catalpa; the rough-leaved catalpa samples described in step (4) are the leaves of the plants of the rough-leaved catalpa.

[0011] In step (4), extract more than 48 rough-leaved catalpas from different sources from the target rough-leaved catalpa and perform PCR amplification using the preliminary screening PCR primers respectively; they are collected from different regions from the target ancient rough-leaved catalpa.

[0012] In step (3), the design parameters of the candidate primers are: the primer length is 20bp, the GC content is 35% - 60%, the annealing temperature is 60°C, and the expected fragment length of the PCR amplification product is 110bp - 300bp.

[0013] In step (4), the PCR amplification is a two-step PCR amplification, which includes the following steps: The first-step PCR amplification, the total volume of the reaction system is 10μL, and it consists of the following components by volume: 1μL of the template with a concentration of 20ng / μL, 0.1μL of the upstream primer with a concentration of 10μmol / L, 0.1μL of the downstream primer with a concentration of 10μmol / L, 5μL of 2xTaq PCR MasterMix, and the balance is ddH2O; the program of the first-step PCR amplification is: pre-denaturation at 95°C for 5min, then denaturation at 95°C for 30s, annealing at an annealing temperature of 60°C for 30s, extension at 72°C for 30s, a total of 20 cycles, and then extension at 72°C for 10min to obtain the first-step amplification product; The second-step PCR amplification, with the total volume of the reaction system being 20 μL, is composed of components in the following volumes: 2 μL of the first-step amplification product, 0.15 μL of the downstream primer used in the first-step PCR amplification with a concentration of 10 μmol / L, 0.15 μL of the M13 primer with a concentration of 10 μmol / L, 10 μL of 2x Taq PCR MasterMix, and the balance being ddH2O; the procedure for the second-step PCR amplification is: pre-denaturation at 95°C for 5 min, followed by denaturation at 95°C for 30 s, annealing at an annealing temperature of 52°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles, and then extension at 72°C for 10 min; the nucleotide sequence of the M13 primer is shown as TGTAAAACGACGGCCAGT in SEQ ID NO.15.

[0014] Advantages of the invention: 1. The 7 pairs of SSR primer sets provided by the present invention have good amplification efficiency, can amplify bands in various sources and individuals, and have high polymorphism; they can accurately distinguish individual ancient trees and Ehretia dicksonii populations from different sources. Based on the Ehretia dicksonii genome data, the present invention screened a total of 212,767 SSR loci with dinucleotide to hexanucleotide repeat motifs, designed and synthesized 192 pairs of primers. Using germplasm materials of Ehretia dicksonii from 8 different geographical sources, through PCR amplification, capillary electrophoresis analysis and polymorphism evaluation, 7 pairs of high-quality SSR primer sets were screened out. These primers have good amplification efficiency, polymorphism and band peak type stability, and are suitable for molecular identification and genetic diversity analysis. Using the 7 pairs of primer sets of the present invention, accurate molecular identification can be carried out on 6 ancient tree samples, and 48 population individuals of Ehretia dicksonii in Luoyang can be effectively distinguished.

[0015] 2. The present invention provides important technical support for the protection, utilization and genetic research of Ehretia dicksonii germplasm resources. The method for screening primer sets for Ehretia dicksonii genome SSR markers of the present invention is efficient and stable, and is suitable for molecular breeding, germplasm resource protection and genetic research. Description of the drawings

[0016] Figure 1 : Molecular identification results of 6 Ehretia dicksonii ancient trees using 7 pairs of primer pairs for Ehretia dicksonii genome SSR markers screened by the method of the present invention. Detailed implementation manners

[0017] The following further illustrates the present invention through examples, but does not limit the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are usually conventional means well known to those skilled in the art. Example

[0018] The screening method of the primer group for the SSR marker of the Ehretia dicksonii genome of the present invention comprises the following steps: (1) Download the Ehretia dicksonii genome data from the NCBI database, then use the MISA software to obtain the sequence segments where all repetitive sequences are located, and establish a repetitive sequence database as the original gene database of the target Ehretia dicksonii sample; (2) Conduct SSR locus search on the original gene database described in step (1), where the repeat numbers of mono-, di-, tri-, tetra-, penta-, and hexa-nucleotides are at least 10, 6, 5, 5, 5, and 5 times respectively; (3) Take the upstream and downstream sequences of the SSR locus obtained by the search in step (2) as the target sequences, use Primer5.0 to design PCR primers for the target sequences, and generate candidate primers; (4) Select 8 Ehretia dicksonii samples from different geographical sources respectively, extract DNA as the template, use the candidate primers for PCR amplification, subject the amplified products to capillary electrophoresis and typing, and then use the GeneMarker software for band analysis to preliminarily screen out the primary screening PCR primers that can amplify the target sequences in step (3); then extract the DNA of 48 Ehretia dicksonii with different provenances from the target Ehretia dicksonii as the template, use the primary screening PCR primers for PCR amplification, subject the amplified products to capillary electrophoresis and typing, and use the GeneMarker software for band analysis to screen out the primers that can amplify the target sequences in step (3), and thus obtain the primer group for the SSR marker of the Ehretia dicksonii genome.

[0019] Two-step PCR amplification is adopted, and the two-step PCR amplification comprises the following steps: The first-step PCR amplification, the total volume of the reaction system is 10 μL, and it consists of the following components by volume: 1 μL of the template with a concentration of 20 ng / μL, 0.1 μL of the upstream primer with a concentration of 10 μmol / L, 0.1 μL of the downstream primer with a concentration of 10 μmol / L, 5 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; the program of the first-step PCR amplification is: pre-denaturation at 95°C for 5 min, then denaturation at 95°C for 30 s, annealing at an annealing temperature of 60°C for 30 s, extension at 72°C for 30 s, a total of 20 cycles, and then extension at 72°C for 10 min to obtain the first-step amplification product; The second-step PCR amplification is carried out with a total reaction volume of 20 μL, and it consists of components in the following volumes: 2 μL of the first-step amplification product, 0.15 μL of the downstream primer used in the first-step PCR amplification with a concentration of 10 μmol / L, 0.15 μL of the M13 primer with a concentration of 10 μmol / L, 10 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; the procedure for the second-step PCR amplification is: pre-denaturation at 95 °C for 5 min, then denaturation at 95 °C for 30 s, annealing at an annealing temperature of 52 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles, and then extension at 72 °C for 10 min; the nucleotide sequence of the M13 primer is shown as TGTAAAACGACGGCCAGT in SEQ ID NO.15.

[0020] The following 7 pairs of primers are screened according to the method described in this example: Primer pair A, the nucleotide sequence of its upstream primer is shown as TGGTGAAGATGAAGGTGAGGATG in SEQ ID NO.1, and the nucleotide sequence of its downstream primer is shown as CTTGTCAAACTGGGATTTGGGAC in SEQ ID NO.2; Primer pair B, the nucleotide sequence of its upstream primer is shown as CGGGGTTGAGTAAGTGCTAGATT in SEQ ID NO.3, and the nucleotide sequence of its downstream primer is shown as AACAATGGGGACTAACCGTAGAC in SEQ ID NO.4; Primer pair C, the nucleotide sequence of its upstream primer is shown as TCTCGTTTCTCTCTCCACAGTTC in SEQ ID NO.5, and the nucleotide sequence of its downstream primer is shown as TAAAGTGTAGTACCCCACACACC in SEQ ID NO.6; Primer pair D, the nucleotide sequence of its upstream primer is shown as ACAACACCAGTGATCACTACCTC in SEQ ID NO.7, and the nucleotide sequence of its downstream primer is shown as GCTTCTTGTTTTGCTATTCGGGT in SEQ ID NO.8.

[0021] Primer pair E, the nucleotide sequence of its upstream primer is shown as GGGAGAAGAATGTGGAGTCCATT in SEQ ID NO.9, and the nucleotide sequence of its downstream primer is shown as CACACATACACACGGATTTCACC in SEQ ID NO.10; Primer pair F, the nucleotide sequence of its upstream primer is shown as AGTGCGGATGGTTTGTATCTGAT in SEQ ID NO.11, and the nucleotide sequence of its downstream primer is shown as GTCATTGCACTTGGATGAAGCTT in SEQ ID NO.12; Primer pair G, the nucleotide sequence of its upstream primer is shown as TTGGATGGCATGAACACAGAAAC in SEQ ID NO.13, and the nucleotide sequence of its downstream primer is shown as GTGTCGTAGTTTAATGCCTTCGG in SEQ ID NO.14.

[0022] Polymorphism analysis was carried out on the 7 primer pairs for Ehretia dicksonii genome SSR markers screened by the method described in Example 1, and the results are shown in Table 1.

[0023] Table 1 Polymorphism analysis table of Ehretia dicksonii genome SSR markers According to the above structural analysis, the number of polymorphic bands of the 7 primer pairs is between 6 and 14. On average, each primer pair amplified 10.42 polymorphic bands, and the polymorphism ratio of each primer was 100.00%. The polymorphism information content ranges from 0.768 to 0.891, which fully proves that the genome SSR markers have relatively rich genetic polymorphisms in Ehretia dicksonii germplasm. 48 Ehretia dicksonii germplasms can be effectively distinguished by using 7 primer pairs. Example

[0024] Molecular identification of Ehretia dicksonii ancient tree SSR markers using the primer pairs of Ehretia dicksonii genome SSR markers of the present invention: (1) Genomic DNA of 6 Ehretia dicksonii ancient trees was extracted. The 6 Ehretia dicksonii ancient trees are XY5 (Wolong Town, Xiangcheng District, Xiangyang City, 31.972368°N 111.863584°E), XY6 (Changping Town, Nanzhang County, Xiangyang City, 31.790974°N 111.55402°E), HY4 (Huaqiao Town, Hengnan County, Hengyang City, 26.874289°N 113.031122°E), HY7 (Liaotian Town, Hengnan County, Hengyang City, 26.687418°N 112.70118°E), JUTING (Villagers' Committee of Heishui Village, Ningqiang County, 33.042584°N 106.081717°E), XICHUAN (Madeng Town, Zhechuan County, Nanyang City, 32.854952°N 111.637663°E).

[0025] (2) The 7 primer pairs for Ehretia dicksonii genome SSR markers screened by the method described in Example 1 were used for the molecular identification of the 6 Ehretia dicksonii ancient trees in (1). PCR amplification was carried out, and the amplified products were subjected to capillary electrophoresis and typing, and band analysis was carried out using GeneMarker software. The PCR amplification is a two-step PCR amplification, and the two-step PCR amplification includes the following steps: The first-step PCR amplification, the total volume of the reaction system is 10 μL, and it consists of components in the following volumes: 1 μL of a template with a concentration of 20 ng / μL, 0.1 μL of an upstream primer with a concentration of 10 μmol / L, 0.1 μL of a downstream primer with a concentration of 10 μmol / L, 5 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; the procedure of the first-step PCR amplification is: pre-denaturation at 95 °C for 5 min, then denaturation at 95 °C for 30 s, annealing at an annealing temperature of 60 °C for 30 s, extension at 72 °C for 30 s, a total of 20 cycles, and then extension at 72 °C for 10 min to obtain the first-step amplification product; The second-step PCR amplification, the total volume of the reaction system is 20 μL, and it consists of components in the following volumes: 2 μL of the first-step amplification product, 0.15 μL of the downstream primer used in the first-step PCR amplification with a concentration of 10 μmol / L, 0.15 μL of the M13 primer with a concentration of 10 μmol / L, 10 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; the procedure of the second-step PCR amplification is: pre-denaturation at 95 °C for 5 min, then denaturation at 95 °C for 30 s, annealing at an annealing temperature of 52 °C for 30 s, extension at 72 °C for 30 s, a total of 35 cycles, and then extension at 72 °C for 10 min; the nucleotide sequence of the M13 primer is shown as TGTAAAACGACGGCCAGT in SEQ ID NO.15.

[0026] (3) The 7 pairs of primers for the SSR markers of the Ehretia dicksonii genome screened by the method described in Example 1 can effectively distinguish 6 ancient Ehretia dicksonii trees, and the results are shown in Figure 1 .

Claims

1. A primer set for SSR markers of the Ehretia dicksonii genome, characterized in that, Comprising at least one of the following primer pairs: Primer pair A, wherein the nucleotide sequence of the upstream primer is shown as TGGTGAAGATGAAGGTGAGGATG in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as CTTGTCAAACTGGGATTTGGGAC in SEQ ID NO.2; Primer pair B, wherein the nucleotide sequence of the upstream primer is shown as CGGGGTTGAGTAAGTGCTAGATT in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown as AACAATGGGGACTAACCGTAGAC in SEQ ID NO.4; Primer pair C, wherein the nucleotide sequence of the upstream primer is shown as TCTCGTTTCTCTCTCCACAGTTC in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown as TAAAGTGTAGTACCCCACACACC in SEQ ID NO.6; Primer pair D, wherein the nucleotide sequence of the upstream primer is shown as ACAACACCAGTGATCACTACCTC in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown as GCTTCTTGTTTTGCTATTCGGGT in SEQ ID NO.8; Primer pair E, wherein the nucleotide sequence of the upstream primer is shown as GGGAGAAGAATGTGGAGTCCATT in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown as CACACATACACACGGATTTCACC in SEQ ID NO.10; Primer pair F, wherein the nucleotide sequence of the upstream primer is shown as AGTGCGGATGGTTTGTATCTGAT in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown as GTCATTGCACTTGGATGAAGCTT in SEQ ID NO.12; Primer pair G, wherein the nucleotide sequence of the upstream primer is shown as TTGGATGGCATGAACACAGAAAC in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown as GTGTCGTAGTTTAATGCCTTCGG in SEQ ID NO.

14.

2. Use of the primer set according to claim 1 in any one of the following (1)-(4): (1) Molecular identification of the Ehretia dicksonii variety; (2) Genetic diversity analysis of the Ehretia dicksonii variety; (3) Analysis of the genetic relationship of the Ehretia dicksonii variety; (4) Molecular marker-assisted breeding of Ehretia dicksonii.

3. A kit for SSR markers of the Ehretia dicksonii genome, characterized in that: The kit uses the primer set according to claim 1, which includes any one or a combination of primer pair A, primer pair B, primer pair C, primer pair D, primer pair E, primer pair F, and primer pair G.

4. The screening method of the primer set according to claim 1, characterized in that Comprising the following steps: (1) Obtaining the original genomic database of the target Ehretia dicksonii sample; (2)Search for SSR loci in the original genomic database described in step (1), where the number of repeats of mono-, di-, tri-, tetra-, penta-, and hexanucleotides is at least 10, 6, 5, 5, 5, and 5 times, respectively; (3)Use the upstream and downstream sequences of the SSR loci obtained in step (2) as target sequences, and use Primer5.0 to design PCR primers for the target sequences and generate candidate primers; (4)Select 8 samples of Ehretia dicksonii from different geographical sources respectively, extract DNA as a template, perform PCR amplification using the candidate primers, subject the amplified products to capillary electrophoresis and genotyping, and then use GeneMarker software for band analysis to preliminarily screen out the preliminary screening PCR primers that can amplify the target sequences in step (3); then extract the DNA of Ehretia dicksonii from different provenances different from the target Ehretia dicksonii as a template, perform PCR amplification using the preliminary screening PCR primers, subject the amplified products to capillary electrophoresis and genotyping, and then use GeneMarker software for band analysis to screen out the primers that can amplify the target sequences in step (3), that is, obtain the primer set for genomic SSR markers of Ehretia dicksonii.

5. The primer set screening method according to claim 4, wherein: In step (1), download the genomic data of Ehretia dicksonii, use MISA software to obtain the sequence segments where all repetitive sequences are located, and establish a repetitive sequence database as the original gene database of the target Ehretia dicksonii sample.

6. The primer set screening method according to claim 4 or 5, characterized in that: In step (1), the target Ehretia dicksonii sample is the rooted tissue culture seedlings of the target Ehretia dicksonii or the leaves of the plants of the target Ehretia dicksonii; the Ehretia dicksonii samples in step (4) are the leaves of Ehretia dicksonii plants.

7. The primer set screening method according to claim 6, characterized in that: In step (4), extract more than 48 Ehretia dicksonii from different sources from the target Ehretia dicksonii and perform PCR amplification using the preliminary screening PCR primers respectively.

8. The primer set screening method according to claim 4, 5 or 7, characterized in that: In step (3), the design parameters of the candidate primers are: primer length is 20 bp, GC content is 35% - 60%, annealing temperature is 60 °C, and the expected fragment length of the PCR amplification product is 100 bp - 200 bp.

9. The primer set screening method according to claim 4, 5 or 7, characterized in that: In step (4), perform PCR amplification using a two-step method, which includes the following steps: The first-step PCR amplification, the total volume of the reaction system is 10 μL and is composed of the following components by volume: 1 μL of the template with a concentration of 20 ng / μL, 0.1 μL of the upstream primer with a concentration of 10 μmol / L, 0.1 μL of the downstream primer with a concentration of 10 μmol / L, 5 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; the program of the first-step PCR amplification is: pre-denaturation at 95 °C for 5 min, then denaturation at 95 °C for 30 s, annealing at an annealing temperature of 60 °C for 30 s, extension at 72 °C for 30 s, a total of 20 cycles, and then extension at 72 °C for 10 min to obtain the first-step amplification product; Second-step PCR amplification: The total volume of the reaction system is 20 μL and it consists of components in the following volumes: 2 μL of the first-step amplification product, 0.15 μL of the downstream primer used in the first-step PCR amplification with a concentration of 10 μmol / L, 0.15 μL of the M13 primer with a concentration of 10 μmol / L, 10 μL of 2x Taq PCR MasterMix, and the balance is ddH2O; The procedure for the second-step PCR amplification is: pre-denaturation at 95 °C for 5 min, followed by denaturation at 95 °C for 30 s, annealing at an annealing temperature of 52 °C for 30 s, extension at 72 °C for 30 s, for a total of 35 cycles, and then extension at 72 °C for 10 min; The nucleotide sequence of the M13 primer is shown as TGTAAAACGACGGCCAGT in SEQ ID NO.15.